Starting /dee2/code/volunteer_pipeline.sh SRR7473325 current disk space = 1543084896256 free memory = 1600272744 SRR7473325 SRAfilesize 35805cf9e24fdf7408723ce88a781f81 SRR7473325.sra SRR7473325.sra file validated SRR7473325 is paired end SRR7473325 is conventional basespace SRR7473325 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473325_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4125 34.0 33.0 34.0 33.0 34.0 2 33.4095 34.0 34.0 34.0 33.0 34.0 3 33.49 34.0 34.0 34.0 33.0 34.0 4 33.519 34.0 34.0 34.0 33.0 34.0 5 33.3985 34.0 34.0 34.0 33.0 34.0 6 37.08825 38.0 38.0 38.0 36.0 38.0 7 37.46975 38.0 38.0 38.0 37.0 38.0 8 37.50775 38.0 38.0 38.0 38.0 38.0 9 37.5475 38.0 38.0 38.0 38.0 38.0 10-14 37.51425 38.0 38.0 38.0 37.6 38.0 15-19 37.43385 38.0 38.0 38.0 37.4 38.0 20-24 37.46835 38.0 38.0 38.0 37.6 38.0 25-29 37.3558 38.0 38.0 38.0 37.0 38.0 30-34 37.22955 38.0 38.0 38.0 36.8 38.0 35-39 37.17165 38.0 38.0 38.0 36.4 38.0 40-44 36.9054 38.0 38.0 38.0 35.4 38.0 45-49 36.9399 38.0 38.0 38.0 35.8 38.0 50-54 36.931349999999995 38.0 38.0 38.0 35.8 38.0 55-59 37.00175 38.0 38.0 38.0 36.0 38.0 60-64 36.87505 38.0 38.0 38.0 35.0 38.0 65-69 36.71465 38.0 38.0 38.0 34.4 38.0 70-74 36.746 38.0 38.0 38.0 34.6 38.0 75-79 36.709450000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.6397 38.0 38.0 38.0 34.2 38.0 85-89 36.514500000000005 38.0 38.0 38.0 34.4 38.0 90-94 36.1765 38.0 37.4 38.0 33.2 38.0 95-99 36.09745 38.0 37.2 38.0 33.0 38.0 100-104 35.938300000000005 38.0 37.0 38.0 32.8 38.0 105-109 35.8163 38.0 37.0 38.0 31.8 38.0 110-114 35.54205 38.0 36.0 38.0 30.4 38.0 115-119 35.22935 38.0 35.8 38.0 28.8 38.0 120-124 35.0505 38.0 35.4 38.0 28.4 38.0 125-129 34.45694999999999 38.0 35.0 38.0 25.6 38.0 130-134 33.92805 38.0 34.4 38.0 22.8 38.0 135-139 33.4904 38.0 34.0 38.0 21.0 38.0 140-144 32.753499999999995 38.0 33.4 38.0 14.0 38.0 145-149 32.24105000000001 38.0 32.6 38.0 11.4 38.0 150-151 27.735625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 1.0 16 8.0 17 1.0 18 5.0 19 4.0 20 8.0 21 12.0 22 9.0 23 11.0 24 14.0 25 14.0 26 17.0 27 35.0 28 33.0 29 39.0 30 52.0 31 77.0 32 102.0 33 115.0 34 216.0 35 355.0 36 794.0 37 2074.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.153306613226455 13.026052104208416 9.969939879759519 37.85070140280561 2 25.382493102583396 16.854778028592925 33.809882116879855 23.952846751943817 3 22.575 21.4 27.474999999999998 28.549999999999997 4 26.224999999999998 28.175 21.475 24.125 5 25.79026593075765 32.087305569493225 21.675865529352734 20.446562970396386 6 22.75 32.6 22.475 22.175 7 18.425 20.424999999999997 38.95 22.2 8 21.275 22.7 26.974999999999998 29.049999999999997 9 21.125 21.099999999999998 30.175 27.6 10-14 23.56 25.345000000000002 24.060000000000002 27.034999999999997 15-19 24.535 24.325 24.81 26.33 20-24 24.224999999999998 25.05 24.64 26.085 25-29 23.785 25.005 25.1 26.11 30-34 23.605 24.68 24.32 27.395000000000003 35-39 23.71974394878976 24.72994598919784 24.60992198439688 26.940388077615523 40-44 23.80547355781258 24.946215039775854 25.036273577825586 26.21203782458598 45-49 24.2110527631908 24.36609152288072 24.221055263815956 27.20180045011253 50-54 24.37 24.795 23.965 26.87 55-59 23.645 24.43 24.82 27.105 60-64 23.815 24.935 24.404999999999998 26.845000000000002 65-69 23.86 24.775 24.65 26.715 70-74 24.67 24.3 24.235 26.795 75-79 24.71623581179059 24.386219310965547 24.48122406120306 26.416320816040802 80-84 24.211210560528027 24.306215310765538 24.436221811090554 27.04635231761588 85-89 24.245 24.615000000000002 24.295 26.845000000000002 90-94 24.788718307746162 23.57853678051708 25.05375806370956 26.578986848027203 95-99 24.90492393915132 24.06925540432346 24.554643714971977 26.471176941553242 100-104 25.180000000000003 