Starting /dee2/code/volunteer_pipeline.sh SRR7473321 current disk space = 1543243231232 free memory = 1606543572 SRR7473321 SRAfilesize b047e374ad2f8577e37080dd0a2da2af SRR7473321.sra SRR7473321.sra file validated SRR7473321 is paired end SRR7473321 is conventional basespace SRR7473321 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473321_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03875 34.0 33.0 34.0 33.0 34.0 2 33.275 34.0 33.0 34.0 33.0 34.0 3 33.28375 34.0 33.0 34.0 33.0 34.0 4 33.25925 34.0 33.0 34.0 33.0 34.0 5 33.26825 34.0 33.0 34.0 33.0 34.0 6 36.873 38.0 37.0 38.0 35.0 38.0 7 37.1745 38.0 38.0 38.0 36.0 38.0 8 37.2595 38.0 38.0 38.0 37.0 38.0 9 37.30525 38.0 38.0 38.0 37.0 38.0 10-14 37.376099999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.34635 38.0 38.0 38.0 37.0 38.0 20-24 37.356300000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.131299999999996 38.0 38.0 38.0 36.2 38.0 30-34 37.03295 38.0 38.0 38.0 36.0 38.0 35-39 36.984350000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.6448 38.0 38.0 38.0 34.8 38.0 45-49 36.70875 38.0 38.0 38.0 34.4 38.0 50-54 36.577 38.0 38.0 38.0 34.2 38.0 55-59 36.687799999999996 38.0 38.0 38.0 34.0 38.0 60-64 36.533100000000005 38.0 38.0 38.0 34.0 38.0 65-69 36.33220000000001 38.0 37.6 38.0 33.6 38.0 70-74 36.25135 38.0 37.6 38.0 33.4 38.0 75-79 36.2353 38.0 37.4 38.0 33.2 38.0 80-84 36.095600000000005 38.0 37.0 38.0 33.0 38.0 85-89 35.882799999999996 38.0 37.0 38.0 32.0 38.0 90-94 35.59505 38.0 36.4 38.0 30.4 38.0 95-99 35.307750000000006 38.0 36.0 38.0 29.4 38.0 100-104 35.06165 38.0 35.6 38.0 28.4 38.0 105-109 34.830949999999994 38.0 35.0 38.0 27.2 38.0 110-114 34.59765 38.0 35.0 38.0 26.2 38.0 115-119 34.060050000000004 38.0 34.2 38.0 23.0 38.0 120-124 33.7296 38.0 34.0 38.0 21.4 38.0 125-129 33.17995 38.0 33.8 38.0 16.2 38.0 130-134 32.8123 38.0 33.0 38.0 15.0 38.0 135-139 32.039249999999996 37.2 32.0 38.0 14.0 38.0 140-144 31.35745 36.0 31.0 38.0 13.2 38.0 145-149 29.4627 36.0 28.0 38.0 4.2 38.0 150-151 24.625625 32.0 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 3.0 12 4.0 13 2.0 14 2.0 15 2.0 16 7.0 17 5.0 18 9.0 19 9.0 20 12.0 21 13.0 22 24.0 23 14.0 24 20.0 25 18.0 26 34.0 27 50.0 28 52.0 29 68.0 30 86.0 31 99.0 32 127.0 33 174.0 34 233.0 35 444.0 36 914.0 37 1573.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.131313131313135 14.898989898989898 12.222222222222221 34.74747474747475 2 26.48459032823854 17.739914808318716 30.64394888499123 25.131545978451513 3 21.05 25.45 25.75 27.750000000000004 4 26.424999999999997 29.725 22.675 21.175 5 24.862155388471177 33.78446115288221 21.578947368421055 19.774436090225564 6 21.325 33.074999999999996 22.675 22.925 7 17.849999999999998 21.125 39.925 21.099999999999998 8 20.349999999999998 21.5 28.599999999999998 29.549999999999997 9 20.5 20.65 31.5 27.35 10-14 22.8 25.52 24.93 26.75 15-19 22.759999999999998 25.5 24.93 26.810000000000002 20-24 22.33 25.745 25.674999999999997 26.25 25-29 22.56 25.55 25.795 26.095000000000002 30-34 22.509999999999998 24.925 26.229999999999997 26.334999999999997 35-39 22.87186155846754 25.307592277683305 25.477643292987896 26.342902870861256 40-44 