Starting /dee2/code/volunteer_pipeline.sh SRR7473320 current disk space = 1543218466816 free memory = 1598818804 SRR7473320 SRAfilesize b226f497e06beddf3a23b6b7537e4408 SRR7473320.sra SRR7473320.sra file validated SRR7473320 is paired end SRR7473320 is conventional basespace SRR7473320 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473320_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35675 34.0 33.0 34.0 33.0 34.0 2 33.41625 34.0 34.0 34.0 33.0 34.0 3 33.45725 34.0 34.0 34.0 33.0 34.0 4 33.455 34.0 34.0 34.0 33.0 34.0 5 33.496 34.0 34.0 34.0 33.0 34.0 6 37.22875 38.0 38.0 38.0 36.0 38.0 7 37.473 38.0 38.0 38.0 37.0 38.0 8 37.47925 38.0 38.0 38.0 37.0 38.0 9 37.50925 38.0 38.0 38.0 37.0 38.0 10-14 37.467000000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.4618 38.0 38.0 38.0 37.0 38.0 20-24 37.4531 38.0 38.0 38.0 37.0 38.0 25-29 37.28535 38.0 38.0 38.0 37.0 38.0 30-34 37.1947 38.0 38.0 38.0 36.4 38.0 35-39 37.0597 38.0 38.0 38.0 36.0 38.0 40-44 36.70395 38.0 38.0 38.0 34.8 38.0 45-49 36.806999999999995 38.0 38.0 38.0 34.8 38.0 50-54 36.79235 38.0 38.0 38.0 34.8 38.0 55-59 36.84065 38.0 38.0 38.0 34.8 38.0 60-64 36.7503 38.0 38.0 38.0 34.8 38.0 65-69 36.662549999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.4191 38.0 38.0 38.0 33.8 38.0 75-79 36.478249999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.376549999999995 38.0 37.6 38.0 33.8 38.0 85-89 36.16975 38.0 37.0 38.0 33.2 38.0 90-94 35.7277 38.0 36.4 38.0 31.6 38.0 95-99 35.47840000000001 38.0 36.0 38.0 29.8 38.0 100-104 35.49085 38.0 36.0 38.0 30.2 38.0 105-109 35.28525 38.0 35.8 38.0 29.6 38.0 110-114 34.973699999999994 38.0 35.2 38.0 28.0 38.0 115-119 34.6017 38.0 35.0 38.0 26.2 38.0 120-124 34.1418 38.0 34.4 38.0 23.4 38.0 125-129 33.7774 38.0 34.0 38.0 22.4 38.0 130-134 33.1829 38.0 34.0 38.0 18.6 38.0 135-139 32.49015000000001 37.6 33.0 38.0 14.2 38.0 140-144 32.00675 36.4 32.0 38.0 13.8 38.0 145-149 30.662149999999997 36.0 30.4 38.0 8.6 38.0 150-151 25.0865 33.5 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 7.0 18 5.0 19 6.0 20 4.0 21 7.0 22 14.0 23 18.0 24 17.0 25 17.0 26 30.0 27 36.0 28 44.0 29 53.0 30 73.0 31 113.0 32 113.0 33 142.0 34 248.0 35 466.0 36 1029.0 37 1550.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.41197094916103 10.81893313298272 11.369897320310542 42.399198597545706 2 24.7 15.950000000000001 33.975 25.374999999999996 3 21.925 19.325 25.374999999999996 33.375 4 27.200000000000003 25.825 22.375 24.6 5 26.75 30.099999999999998 23.65 19.5 6 21.5 32.95 24.625 20.925 7 17.7 21.45 41.099999999999994 19.75 8 20.150000000000002 21.825 28.775000000000002 29.25 9 20.925 21.099999999999998 31.225 26.75 10-14 23.35 25.245 25.135 26.27 15-19 23.32 25.040000000000003 25.605 26.035000000000004 20-24 22.845 25.180000000000003 26.384999999999998 25.590000000000003 25-29 23.075000000000003 25.014999999999997 25.835 26.075 30-34 23.189999999999998 25.06 25.36 26.39 35-39 23.081540770385192 24.722361180590298 25.68784392196098 26.50825412706353 40-44 23.325820185324318 24.873528675181568 26.000500876533934 25.80015026296018 45-49 23.62862862862863 24.834834834834833 25.415415415415417 26.12112112112112 50-54 23.861193059652983 24.746237311865592 25.44627231361568 25.946297314865742 55-59 23.87 24.82 25.385 