Starting /dee2/code/volunteer_pipeline.sh SRR7473319 current disk space = 1543215857664 free memory = 1601497060 SRR7473319 SRAfilesize 06c89e55c3d341dacd4a771008a55bc2 SRR7473319.sra SRR7473319.sra file validated SRR7473319 is paired end SRR7473319 is conventional basespace SRR7473319 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473319_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36125 34.0 33.0 34.0 33.0 34.0 2 33.478 34.0 34.0 34.0 33.0 34.0 3 33.4645 34.0 34.0 34.0 33.0 34.0 4 33.441 34.0 34.0 34.0 33.0 34.0 5 33.371 34.0 34.0 34.0 33.0 34.0 6 37.118 38.0 38.0 38.0 36.0 38.0 7 37.37825 38.0 38.0 38.0 37.0 38.0 8 37.38575 38.0 38.0 38.0 37.0 38.0 9 37.46875 38.0 38.0 38.0 37.0 38.0 10-14 37.43125 38.0 38.0 38.0 37.4 38.0 15-19 37.426849999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.4633 38.0 38.0 38.0 37.0 38.0 25-29 37.27875 38.0 38.0 38.0 37.0 38.0 30-34 37.02095 38.0 38.0 38.0 36.0 38.0 35-39 36.984750000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.874100000000006 38.0 38.0 38.0 35.2 38.0 45-49 36.9205 38.0 38.0 38.0 35.4 38.0 50-54 36.70115 38.0 38.0 38.0 34.8 38.0 55-59 36.80425 38.0 38.0 38.0 34.8 38.0 60-64 36.861000000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.59915 38.0 38.0 38.0 34.2 38.0 70-74 36.39755 38.0 38.0 38.0 34.0 38.0 75-79 36.428999999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.467 38.0 38.0 38.0 33.8 38.0 85-89 36.286649999999995 38.0 37.4 38.0 33.8 38.0 90-94 35.90024999999999 38.0 37.0 38.0 32.2 38.0 95-99 35.674099999999996 38.0 36.4 38.0 31.0 38.0 100-104 35.42295 38.0 36.0 38.0 30.0 38.0 105-109 35.3101 38.0 36.0 38.0 29.2 38.0 110-114 34.938300000000005 38.0 35.4 38.0 27.8 38.0 115-119 34.528850000000006 38.0 35.0 38.0 25.8 38.0 120-124 34.39925000000001 38.0 34.8 38.0 25.4 38.0 125-129 33.75775 38.0 34.0 38.0 23.0 38.0 130-134 33.2459 38.0 34.0 38.0 16.2 38.0 135-139 32.78175 37.8 33.6 38.0 14.6 38.0 140-144 32.11705 37.0 33.0 38.0 14.0 38.0 145-149 31.116300000000003 36.0 31.4 38.0 8.6 38.0 150-151 26.545125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 6.0 17 5.0 18 5.0 19 11.0 20 14.0 21 8.0 22 12.0 23 14.0 24 11.0 25 27.0 26 30.0 27 23.0 28 34.0 29 61.0 30 77.0 31 87.0 32 98.0 33 148.0 34 227.0 35 404.0 36 947.0 37 1744.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5061295971979 12.284213159869903 10.257693269952464 35.95196397297973 2 26.8 16.825000000000003 32.175 24.2 3 22.5 23.200000000000003 24.575 29.725 4 25.874999999999996 29.2 22.3 22.625 5 26.875 31.75 21.349999999999998 20.025000000000002 6 22.05 32.975 22.75 22.225 7 16.45 22.15 40.65 20.75 8 20.474999999999998 21.224999999999998 27.900000000000002 30.4 9 20.8 19.85 31.85 27.500000000000004 10-14 23.375 25.485000000000003 24.9 26.240000000000002 15-19 23.485 25.224999999999998 25.365 25.924999999999997 20-24 23.674999999999997 25.14 25.09 26.095000000000002 25-29 23.625162776720423 24.937393569067414 25.783832515275968 25.653611138936196 30-34 23.375 24.86 25.755 26.009999999999998 35-39 23.872161648494547 25.027508252475744 25.012503751125337 26.087826347904368 40-44 23.865285492668768 25.381574338187455 24.67097032477606 26.082169844367716 45-49 24.13586113751188 25.3564103846731 24.86618978540343 25.641538692411586 50-54 23.91 24.685000000000002 25.03 26.375 55-59 23.87 24.8 24.965 26.365 60-64 23.535 24.89 25.66 25.915 65-69 23.39 24.32 25.585 26.705000000000002 70-74 24.135 25.035 24.990000000000002 25.840000000000003 75-79 24.19 24.165 25.314999999999998 26.33 80-84 23.294999999999998 24.775 25.605 26.325 85-89 24.545 23.935000000000002 25.19 26.33 90-94 23.967107902125953 24.548736462093864 