22.942118966553174 25.705988383737232 25.145203284598438 26.206689365111156 45-49 22.638583149889936 24.719831899139482 26.085651390834503 26.55593356013608 50-54 23.0 25.645 25.27 26.085 55-59 23.599999999999998 25.39 25.180000000000003 25.83 60-64 23.35 25.369999999999997 24.975 26.305 65-69 22.905 25.97 25.385 25.740000000000002 70-74 23.294999999999998 25.009999999999998 25.590000000000003 26.105 75-79 23.28116405820291 24.47122356117806 25.386269313465675 26.86134306715336 80-84 23.412341234123414 25.247524752475247 24.967496749674968 26.37263726372637 85-89 24.058608791318697 24.9187378106716 24.958743811571736 26.063909586437966 90-94 23.66037924651023 25.06629309050883 25.196377645469553 26.07695001751138 95-99 23.897574664261377 25.20545199438765 25.235518139907796 25.66145520144317 100-104 24.32 25.305 24.7 25.674999999999997 105-109 23.781189059452974 25.43627181359068 24.97624881244062 25.806290314515728 110-114 23.43117155857793 25.37626881344067 24.911245562278115 26.281314065703288 115-119 23.919999999999998 24.915000000000003 25.525 25.64 120-124 23.943168742808545 24.72359797888839 24.93871629396168 26.394516984341386 125-129 24.236803849817036 24.923555065416814 25.214296455962703 25.625344628803447 130-134 23.733252745038783 25.183842046942683 24.589503374634834 26.4934018333837 135-139 24.16171583929111 24.88671835666096 24.755815124358072 26.195750679689862 140-144 24.606831613743363 25.217870379645397 24.50165280977662 25.67364519683462 145-149 23.907791423394404 25.699617475337227 24.426213005838534 25.96637809542984 150-151 24.053030303030305 25.037878787878785 24.1540404040404 26.755050505050505 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.5 27 2.5 28 3.5 29 6.0 30 6.5 31 11.5 32 21.5 33 28.5 34 34.5 35 46.5 36 60.5 37 62.0 38 69.5 39 106.0 40 128.0 41 143.5 42 159.5 43 162.5 44 176.0 45 176.0 46 178.0 47 194.5 48 189.5 49 166.5 50 165.0 51 160.0 52 137.5 53 119.5 54 102.0 55 114.5 56 113.5 57 91.5 58 97.0 59 97.5 60 86.0 61 73.0 62 70.0 63 68.5 64 60.5 65 52.5 66 51.0 67 44.0 68 31.0 69 26.0 70 24.5 71 23.0 72 17.5 73 13.0 74 9.0 75 5.0 76 3.5 77 4.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.13999999999999999 45-49 0.06 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.01 85-89 0.015 90-94 0.065 95-99 0.22 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.0 120-124 0.055 125-129 0.255 130-134 0.73 135-139 0.69 140-144 0.16999999999999998 145-149 0.66 150-151 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70558375634518 97.225 2 1.116751269035533 2.1999999999999997 3 0.12690355329949238 0.375 4 0.050761421319796954 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.4 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 2.9749999999999996 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.137499999999999 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 4.925 0.0 0.025 0.0 0.0 136-137 5.325 0.0 0.025 0.0 0.0 138-139 5.8125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTACTC 10 0.00686971 144.72499 8 >>END_MODULE SRR7473321 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473321_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9625 33.0 33.0 