25.924999999999997 60-64 23.525 24.88 25.480000000000004 26.115 65-69 23.51617580879044 24.73123656182809 25.85129256462823 25.90129506475324 70-74 24.01 25.09 25.174999999999997 25.724999999999998 75-79 24.486224311215558 24.396219810990548 25.416270813540677 25.701285064253216 80-84 23.875968992248062 24.646161540385098 25.021255313828455 26.456614153538382 85-89 24.219843968793757 24.6999399879976 24.88497699539908 26.195239047809558 90-94 24.253375495658283 24.499322391206142 24.961100235908244 26.286201877227327 95-99 24.09777643929127 24.88079104552527 24.98117753350399 26.040254981679468 100-104 24.43 24.435000000000002 25.069999999999997 26.064999999999998 105-109 24.16 24.81 25.055 25.974999999999998 110-114 24.065 25.169999999999998 25.27 25.495 115-119 23.905 24.310000000000002 25.235000000000003 26.55 120-124 24.485 24.735 24.745 26.035000000000004 125-129 24.128417356408328 25.252069224981188 24.645096563832457 25.974416854778028 130-134 24.591490868619417 24.981028987706786 24.363838721100826 26.063641422572974 135-139 24.482897790333972 24.916759156492784 24.70487337301988 25.895469680153365 140-144 24.661314601103864 25.03763171098846 24.420471650777724 25.880582037129958 145-149 24.003636914684044 25.37253119159469 25.1502752942365 25.47355659948477 150-151 24.8 25.1 24.025 26.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 1.0 26 2.5 27 3.5 28 3.0 29 4.5 30 7.5 31 11.5 32 12.5 33 21.0 34 34.0 35 39.0 36 41.5 37 59.0 38 80.5 39 91.5 40 122.5 41 157.0 42 163.5 43 168.5 44 174.0 45 187.5 46 200.0 47 183.5 48 172.5 49 155.5 50 155.5 51 144.5 52 124.5 53 133.0 54 121.5 55 104.5 56 101.0 57 95.0 58 83.5 59 76.0 60 71.0 61 84.0 62 91.5 63 74.5 64 64.0 65 59.0 66 51.5 67 55.5 68 53.5 69 38.0 70 29.0 71 24.5 72 19.5 73 13.0 74 7.5 75 6.5 76 6.5 77 4.0 78 2.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.05 40-44 0.17500000000000002 45-49 0.1 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.025 85-89 0.02 90-94 0.385 95-99 0.385 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.325 130-134 1.165 135-139 0.89 140-144 0.35000000000000003 145-149 1.015 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93724696356276 97.75 2 0.9109311740890688 1.7999999999999998 3 0.15182186234817813 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.1500000000000004 0.0 0.0 0.0 0.0 126-127 3.4 0.0 0.0 0.0 0.0 128-129 3.7125000000000004 0.0 0.0 0.0 0.0 130-131 4.05 0.0 0.0 0.0 0.0 132-133 4.387499999999999 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.1125 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473320 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473320_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3465 33.0 33.0 34.0 32.0 34.0 2 32.4805 33.0 33.0 34.0 32.0 34.0 3 32.4395 34.0 33.0 34.0 32.0 34.0 4 32.4795 34.0 33.0 34.0 32.0 34.0 5 32.507 34.0 33.0 34.0 32.0 34.0 6 36.5785 38.0 38.0 38.0 36.0 38.0 7 36.554 38.0 38.0 38.0 36.0 38.0 8 36.91425 38.0 38.0 38.0 36.0 38.0 9 36.84475 38.0 38.0 38.0 36.0 38.0 10-14 36.9773 38.0 38.0 38.0 36.4 38.0 15-19 36.6404 38.0 38.0 38.0 35.8 38.0 20-24 36.3138 38.0 38.0 38.0 35.4 38.0 25-29 36.406150000000004 38.0 38.0 38.0 35.8 38.0 30-34 