25.426193341355795 26.057962294424385 95-99 24.231791067221415 24.08140758935285 25.424833324978696 26.26196801844704 100-104 23.995 24.404999999999998 25.724999999999998 25.874999999999996 105-109 24.275 24.595 24.89 26.240000000000002 110-114 24.02 24.610000000000003 24.905 26.465 115-119 24.709999999999997 24.75 24.365000000000002 26.174999999999997 120-124 24.719663596315577 25.070084100921104 24.75470564677613 25.45554665598718 125-129 24.408224674022065 24.488465396188566 24.809428284854565 26.293881644934803 130-134 25.309734513274336 24.844500632111252 24.217446270543615 25.628318584070797 135-139 23.971667088287376 25.094864659752087 24.371363521376168 26.56210473058437 140-144 25.01254894086939 24.922196566609777 24.51561088244152 25.549643610079308 145-149 24.76944010482286 24.991180769036937 24.5023433956559 25.737035730484305 150-151 24.79286969620889 24.328395681647 24.71754958573939 26.16118503640472 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 2.0 29 3.0 30 6.5 31 12.5 32 16.0 33 23.5 34 30.5 35 35.5 36 48.5 37 62.0 38 76.0 39 89.0 40 114.0 41 148.0 42 166.5 43 171.5 44 181.0 45 206.5 46 196.0 47 174.5 48 166.0 49 156.0 50 151.0 51 142.5 52 131.5 53 127.0 54 110.0 55 94.5 56 99.0 57 94.5 58 90.5 59 86.5 60 95.5 61 92.0 62 74.5 63 69.5 64 66.0 65 59.5 66 53.0 67 42.5 68 40.0 69 41.0 70 36.0 71 35.0 72 27.0 73 17.5 74 14.0 75 8.5 76 2.5 77 1.5 78 3.5 79 3.0 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.16999999999999998 30-34 0.0 35-39 0.03 40-44 0.08499999999999999 45-49 0.045 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.27999999999999997 95-99 0.255 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.12 125-129 0.3 130-134 1.125 135-139 1.175 140-144 0.38999999999999996 145-149 0.7849999999999999 150-151 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.0625 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.9 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGACT 10 0.0069393674 144.2375 5 >>END_MODULE SRR7473319 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473319_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.226 33.0 33.0 34.0 32.0 34.0 2 32.20825 33.0 33.0 34.0 32.0 34.0 3 32.21825 33.0 33.0 34.0 32.0 34.0 4 32.1075 34.0 33.0 34.0 31.0 34.0 5 32.30275 34.0 33.0 34.0 32.0 34.0 6 36.21475 38.0 38.0 38.0 35.0 38.0 7 36.51675 38.0 38.0 38.0 35.0 38.0 8 36.6725 38.0 38.0 38.0 36.0 38.0 9 36.66775 38.0 38.0 38.0 35.0 38.0 10-14 36.65915 38.0 38.0 38.0 36.0 38.0 15-19 36.4373 38.0 38.0 38.0 35.6 38.0 20-24 36.302749999999996 38.0 38.0 38.0 35.0 38.0 25-29 36.28775 38.0 38.0 38.0 34.8 38.0 30-34 36.303399999999996 38.0 38.0 38.0 35.0 38.0 35-39 36.23535 38.0 38.0 38.0 35.0 38.0 40-44 36.2981 38.0 38.0 38.0 34.8 38.0 45-49 36.101600000000005 38.0 38.0 38.0 34.4 38.0 50-54 36.09925 38.0 38.0 38.0 34.2 38.0 55-59 36.108000000000004 38.0 38.0 38.0 34.0 38.0 60-64 35.98025 38.0 38.0 38.0 33.8 38.0 65-69 35.6105 38.0 38.0 38.0 33.0 38.0 70-74 35.7786 38.0 38.0 38.0 33.2 38.0 75-79 35.764599999999994 38.0 38.0 38.0 33.0 38.0 80-84 35.7028 38.0 38.0 38.0 33.0 38.0 85-89 35.55630000000001 38.0 38.0 38.0 32.2 38.0 90-94 35.3429 38.0 37.2 38.0 30.6 38.0 95-99 34.83685 38.0 36.8 38.0 28.0 38.0 100-104 34.2215 38.0 36.0 38.0 23.8 38.0 105-109 33.92725 38.0 35.2 38.0 21.4 38.0 110-114 33.7325 38.0 35.0 38.0 17.8 38.0 115-119 33.365449999999996 38.0 35.0 38.0 15.0 38.0 120-124 33.1706 38.0 34.2 38.0 15.0 38.0 125-129 32.7967 38.0 34.0 38.0 14.2 38.0 130-134 32.41785 38.0 33.4 38.0 13.6 38.0 135-139 32.13955 38.0 33.0 38.0 13.2 38.0 140-144 31.390449999999998 38.0 31.2 38.0 10.8 38.0 145-149 30.33535 37.8 31.0 38.0 2.0 38.0 150-151 25.13275 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 20.0 4 16.0 5 3.