34.0 31.0 34.0 2 32.1215 33.0 33.0 34.0 31.0 34.0 3 32.14125 33.0 33.0 34.0 32.0 34.0 4 32.0895 33.0 33.0 34.0 31.0 34.0 5 31.978 33.0 33.0 34.0 31.0 34.0 6 36.0845 38.0 38.0 38.0 34.0 38.0 7 36.32225 38.0 38.0 38.0 34.0 38.0 8 36.4625 38.0 38.0 38.0 34.0 38.0 9 36.455 38.0 38.0 38.0 34.0 38.0 10-14 36.565 38.0 38.0 38.0 35.2 38.0 15-19 36.38445 38.0 38.0 38.0 35.0 38.0 20-24 36.0021 38.0 38.0 38.0 34.2 38.0 25-29 36.1654 38.0 38.0 38.0 34.0 38.0 30-34 36.211200000000005 38.0 38.0 38.0 34.4 38.0 35-39 36.1774 38.0 38.0 38.0 34.4 38.0 40-44 36.193799999999996 38.0 38.0 38.0 34.6 38.0 45-49 36.02995 38.0 38.0 38.0 34.0 38.0 50-54 36.06410000000001 38.0 38.0 38.0 34.0 38.0 55-59 36.0127 38.0 38.0 38.0 34.0 38.0 60-64 35.9218 38.0 38.0 38.0 33.2 38.0 65-69 35.55105 38.0 38.0 38.0 32.0 38.0 70-74 35.6611 38.0 38.0 38.0 31.8 38.0 75-79 35.586200000000005 38.0 38.0 38.0 31.6 38.0 80-84 35.59875 38.0 38.0 38.0 32.4 38.0 85-89 35.438100000000006 38.0 38.0 38.0 31.0 38.0 90-94 35.16844999999999 38.0 37.2 38.0 30.0 38.0 95-99 34.6729 38.0 37.0 38.0 27.0 38.0 100-104 33.9941 38.0 36.0 38.0 21.8 38.0 105-109 33.9825 38.0 35.6 38.0 21.4 38.0 110-114 33.5489 38.0 35.0 38.0 15.0 38.0 115-119 33.226200000000006 38.0 34.4 38.0 15.0 38.0 120-124 33.09975 38.0 34.4 38.0 14.6 38.0 125-129 32.63355 38.0 34.0 38.0 13.8 38.0 130-134 32.046299999999995 38.0 32.8 38.0 13.0 38.0 135-139 31.543400000000002 38.0 31.0 38.0 13.0 38.0 140-144 30.736249999999995 38.0 30.0 38.0 2.0 38.0 145-149 29.446199999999997 36.4 28.6 38.0 2.0 38.0 150-151 23.613 31.0 6.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 18.0 4 13.0 5 2.0 6 3.0 7 6.0 8 1.0 9 4.0 10 2.0 11 3.0 12 11.0 13 14.0 14 9.0 15 7.0 16 15.0 17 14.0 18 15.0 19 9.0 20 25.0 21 15.0 22 24.0 23 22.0 24 37.0 25 27.0 26 30.0 27 32.0 28 47.0 29 51.0 30 58.0 31 71.0 32 98.0 33 136.0 34 204.0 35 319.0 36 682.0 37 1942.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.01712241247125 18.6046511627907 12.547917199079988 27.830309225658063 2 31.509289895647747 22.601170781369305 25.833545431407483 20.05599389157546 3 22.54025044722719 25.990288780986454 27.472527472527474 23.99693329925888 4 26.444387884958005 31.662000509035376 19.190633749045556 22.70297785696106 5 26.673479816044964 34.72151251916198 19.085334695963212 19.51967296882984 6 23.850868232890704 33.24821246169561 20.786516853932586 22.1144024514811 7 22.33181588265048 18.057663125948405 35.63480020232676 23.975720789074355 8 24.345417925478348 22.129909365558913 22.683786505538773 30.840886203423967 9 24.217380415727526 21.7129977460556 26.69671925870273 27.372902579514154 10-14 26.967250112844177 24.294096995837304 23.070364612066804 25.668288279251716 15-19 26.338113512421735 25.222177337911532 23.666935972530805 24.77277317713593 20-24 26.490369917456434 24.992357077346377 24.32487516559666 24.19239783960053 25-29 25.914850481500252 24.505828687278257 24.196654840344653 25.382665990876834 30-34 26.329639188300185 24.887404483578766 23.900612317190426 24.88234401093062 35-39 26.41069800425489 24.962009928072128 23.30564279201702 25.32164927565596 40-44 26.680831689178934 24.905144938533923 24.14630444680528 24.267718925481862 45-49 