36.574799999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.535849999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.53509999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.43835 38.0 38.0 38.0 35.8 38.0 50-54 36.4311 38.0 38.0 38.0 35.0 38.0 55-59 36.402499999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.27135 38.0 38.0 38.0 34.8 38.0 65-69 35.77515 38.0 38.0 38.0 33.4 38.0 70-74 36.08245000000001 38.0 38.0 38.0 33.8 38.0 75-79 36.09654999999999 38.0 38.0 38.0 34.0 38.0 80-84 35.98725 38.0 38.0 38.0 34.0 38.0 85-89 35.81275 38.0 38.0 38.0 33.0 38.0 90-94 35.6969 38.0 38.0 38.0 33.0 38.0 95-99 35.155449999999995 38.0 37.4 38.0 30.4 38.0 100-104 34.4627 38.0 36.8 38.0 25.6 38.0 105-109 34.419200000000004 38.0 36.0 38.0 25.8 38.0 110-114 34.14615 38.0 36.0 38.0 23.2 38.0 115-119 34.02255 38.0 35.4 38.0 22.6 38.0 120-124 33.81275 38.0 35.0 38.0 21.4 38.0 125-129 33.43985 38.0 35.0 38.0 15.0 38.0 130-134 32.994150000000005 38.0 33.6 38.0 13.8 38.0 135-139 32.519099999999995 38.0 33.6 38.0 13.4 38.0 140-144 31.8238 38.0 31.8 38.0 13.0 38.0 145-149 30.692349999999998 38.0 31.0 38.0 2.0 38.0 150-151 25.634124999999997 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 32.0 4 14.0 5 2.0 6 1.0 7 1.0 8 0.0 9 1.0 10 3.0 11 3.0 12 5.0 13 4.0 14 8.0 15 8.0 16 6.0 17 10.0 18 7.0 19 8.0 20 5.0 21 13.0 22 17.0 23 21.0 24 47.0 25 22.0 26 27.0 27 35.0 28 31.0 29 46.0 30 63.0 31 83.0 32 86.0 33 110.0 34 171.0 35 271.0 36 647.0 37 2175.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.646670055922726 15.937976614133198 13.955261820030504 35.460091509913575 2 32.162849872773535 20.94147582697201 27.480916030534353 19.4147582697201 3 23.599796334012222 26.40020366598778 24.94908350305499 25.050916496945007 4 25.97105864432597 31.4039096217314 19.243462807819242 23.381568926123382 5 28.680203045685282 32.28426395939086 19.035532994923855 20.0 6 22.932521562658547 34.47488584474886 19.48249619482496 23.11009639776763 7 22.459349593495933 16.4380081300813 36.30589430894309 24.796747967479675 8 23.235367997990455 21.90404420999749 23.587038432554635 31.273549359457427 9 24.06015037593985 21.954887218045112 27.468671679197993 26.516290726817044 10-14 26.418786692759294 24.73280144513021 22.881228360680417 25.967183501430075 15-19 25.490592757434754 25.429900869917056 23.872142423629374 25.207363949018813 20-24 25.98601969488239 25.088014694627276 23.761416398795856 25.164549211694474 25-29 26.02481944868274 25.15003560166819 23.436069575831553 25.389075373817516 30-34 25.84195577196186 25.177520795293162 24.487725705011158 24.49279772773382 35-39 25.88641674286295 25.231128720918417 23.295743167733416 25.586711368485215 40-44 25.583514758746396 24.86962685433649 24.115234671662193 25.431623715254926 45-49 26.055549903347234 24.376844032963678 24.12249465866314 25.445111405025944 50-54 26.381208462279943 25.12302775100198 23.819187255846987 24.676576530871085 55-59 26.42560518586043 24.734123366757824 23.908639724501164 24.931631722880585 60-64 26.020226660568174 24.831020988971897 23.89591909335773 25.252833257102203 65-69 26.241098416927095 24.36087914339874 24.36087914339874 25.03714329627542 70-74 26.130423750317178 24.46587160619132 24.460796752093376 24.94290789139812 75-79 26.087176887987834 24.830207805372527 24.181449569183982 24.901165737455653 80-84 26.460029326996004 24.66501491631693 