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 2.0 12 3.0 13 8.0 14 3.0 15 13.0 16 8.0 17 11.0 18 13.0 19 15.0 20 10.0 21 13.0 22 19.0 23 30.0 24 33.0 25 33.0 26 22.0 27 34.0 28 39.0 29 33.0 30 69.0 31 88.0 32 110.0 33 128.0 34 188.0 35 328.0 36 646.0 37 2017.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.593392630241425 16.64548919949174 11.766200762388818 31.994917407878017 2 30.3293336737299 22.08322695940771 25.96374776614756 21.623691600714835 3 23.49936143039591 24.214559386973182 27.68837803320562 24.597701149425287 4 25.748656257998466 31.71231123624264 18.83798310724341 23.701049398515487 5 27.944162436548226 32.36040609137056 18.98477157360406 20.710659898477157 6 22.440142638818138 33.6474783494651 19.740193581253184 24.17218543046358 7 22.149011657374558 16.90319310694374 36.3659401926001 24.581855043081603 8 22.831279859190346 21.49861704802615 22.982147347246666 32.68795574553683 9 23.56639839034205 21.88128772635815 25.528169014084508 29.02414486921529 10-14 25.8309448383366 24.86549001860512 23.336853220696938 25.96671192236134 15-19 25.674852851633855 24.533184493606658 23.741627765374467 26.050334889385024 20-24 25.503765520048848 24.903317728475475 24.00264604111541 25.59027071036027 25-29 25.93757929459528 24.9632073077899 23.755392032479065 25.343821365135753 30-34 25.895260832021133 24.5695128765175 24.178391832173514 25.356834459287853 35-39 26.966406688076667 24.381913646327167 23.454146913391448 25.197532752204722 40-44 26.069091462486682 25.32339065591234 23.588494901841425 25.019022979759548 45-49 26.510512349459077 24.698918146560523 23.515003061849356 25.275566442131048 50-54 26.087620210654862 24.48989976085076 24.32198646517071 25.100493563323667 55-59 26.08850096417335 24.76910585608444 23.601948645082715 25.540444534659496 60-64 25.79938900203666 24.725050916496947 23.976578411405296 25.4989816700611 65-69 26.601313898583452 24.173680969000205 23.73742557996305 25.487579552453294 70-74 26.26503578135309 24.904836826879155 23.36699994924631 25.463127442521444 75-79 26.46939602756384 24.751722740170248 23.789014997973247 24.989866234292663 80-84 26.33340093287366 24.711011965118637 24.13303589535591 24.822551206651795 85-89 26.055092241597173 25.089714430123834 23.88172858225929 24.97346474601971 90-94 26.42121811450885 24.625995233023986 23.774025051980324 25.178761600486837 95-99 25.842581175503494 24.77907932593506 24.208795725441842 25.169543773119607 100-104 26.879825879670417 24.729232523190134 23.8638130279318 24.527128569207648 105-109 26.61302880872048 24.81702569426421 23.498572540877237 25.07137295613807 110-114 26.66112093168348 24.794634501403763 23.92118124155142 24.62306332536134 115-119 26.276728254100064 24.968860286485363 24.070998546813367 24.683412912601206 120-124 26.937231120095372 25.299331363707044 23.5940496553154 24.169387860882185 125-129 26.651162790697676 25.02842377260982 23.617571059431526 24.702842377260982 130-134 26.957552029672367 24.76303317535545 24.11395013393777 24.16546466103441 135-139 26.618189266693975 25.266284309709135 24.13457599344531 23.980950430151577 140-144 26.63115845539281 24.9308614155485 24.07559151900031 24.36238861005838 145-149 26.922678811717216 25.271711003001762 23.667322223372324 24.138287961908706 150-151 27.318652849740932 25.51813471502591 22.655440414507773 24.507772020725387 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 10.5 2 6.5 3 4.0 4 4.5 5 3.0 6 4.0 7 4.0 8 3.5 9 2.5 10 1.0 11 1.0 12 1.0 13 0.5 14 1.5 15 1.5 16 0.0 17 0.5 18 1.0 19 2.0 20 1.5 21 1.0 22 2.0 23 2.5 24 1.5 25 4.0 26 4.5 27 2.0 28 2.5 29 3.5 30 8.0 31 10.5 32 12.0 33 15.5 34 20.5 35 29.5 36 38.0 37 48.0 38 70.5 39 86.5 40 96.0 41 114.5 42 137.0 43 161.0 44 160.0 45 152.0 46 149.0 47 161.0 48 172.5 49 163.0 50 148.0 51 129.5 52 119.0 53 115.0 54 110.5 55 106.0 56 104.0 57 99.0 58 97.0 59 102.5 60 98.5 61 89.5 62 92.5 63 87.5 64 81.5 65 81.0 66 75.0 67 63.0 68 55.5 69 55.0 70 50.5 71 43.5 72 32.5 73 23.0 74 21.0 75 16.0 76 6.0 77 2.0 78 3.