24.48 23.9 26.44 105-109 24.395 23.97 24.465 27.169999999999998 110-114 24.834999999999997 23.990000000000002 24.34 26.834999999999997 115-119 24.815 24.474999999999998 23.965 26.745 120-124 24.72 24.2 24.349999999999998 26.729999999999997 125-129 24.386456976860664 24.561754983471904 24.171090854452572 26.880697185214864 130-134 24.976033099550936 24.506786417074526 23.649023664160655 26.868156819213883 135-139 24.53675730110775 24.6122860020141 23.741188318227593 27.109768378650557 140-144 25.153957843088172 24.66329544885596 23.226355580033044 26.956391128022833 145-149 25.036433991657876 24.488667772249862 23.835368611488015 26.63952962460425 150-151 24.175685879687894 24.79234835137176 23.785552479234834 27.24641328970551 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 1.5 28 3.5 29 7.0 30 8.0 31 8.0 32 13.5 33 16.0 34 23.5 35 34.5 36 39.0 37 48.0 38 71.0 39 95.0 40 110.5 41 121.5 42 136.0 43 150.5 44 156.5 45 161.5 46 163.0 47 166.0 48 162.5 49 156.0 50 152.5 51 150.0 52 143.5 53 144.5 54 144.0 55 132.0 56 125.5 57 112.5 58 100.0 59 98.0 60 93.0 61 88.5 62 78.0 63 75.0 64 75.5 65 65.5 66 54.0 67 50.0 68 58.0 69 46.5 70 35.0 71 37.5 72 29.5 73 16.0 74 11.5 75 9.0 76 6.5 77 4.5 78 4.0 79 3.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.325 3 0.0 4 0.0 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.065 45-49 0.025 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.015 95-99 0.08 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.16999999999999998 130-134 0.905 135-139 0.7000000000000001 140-144 0.135 145-149 0.505 150-151 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41997961264016 96.55 2 1.3506625891946993 2.65 3 0.1783893985728848 0.525 4 0.025484199796126403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025484199796126403 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCCAACATAGCCTTCTCCGTCCCCCCTTCGCAGTAACACCAAGTACAGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.425 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.112500000000001 0.0 0.0 0.0 0.0 134-135 6.5625 0.0 0.0 0.0 0.0 136-137 7.1625 0.0 0.0 0.0 0.0 138-139 7.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCCGG 10 0.006830828 145.0 9 >>END_MODULE SRR7473325 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473325_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19925 33.0 33.0 34.0 32.0 34.0 2 32.37575 33.0 33.0 34.0 32.0 34.0 3 32.19525 34.0 33.0 34.0 32.0 34.0 4 32.297 34.0 33.0 34.0 32.0 34.0 5 32.21125 34.0 33.0 34.0 32.0 34.0 6 36.36125 38.0 38.0 38.0 35.0 38.0 7 36.51875 38.0 38.0 38.0 35.0 38.0 8 36.7075 38.0 38.0 38.0 35.0 38.0 9 36.9185 38.0 38.0 38.0 36.0 38.0 10-14 36.8917 38.0 38.0 38.0 36.2 38.0 15-19 36.6252 38.0 38.0 38.0 35.8 38.0 20-24 36.3707 38.0 38.0 38.0 35.6 38.0 25-29 36.352199999999996 38.0 38.0 38.0 35.2 38.0 30-34 36.377399999999994 38.0 38.0 38.0 35.4 38.0 35-39 36.47735 38.0 38.0 38.0 36.0 38.0 40-44 36.385400000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.282849999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.397200000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.30865 38.0 38.0 38.0 35.0 38.0 60-64 36.1928 38.0 38.0 38.0 34.4 38.0 65-69 35.814350000000005 38.0 38.0 38.0 33.8 38.0 70-74 36.036199999999994 38.0 38.0 38.0 34.0 38.0 75-79 36.05155 38.0 38.0 38.0 34.0 38.0 80-84 35.953100000000006 38.0 38.0 38.0 34.0 38.0 85-89 35.7849 38.0 38.0 38.0 33.6 38.0 90-94 35.670500000000004 38.0 38.0 38.0 33.0 38.0 95-99 35.29445 38.0 37.8 38.0 30.8 38.0 100-104 34.37205 38.0 36.4 38.0 24.4 38.0 105-109 34.4236 38.0 36.4 38.0 25.4 38.0 110-114 34.15405 38.0 36.0 38.0 23.4 38.0 115-119 33.85405 38.0 35.0 38.0 19.4 38.0 120-124 33.774350000000005 38.0 35.0 38.0 21.4 38.0 125-129 33.52505 38.0 35.0 38.0 