23.694190220963744 25.180765535723314 85-89 26.18326773640125 25.391058633565443 23.579574124533252 24.84609950550005 90-94 26.187458812794645 24.788361129416536 24.24595731738227 24.778222740406548 95-99 26.801536491677336 24.609475032010245 24.47631241997439 24.112676056338028 100-104 26.90988462737761 24.9350379378443 24.04115996258185 24.113917472196235 105-109 26.257128045619492 25.064800414722654 23.742871954380508 24.935199585277346 110-114 26.686415133562 25.813325018189374 23.64619062467519 23.854069223573433 115-119 26.284472499611944 25.420396336731 23.081699177316708 25.21343198634035 120-124 26.22284007826177 25.78004324992277 23.83379672536299 24.16331994645248 125-129 27.428955950100935 24.96506030332833 23.158548579119 24.44743516745173 130-134 26.600475747233425 24.971558589306028 24.07177577826042 24.356189885200124 135-139 27.03035906919402 26.059485282786255 23.372887450557354 23.53726819746237 140-144 27.22548111557065 25.635484202943292 23.844808068333847 23.294226613152208 145-149 26.825618000722507 26.07214739123703 23.822057077979046 23.28017753006141 150-151 26.728050836467382 26.520555051225518 23.239527947088575 23.51186616521852 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.5 2 1.5 3 4.0 4 5.5 5 5.5 6 4.5 7 3.5 8 3.0 9 1.5 10 3.0 11 3.0 12 1.5 13 1.0 14 1.0 15 1.5 16 2.0 17 2.0 18 1.5 19 1.0 20 0.0 21 1.0 22 1.0 23 0.5 24 3.0 25 4.5 26 3.0 27 3.0 28 3.5 29 4.5 30 12.0 31 14.0 32 11.5 33 15.5 34 22.0 35 29.0 36 37.0 37 53.5 38 67.0 39 81.0 40 103.0 41 122.0 42 124.5 43 133.0 44 151.5 45 175.5 46 181.0 47 166.0 48 160.0 49 159.5 50 162.0 51 144.0 52 129.5 53 124.5 54 115.0 55 103.5 56 94.5 57 93.5 58 99.5 59 100.0 60 90.0 61 88.0 62 89.0 63 91.0 64 90.5 65 76.5 66 65.0 67 60.0 68 59.5 69 59.0 70 50.0 71 38.5 72 27.5 73 18.5 74 13.0 75 9.5 76 7.0 77 3.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 1.7500000000000002 3 1.7999999999999998 4 1.525 5 1.5 6 1.4500000000000002 7 1.6 8 0.475 9 0.25 10-14 0.35500000000000004 15-19 1.1400000000000001 20-24 2.005 25-29 1.69 30-34 1.4200000000000002 35-39 1.5699999999999998 40-44 1.2449999999999999 45-49 1.71 50-54 1.4449999999999998 55-59 1.27 60-64 1.6150000000000002 65-69 2.405 70-74 1.4749999999999999 75-79 1.35 80-84 1.115 85-89 0.91 90-94 1.365 95-99 2.375 100-104 3.7900000000000005 105-109 3.55 110-114 3.7900000000000005 115-119 3.3649999999999998 120-124 2.8899999999999997 125-129 3.405 130-134 3.3099999999999996 135-139 2.665 140-144 2.83 145-149 3.115 150-151 3.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41513292433538 96.25 2 1.2269938650306749 2.4 3 0.2044989775051125 0.6 4 0.10224948875255625 0.4 5 0.0 0.0 6 0.0 0.0 7 0.051124744376278126 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 7 0.17500000000000002 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0125 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.0625 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.1 0.025 0.0 0.0 0.0 88-89 0.125 0.025 0.0 0.0 0.0 90-91 0.15 0.025 0.0 0.0 0.0 92-93 0.2 0.025 0.0 0.0 0.0 94-95 0.2625 0.025 0.0 0.0 0.0 96-97 0.325 0.025 0.0 0.0 0.0 98-99 0.35 0.025 0.0 0.0 0.0 100-101 0.4875 0.025 0.0 0.0 0.0 102-103 0.575 0.025 0.0 0.0 0.0 104-105 0.7125 0.025 0.0 0.0 0.0 106-107 0.775 0.025 0.0 0.0 0.0 108-109 