26.314719780498958 24.98856765408262 24.063817895432145 24.63289466998628 50-54 26.032034763276236 24.667778283057956 24.591986256379162 24.708200697286646 55-59 26.606293635535767 24.784984316503085 23.469594252757258 25.139127795203887 60-64 26.699447457798957 24.727530795356618 24.286510873422213 24.286510873422213 65-69 25.788345749566282 24.977038473313602 24.303500357179303 24.93111541994081 70-74 27.182549724176326 24.65711827521636 23.857482666126828 24.302849334480488 75-79 26.158354807740892 24.84967914708706 24.213026122985195 24.77893992218685 80-84 26.157337367624812 25.02269288956127 24.084720121028745 24.735249621785176 85-89 26.965103983080716 24.739412860667706 24.034442821894356 24.26104033435722 90-94 26.98340416919652 24.82797004654928 24.03865614248128 24.14996964177292 95-99 26.823529411764707 25.29923273657289 24.112531969309465 23.764705882352942 100-104 26.85209119578142 24.990952799462338 23.838080959520237 24.318875045236002 105-109 26.466188683138185 24.58348377778924 24.867179037499355 24.08314850157322 110-114 26.40049520272362 25.441039925719593 24.42484266996802 23.733622201588776 115-119 27.287724905913286 24.777027375367325 24.323348971490436 23.611898747228953 120-124 26.981840629662017 25.3871083903493 24.02386954061423 23.607181439374454 125-129 27.093748389424317 25.258980570014945 24.449827346286657 23.19744369427408 130-134 27.18471599979402 24.939492249858386 24.47602863175241 23.39976311859519 135-139 27.181739263647042 25.3383036307001 24.388500229791145 23.091456875861716 140-144 27.247162286532365 26.009816954698845 23.7294201861131 23.01360057265569 145-149 28.019075944823342 25.701246089944107 23.75775601251218 22.521921952720373 150-151 27.970844722113757 26.382923337238058 23.40231680333203 22.243915137316154 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 3.5 2 3.0 3 4.5 4 6.0 5 5.0 6 3.0 7 2.0 8 0.5 9 1.5 10 2.0 11 0.5 12 0.5 13 2.0 14 2.5 15 1.5 16 1.0 17 1.5 18 1.5 19 1.0 20 1.0 21 1.0 22 0.5 23 1.5 24 2.0 25 2.5 26 5.5 27 5.0 28 4.0 29 8.0 30 12.5 31 12.5 32 13.5 33 15.5 34 20.0 35 28.5 36 33.0 37 45.5 38 68.5 39 81.0 40 101.0 41 129.0 42 142.5 43 159.0 44 162.5 45 156.5 46 161.5 47 157.5 48 153.5 49 152.5 50 137.5 51 131.5 52 137.5 53 126.5 54 110.5 55 120.0 56 119.5 57 108.0 58 103.5 59 97.5 60 96.5 61 96.0 62 103.0 63 93.5 64 73.0 65 73.0 66 71.5 67 70.0 68 66.0 69 48.0 70 32.0 71 27.5 72 23.5 73 15.0 74 12.0 75 9.5 76 6.5 77 4.0 78 2.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 1.775 3 2.175 4 1.775 5 2.15 6 2.1 7 1.15 8 0.7000000000000001 9 0.17500000000000002 10-14 0.305 15-19 0.98 20-24 1.87 25-29 1.35 30-34 1.195 35-39 1.29 40-44 1.165 45-49 1.595 50-54 1.045 55-59 1.17 60-64 1.365 65-69 2.01 70-74 1.205 75-79 1.045 80-84 0.8500000000000001 85-89 0.705 90-94 1.18 95-99 2.25 100-104 3.2849999999999997 105-109 3.065 110-114 3.0700000000000003 115-119 3.015 120-124 2.8049999999999997 125-129 2.9850000000000003 130-134 2.905 135-139 2.085 140-144 2.21 145-149 2.495 150-151 3.