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 2.075 3 2.125 4 2.325 5 1.5 6 1.8499999999999999 7 1.35 8 0.575 9 0.6 10-14 0.565 15-19 1.46 20-24 1.7399999999999998 25-29 1.4749999999999999 30-34 1.5650000000000002 35-39 1.915 40-44 1.435 45-49 2.02 50-54 1.735 55-59 1.47 60-64 1.7999999999999998 65-69 2.58 70-74 1.485 75-79 1.32 80-84 1.38 85-89 1.075 90-94 1.405 95-99 2.68 100-104 3.515 105-109 3.675 110-114 3.83 115-119 3.66 120-124 3.535 125-129 3.25 130-134 2.94 135-139 2.36 140-144 2.37 145-149 3.39 150-151 3.5000000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91001267427123 97.55 2 0.8871989860583016 1.7500000000000002 3 0.12674271229404308 0.375 4 0.050697084917617236 0.2 5 0.025348542458808618 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.4125 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAAG 10 0.0069557517 144.07692 5 ATCGGAA 35 0.0034008608 20.849722 125-129 CGTCGTG 40 0.0073626977 18.243507 135-139 >>END_MODULE Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320825 spots for SRR7473319.sra Written 1320825 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra Read 1320816 spots for SRR7473319.sra Written 1320816 spots for SRR7473319.sra SRR ids: ['SRR7473319.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z7gk398n SRR7473319.sra spots: 26416329 blocks: [[1, 1320816], [1320817, 2641632], [2641633, 3962448], [3962449, 5283264], [5283265, 6604080], [6604081, 7924896], [7924897, 9245712], [9245713, 10566528], [10566529, 11887344], [11887345, 13208160], [13208161, 14528976], [14528977, 15849792], [15849793, 17170608], [17170609, 18491424], [18491425, 19812240], [19812241, 21133056], [21133057, 22453872], [22453873, 23774688], [23774689, 25095504], [25095505, 26416329]] SRR7473319 file size 8929926 SRR7473319 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473319 SRR7473319_1.fastq SRR7473319_2.fastq Input file: SRR7473319_1.fastq Paired file: SRR7473319_2.fastq trimmed: SRR7473319-trimmed-pair1.fastq, SRR7473319-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:18:35 2024 >> started Sat Dec 7 13:19:39 2024 >> done (64.444s) 26416329 read pairs processed; of these: 47633 ( 0.18%) short read pairs filtered out after trimming by size control 68582 ( 0.26%) empty read pairs filtered out after trimming by size control 26300114 (99.56%) read pairs available; of these: 14786736 (56.22%) trimmed read pairs available after processing 11513378 (43.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 27 0.00% 20 16 0.00% 21 24 0.00% 22 32 0.00% 23 27 0.00% 24 27 0.00% 25 30 0.00% 26 43 0.00% 27 47 0.00% 28 38 0.00% 29 37 0.00% 30 45 0.00% 31 46 0.00% 32 44 0.00% 33 54 0.00% 34 51 0.00% 35 58 0.00% 36 67 0.00% 37 69 0.00% 38 60 0.00% 39 74 0.00% 40 88 0.00% 41 104 0.00% 42 111 0.00% 43 98 0.00% 44 136 0.00% 45 143 0.00% 46 140 0.00% 47 132 0.00% 48 168 0.00% 49 200 0.00% 50 205 0.00% 51 223 0.00% 52 246 0.00% 53 265 0.00% 54 314 0.00% 55 332 0.00% 56 387 0.00% 57 419 0.00% 58 497 0.00% 59 460 0.00% 60 577 0.00% 61 623 0.00% 62 673 0.00% 63 801 0.00% 64 856 0.00% 65 891 0.00% 66 1028 0.00% 67 1158 0.00% 68 1263 0.00% 69 1545 0.01% 70 1739 0.01% 71 1744 0.01% 72 1889 0.01% 73 2217 