0.925 0.025 0.0 0.0 0.0 110-111 1.1375000000000002 0.025 0.0 0.0 0.0 112-113 1.35 0.025 0.0 0.0 0.0 114-115 1.675 0.025 0.0 0.0 0.0 116-117 1.9875 0.025 0.0 0.0 0.0 118-119 2.2375 0.025 0.0 0.0 0.0 120-121 2.5375 0.025 0.0 0.0 0.0 122-123 2.8125 0.025 0.0 0.0 0.0 124-125 3.075 0.025 0.0 0.0 0.0 126-127 3.35 0.025 0.0 0.0 0.0 128-129 3.6624999999999996 0.025 0.0 0.0 0.0 130-131 3.925 0.025 0.0 0.0 0.0 132-133 4.262499999999999 0.025 0.0 0.0 0.0 134-135 4.55 0.025 0.0 0.0 0.0 136-137 5.0125 0.025 0.0 0.0 0.0 138-139 5.5 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007011777 18.390625 140-144 >>END_MODULE Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242623 spots for SRR7473320.sra Written 1242623 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra Read 1242606 spots for SRR7473320.sra Written 1242606 spots for SRR7473320.sra SRR ids: ['SRR7473320.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_col4i15k SRR7473320.sra spots: 24852137 blocks: [[1, 1242606], [1242607, 2485212], [2485213, 3727818], [3727819, 4970424], [4970425, 6213030], [6213031, 7455636], [7455637, 8698242], [8698243, 9940848], [9940849, 11183454], [11183455, 12426060], [12426061, 13668666], [13668667, 14911272], [14911273, 16153878], [16153879, 17396484], [17396485, 18639090], [18639091, 19881696], [19881697, 21124302], [21124303, 22366908], [22366909, 23609514], [23609515, 24852137]] SRR7473320 file size 8399873 SRR7473320 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473320 SRR7473320_1.fastq SRR7473320_2.fastq Input file: SRR7473320_1.fastq Paired file: SRR7473320_2.fastq trimmed: SRR7473320-trimmed-pair1.fastq, SRR7473320-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:16:23 2024 >> started Sat Dec 7 13:16:50 2024 >> done (27.380s) 24852137 read pairs processed; of these: 39594 ( 0.16%) short read pairs filtered out after trimming by size control 63243 ( 0.25%) empty read pairs filtered out after trimming by size control 24749300 (99.59%) read pairs available; of these: 14030238 (56.69%) trimmed read pairs available after processing 10719062 (43.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 19 0.00% 20 14 0.00% 21 17 0.00% 22 25 0.00% 23 25 0.00% 24 27 0.00% 25 27 0.00% 26 33 0.00% 27 34 0.00% 28 29 0.00% 29 25 0.00% 30 42 0.00% 31 36 0.00% 32 36 0.00% 33 48 0.00% 34 58 0.00% 35 46 0.00% 36 47 0.00% 37 62 0.00% 38 69 0.00% 39 58 0.00% 40 55 0.00% 41 70 0.00% 42 74 0.00% 43 93 0.00% 44 105 0.00% 45 110 0.00% 46 91 0.00% 47 137 0.00% 48 127 0.00% 49 152 0.00% 50 207 0.00% 51 189 0.00% 52 283 0.00% 53 271 0.00% 54 277 0.00% 55 292 0.00% 56 319 0.00% 57 343 0.00% 58 371 0.00% 59 443 0.00% 60 458 0.00% 61 554 0.00% 62 638 0.00% 63 681 0.00% 64 766 0.00% 65 878 0.00% 66 959 0.00% 67 1034 0.00% 68 1189 0.00% 69 1693 0.01% 70 1943 0.01% 71 1788 0.01% 72 1818 0.01% 73 1982 0.01% 74 2262 0.01% 75 2423 0.01% 76 2743 0.01% 77 2893 0.01% 78 3331 0.01% 79 3749 0.02% 80 4111 0.02% 81 4465 0.02% 82 5056 0.02% 83 5764 0.02% 84 7481 0.03% 85 8118 0.03% 86 8592 0.03% 87 9310 0.04% 88 9983 0.04% 89 10675 0.04% 90 11492 0.05% 91 12020 0.05% 92 12817 0.05% 93 14148 0.06% 94 15420 0.06% 95 16577 0.07% 96 17526 0.07% 97 18058 0.07% 98 19129 0.08% 99 20145 0.08% 100 21353 0.09% 101 22158 0.09% 102 23539 0.10% 103 24848 0.10% 