16.2 38.0 130-134 32.75655 38.0 34.0 38.0 14.0 38.0 135-139 32.572250000000004 38.0 33.4 38.0 13.2 38.0 140-144 31.87165 38.0 32.4 38.0 13.0 38.0 145-149 30.821800000000003 38.0 31.0 38.0 2.0 38.0 150-151 25.6535 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 31.0 4 14.0 5 2.0 6 2.0 7 4.0 8 2.0 9 2.0 10 3.0 11 4.0 12 4.0 13 10.0 14 2.0 15 8.0 16 3.0 17 13.0 18 10.0 19 14.0 20 7.0 21 14.0 22 24.0 23 17.0 24 27.0 25 41.0 26 24.0 27 26.0 28 33.0 29 40.0 30 55.0 31 63.0 32 80.0 33 117.0 34 176.0 35 259.0 36 615.0 37 2232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.24758515505846 18.174885612608033 11.108286731062531 31.469242501270973 2 31.43293458895393 20.79409518961568 27.895138712140493 19.877831509289894 3 24.153846153846153 23.846153846153847 26.564102564102566 25.435897435897438 4 26.14445574771109 30.111902339776197 20.19328585961343 23.55035605289929 5 28.681177976952625 31.70294494238156 18.23303457106274 21.382842509603073 6 24.567209775967413 33.35030549898167 18.73727087576375 23.34521384928717 7 23.67553865652725 17.211660329531053 33.68821292775665 25.424588086185047 8 23.74716696046336 22.23621254092168 22.00956937799043 32.00705112062453 9 23.50877192982456 22.55639097744361 25.263157894736842 28.671679197994987 10-14 26.922884201032222 24.26216365185148 22.212757428471214 26.602194718645087 15-19 27.05328677698497 24.108091695764383 22.9492434593391 25.889378067911544 20-24 26.49555273189327 24.391359593392632 23.47141041931385 25.641677255400253 25-29 26.634210659769764 24.600638977635782 22.896698615548456 25.868451747045995 30-34 27.131546894031665 24.66504263093788 22.680673974827446 25.522736500203003 35-39 26.8059580092522 24.142138172944943 22.71363936759697 26.33826445020589 40-44 26.907284432503676 24.18512698332235 23.323363917473515 25.58422466670046 45-49 27.523964919437077 23.69467672853355 23.419335100958598 25.362023251070774 50-54 27.364847747884685 24.167806657546738 23.063282160409386 25.40406343415919 55-59 27.13684957187009 23.78780969752242 23.19501443988448 25.880326290723012 60-64 27.230737996142523 24.55588265150746 22.941833316414577 25.271546035935437 65-69 27.33982573039467 23.64941055868785 23.35212711430036 25.658636596617118 70-74 27.185252709409504 23.721260002025726 24.009926060974372 25.0835612275904 75-79 27.292078455222747 24.357609852516347 23.242613146824795 25.107698545436115 80-84 27.17912481703932 23.837884217432997 24.120526926765255 24.86246403876243 85-89 27.091613422548676 24.13342053629823 23.28319162851537 25.491774412637724 90-94 27.24566007266855 24.68712151796528 23.4356075898264 24.631610819539766 95-99 26.907179670357706 24.743583201510436 23.610756748481908 24.738480379649946 100-104 27.160814460835237 24.57926449200083 23.27030957822564 24.989611468938293 105-109 27.207822442961355 24.71933364374774 23.136220187283357 24.936623726007554 110-114 27.3424543946932 24.07752902155887 23.616293532338307 24.96372305140962 115-119 27.739408308421815 24.698484692299765 23.229563962478096 24.33254303680033 120-124 27.954217364405032 24.164776242524233 23.546091977727365 24.33491441534337 125-129 27.467368312438733 24.242893256977762 23.592839085796832 24.69689934478667 130-134 28.000000000000004 25.136950904392762 22.935400516795866 23.927648578811368 135-139 27.791411042944787 24.596114519427402 23.624744376278116 23.987730061349694 140-144 27.602781754960116 25.102270402945386 23.644917160973613 23.650030681120885 145-149 28.07099004282103 25.326316875612648 23.345199401537432 23.25749368002889 150-151 28.919131117508506 25.43836691965454 22.677309604815495 22.96519235802146 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.5 2 3.0 3 4.5 4 4.5 5 2.5 6 2.5 7 2.5 8 1.5 9 2.0 10 3.0 11 2.5 12 2.0 13 2.0 14 1.0 15 1.5 16 2.5 17 2.0 18 2.0 19 1.5 20 1.0 21 1.0 22 1.5 23 3.0 24 4.0 25 4.0 26 4.0 27 3.5 28 3.0 29 3.0 30 3.0 31 5.5 32 10.5 33 12.0 34 15.0 35 21.0 36 27.5 37 37.5 38 49.0 39 69.0 40 90.5 41 103.0 42 126.0 43 141.0 44 126.5 45 132.0 46 146.0 47 148.0 48 165.0 49 164.0 50 133.5 51 126.0 52 131.0 53 140.5 54 141.5 55 126.5 56 117.5 57 109.0 58 103.5 59 110.5 60 106.0 61 100.5 62 119.5 63 110.0 64 92.5 65 88.0 66 75.0 67 78.5 68 76.5 69 60.5 70 47.5 71 34.5 72 28.0 73 24.0 74 17.0 75 13.5 76 10.5 77 5.0 78 3.