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85670731707317 97.275 2 0.9400406504065042 1.8499999999999999 3 0.07621951219512195 0.22499999999999998 4 0.0 0.0 5 0.10162601626016261 0.5 6 0.025406504065040653 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 6 0.15 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0999999999999996 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 3.9000000000000004 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.675 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211087 spots for SRR7473321.sra Written 1211087 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra Read 1211070 spots for SRR7473321.sra Written 1211070 spots for SRR7473321.sra SRR ids: ['SRR7473321.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_islff5hz SRR7473321.sra spots: 24221417 blocks: [[1, 1211070], [1211071, 2422140], [2422141, 3633210], [3633211, 4844280], [4844281, 6055350], [6055351, 7266420], [7266421, 8477490], [8477491, 9688560], [9688561, 10899630], [10899631, 12110700], [12110701, 13321770], [13321771, 14532840], [14532841, 15743910], [15743911, 16954980], [16954981, 18166050], [18166051, 19377120], [19377121, 20588190], [20588191, 21799260], [21799261, 23010330], [23010331, 24221417]] SRR7473321 file size 8186143 SRR7473321 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473321 SRR7473321_1.fastq SRR7473321_2.fastq Input file: SRR7473321_1.fastq Paired file: SRR7473321_2.fastq trimmed: SRR7473321-trimmed-pair1.fastq, SRR7473321-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:18:40 2024 >> started Sat Dec 7 13:19:18 2024 >> done (37.970s) 24221417 read pairs processed; of these: 60829 ( 0.25%) short read pairs filtered out after trimming by size control 99531 ( 0.41%) empty read pairs filtered out after trimming by size control 24061057 (99.34%) read pairs available; of these: 14487628 (60.21%) trimmed read pairs available after processing 9573429 (39.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 19 0.00% 20 19 0.00% 21 25 0.00% 22 25 0.00% 23 32 0.00% 24 37 0.00% 25 42 0.00% 26 26 0.00% 27 41 0.00% 28 52 0.00% 29 59 0.00% 30 56 0.00% 31 50 0.00% 32 58 0.00% 33 49 0.00% 34 70 0.00% 35 77 0.00% 36 67 0.00% 37 75 0.00% 38 78 0.00% 39 79 0.00% 40 111 0.00% 41 91 0.00% 42 100 0.00% 43 120 0.00% 44 134 0.00% 45 155 0.00% 46 155 0.00% 47 196 0.00% 48 215 0.00% 49 290 0.00% 50 264 0.00% 51 302 0.00% 52 369 0.00% 53 398 0.00% 54 404 0.00% 55 446 0.00% 56 488 0.00% 57 489 0.00% 58 587 0.00% 59 620 0.00% 60 720 0.00% 61 881 0.00% 62 937 0.00% 63 1070 0.00% 64 1153 0.00% 65 1213 0.01% 66 1561 0.01% 67 2251 0.01% 68 3153 0.01% 69 5971 0.02% 70 6260 0.03% 71 3517 0.01% 72 3065 0.01% 73 3227 0.01% 74 3368 0.01% 75 3568 0.01% 76 3734 0.02% 77 4048 0.02% 78 4384 0.02% 79 4904 0.02% 80 5551 0.02% 81 6349 0.03% 82 7404 0.03% 83 8374 0.03% 84 11301 0.05% 85 11997 0.05% 86 12359 0.05% 87 12678 0.05% 88 13409 0.06% 89 14172 0.06% 90 15306 0.06% 91 16469 0.07% 92 17731 0.07% 93 19606 0.08% 94 21105 0.09% 95 22346 0.09% 96 22752 0.09% 97 23708 0.10% 98 23812 0.10% 99 25082 0.10% 100 26706 0.11% 101 27831 0.12% 102 29948 0.12% 103 32792 0.14% 104 34774 0.14% 105 37322 0.16% 106 38062 0.16% 107 38506 0.16% 108 39491 0.16% 109 42112 0.18% 110 42902 0.18% 111 43306 0.18% 112 46479 0.19% 113 51916 0.22% 114 53104 0.22% 115 55967 0.23% 116 57941 0.24% 117 