0.01% 74 2331 0.01% 75 2680 0.01% 76 2892 0.01% 77 3143 0.01% 78 3423 0.01% 79 3768 0.01% 80 4152 0.02% 81 4595 0.02% 82 5359 0.02% 83 6185 0.02% 84 7743 0.03% 85 8735 0.03% 86 9114 0.03% 87 9491 0.04% 88 10102 0.04% 89 10457 0.04% 90 11154 0.04% 91 12094 0.05% 92 13091 0.05% 93 13973 0.05% 94 15310 0.06% 95 16249 0.06% 96 17142 0.07% 97 17711 0.07% 98 18290 0.07% 99 19525 0.07% 100 20851 0.08% 101 21812 0.08% 102 22971 0.09% 103 24638 0.09% 104 26124 0.10% 105 28010 0.11% 106 29460 0.11% 107 30434 0.12% 108 31839 0.12% 109 33589 0.13% 110 34528 0.13% 111 35856 0.14% 112 38221 0.15% 113 40544 0.15% 114 42787 0.16% 115 45361 0.17% 116 46712 0.18% 117 48509 0.18% 118 49732 0.19% 119 52020 0.20% 120 54036 0.21% 121 57117 0.22% 122 59788 0.23% 123 63005 0.24% 124 67363 0.26% 125 69099 0.26% 126 72043 0.27% 127 74716 0.28% 128 78109 0.30% 129 81952 0.31% 130 85898 0.33% 131 90173 0.34% 132 95247 0.36% 133 101006 0.38% 134 106949 0.41% 135 114855 0.44% 136 122566 0.47% 137 131255 0.50% 138 140468 0.53% 139 151840 0.58% 140 165863 0.63% 141 184836 0.70% 142 206650 0.79% 143 237402 0.90% 144 277791 1.06% 145 337173 1.28% 146 424503 1.61% 147 579584 2.20% 148 886496 3.37% 149 1716243 6.53% 150 6977394 26.53% 151 11513378 43.78% 26300114 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=14 prefix-density=1.00 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=26 fanout-score=12.05 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=11 prefix-density=0.76 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=94.29 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473319 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:20:33 Started mapping on | Dec 07 13:20:33 Finished on | Dec 07 13:23:57 Mapping speed, Million of reads per hour | 464.12 Number of input reads | 26300114 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 25100251 Uniquely mapped reads % | 95.44% Average mapped length | 293.68 Number of splices: Total | 26953927 Number of splices: Annotated (sjdb) | 25491849 Number of splices: GT/AG | 26602463 Number of splices: GC/AG | 311605 Number of splices: AT/AC | 14656 Number of splices: Non-canonical | 25203 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231676 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 31252 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 991916 991916 991916 N_multimapping 231676 231676 231676 N_noFeature 797746 24343888 1073698 N_ambiguous 567006 3411 87984 UnstrandedReadsAssigned:23735499 PositiveStrandReadsAssigned:752952 NegativeStrandReadsAssigned:23938569 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7473319 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473319-trimmed-pair1.fastq SRR7473319-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,300,114 reads, 24,023,316 reads pseudoaligned [quant] estimated average fragment length: 289.378 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR7473319.ke.tsv 35125 SRR7473319.se.tsv 88098 total ==> SRR7473319.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 648.477 23.8186 2.14432 PNS24247 1044 755.622 56.1197 4.3359 PNS24249 1928 1639.62 69.704 2.48189 PNS24246 1044 755.622 56.1197 4.3359 PNS24248 1044 755.622 56.1197 4.3359 PNS24244 1471 1182.62 53.1183 2.62221 PNS24243 293 85.5777 0 0 KQK14069 1603 1314.62 1055.56 46.8762 KQK14071 474 216.331 3.36304 0.907575 ==> SRR7473319.se.tsv <== BRADI_1g14170v3 1079 BRADI_1g53295v3 262 BRADI_1g59795v3 635 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 3035 BRADI_1g74790v3 64 BRADI_1g09890v3 1 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR7473319 completed mapping pipeline successfully