104 26441 0.11% 105 28445 0.11% 106 29500 0.12% 107 30751 0.12% 108 32835 0.13% 109 34187 0.14% 110 35973 0.15% 111 37315 0.15% 112 39100 0.16% 113 41028 0.17% 114 42793 0.17% 115 45172 0.18% 116 46918 0.19% 117 48237 0.19% 118 50136 0.20% 119 52489 0.21% 120 54770 0.22% 121 57557 0.23% 122 60164 0.24% 123 62028 0.25% 124 66027 0.27% 125 67824 0.27% 126 70174 0.28% 127 73280 0.30% 128 76206 0.31% 129 80477 0.33% 130 84258 0.34% 131 87099 0.35% 132 92165 0.37% 133 97153 0.39% 134 102655 0.41% 135 108394 0.44% 136 116255 0.47% 137 124648 0.50% 138 133877 0.54% 139 144440 0.58% 140 155707 0.63% 141 171735 0.69% 142 193747 0.78% 143 220375 0.89% 144 257235 1.04% 145 313891 1.27% 146 399491 1.61% 147 550415 2.22% 148 846467 3.42% 149 1624275 6.56% 150 6554744 26.48% 151 10719062 43.31% 24749300 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=30 prefix-density=0.75 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=105.96 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.5 sequence=CTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=26 prefix-density=0.55 prefix-fanout=2.6 sequence=CTCGGCAGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=93.86 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGA SRR7473320 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:17:31 Started mapping on | Dec 07 13:17:31 Finished on | Dec 07 13:21:54 Mapping speed, Million of reads per hour | 338.77 Number of input reads | 24749300 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 23429856 Uniquely mapped reads % | 94.67% Average mapped length | 293.51 Number of splices: Total | 25629995 Number of splices: Annotated (sjdb) | 24193688 Number of splices: GT/AG | 25305074 Number of splices: GC/AG | 288788 Number of splices: AT/AC | 12082 Number of splices: Non-canonical | 24051 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195416 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 19508 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1140127 1140127 1140127 N_multimapping 195416 195416 195416 N_noFeature 840690 22586027 1122266 N_ambiguous 659136 3461 98779 UnstrandedReadsAssigned:21930030 PositiveStrandReadsAssigned:840368 NegativeStrandReadsAssigned:22208811 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473320 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473320-trimmed-pair1.fastq SRR7473320-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,749,300 reads, 22,283,743 reads pseudoaligned [quant] estimated average fragment length: 278.643 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR7473320.ke.tsv 35125 SRR7473320.se.tsv 88098 total ==> SRR7473320.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.054 0 0 PNS24247 1044 766.357 52.0487 4.12253 PNS24249 1928 1650.36 45.7814 1.68383 PNS24246 1044 766.357 52.0487 4.12253 PNS24248 1044 766.357 52.0487 4.12253 PNS24244 1471 1193.36 87.0724 4.4289 PNS24243 293 88.9687 0 0 KQK14069 1603 1325.36 215.529 9.87094 KQK14071 474 222.496 1.40781 0.384067 ==> SRR7473320.se.tsv <== BRADI_1g14170v3 217 BRADI_1g53295v3 650 BRADI_1g59795v3 691 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 1080 BRADI_1g74790v3 187 BRADI_1g09890v3 3 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR7473320 completed mapping pipeline successfully