57673 0.24% 118 58528 0.24% 119 60318 0.25% 120 62552 0.26% 121 65276 0.27% 122 69053 0.29% 123 72851 0.30% 124 78526 0.33% 125 80136 0.33% 126 83046 0.35% 127 85473 0.36% 128 87350 0.36% 129 90316 0.38% 130 93167 0.39% 131 97509 0.41% 132 103734 0.43% 133 110623 0.46% 134 118141 0.49% 135 126435 0.53% 136 133833 0.56% 137 142803 0.59% 138 151251 0.63% 139 160365 0.67% 140 172515 0.72% 141 191871 0.80% 142 213821 0.89% 143 244464 1.02% 144 285704 1.19% 145 343980 1.43% 146 430663 1.79% 147 581482 2.42% 148 863085 3.59% 149 1643049 6.83% 150 6251382 25.98% 151 9573429 39.79% 24061057 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=15 prefix-density=0.80 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=22 fanout-score=34.70 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=11.1 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=29 prefix-density=0.49 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=18 fanout-score=44.39 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=13.0 sequence=CAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAAC SRR7473321 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:20:09 Started mapping on | Dec 07 13:20:11 Finished on | Dec 07 13:24:51 Mapping speed, Million of reads per hour | 309.36 Number of input reads | 24061057 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 22319580 Uniquely mapped reads % | 92.76% Average mapped length | 291.90 Number of splices: Total | 23370906 Number of splices: Annotated (sjdb) | 21928748 Number of splices: GT/AG | 23067519 Number of splices: GC/AG | 268381 Number of splices: AT/AC | 11110 Number of splices: Non-canonical | 23896 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215301 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 24914 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.45% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1559077 1559077 1559077 N_multimapping 215301 215301 215301 N_noFeature 853001 21509873 1174242 N_ambiguous 583265 3781 95388 UnstrandedReadsAssigned:20883314 PositiveStrandReadsAssigned:805926 NegativeStrandReadsAssigned:21049950 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473321 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473321-trimmed-pair1.fastq SRR7473321-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,061,057 reads, 21,144,121 reads pseudoaligned [quant] estimated average fragment length: 275.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR7473321.ke.tsv 35125 SRR7473321.se.tsv 88098 total ==> SRR7473321.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 662.68 33.2771 3.05342 PNS24247 1044 769.928 43.3218 3.42137 PNS24249 1928 1653.93 53.0014 1.94857 PNS24246 1044 769.928 43.3218 3.42137 PNS24248 1044 769.928 43.3218 3.42137 PNS24244 1471 1196.93 125.756 6.38859 PNS24243 293 91.9213 0 0 KQK14069 1603 1328.93 1649.14 75.457 KQK14071 474 227.495 23.5482 6.29403 ==> SRR7473321.se.tsv <== BRADI_1g14170v3 1834 BRADI_1g53295v3 843 BRADI_1g59795v3 1526 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 2295 BRADI_1g74790v3 113 BRADI_1g09890v3 5 BRADI_1g77505v3 281 BRADI_1g48960v3 1 SRR7473321 completed mapping pipeline successfully