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 1.775 3 2.5 4 1.7000000000000002 5 2.375 6 1.7999999999999998 7 1.375 8 0.7250000000000001 9 0.25 10-14 0.215 15-19 1.195 20-24 1.625 25-29 1.405 30-34 1.48 35-39 1.645 40-44 1.365 45-49 1.94 50-54 1.315 55-59 1.315 60-64 1.49 65-69 2.45 70-74 1.27 75-79 1.345 80-84 0.935 85-89 0.615 90-94 0.9199999999999999 95-99 2.015 100-104 3.74 105-109 3.3550000000000004 110-114 3.52 115-119 2.9899999999999998 120-124 3.02 125-129 3.085 130-134 3.25 135-139 2.1999999999999997 140-144 2.22 145-149 3.085 150-151 4.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39121552604698 96.325 2 1.2257405515832482 2.4 3 0.30643513789581206 0.8999999999999999 4 0.02553626149131767 0.1 5 0.02553626149131767 0.125 6 0.02553626149131767 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.2249999999999996 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.5375 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.75 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176350 spots for SRR7473325.sra Written 1176350 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra Read 1176337 spots for SRR7473325.sra Written 1176337 spots for SRR7473325.sra SRR ids: ['SRR7473325.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8epc_wwk SRR7473325.sra spots: 23526753 blocks: [[1, 1176337], [1176338, 2352674], [2352675, 3529011], [3529012, 4705348], [4705349, 5881685], [5881686, 7058022], [7058023, 8234359], [8234360, 9410696], [9410697, 10587033], [10587034, 11763370], [11763371, 12939707], [12939708, 14116044], [14116045, 15292381], [15292382, 16468718], [16468719, 17645055], [17645056, 18821392], [18821393, 19997729], [19997730, 21174066], [21174067, 22350403], [22350404, 23526753]] SRR7473325 file size 7950744 SRR7473325 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473325 SRR7473325_1.fastq SRR7473325_2.fastq Input file: SRR7473325_1.fastq Paired file: SRR7473325_2.fastq trimmed: SRR7473325-trimmed-pair1.fastq, SRR7473325-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:25:08 2024 >> started Sat Dec 7 13:25:37 2024 >> done (28.652s) 23526753 read pairs processed; of these: 45401 ( 0.19%) short read pairs filtered out after trimming by size control 74116 ( 0.32%) empty read pairs filtered out after trimming by size control 23407236 (99.49%) read pairs available; of these: 13291116 (56.78%) trimmed read pairs available after processing 10116120 (43.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 19 0.00% 20 19 0.00% 21 26 0.00% 22 26 0.00% 23 30 0.00% 24 25 0.00% 25 21 0.00% 26 29 0.00% 27 45 0.00% 28 44 0.00% 29 39 0.00% 30 52 0.00% 31 51 0.00% 32 39 0.00% 33 56 0.00% 34 52 0.00% 35 55 0.00% 36 68 0.00% 37 81 0.00% 38 83 0.00% 39 102 0.00% 40 96 0.00% 41 117 0.00% 42 126 0.00% 43 136 0.00% 44 150 0.00% 45 149 0.00% 46 154 0.00% 47 171 0.00% 48 206 0.00% 49 199 0.00% 50 264 0.00% 51 303 0.00% 52 335 0.00% 53 353 0.00% 54 352 0.00% 55 383 0.00% 56 477 0.00% 57 525 0.00% 58 490 0.00% 59 564 0.00% 60 687 0.00% 61 818 0.00% 62 948 0.00% 63 1058 0.00% 64 1095 0.00% 65 1203 0.01% 66 1337 0.01% 67 1535 0.01% 68 1951 0.01% 69 2969 0.01% 70 3480 0.01% 71 2853 0.01% 72 2882 0.01% 73 3182 0.01% 74 3319 0.01% 75 3611 0.02% 76 3822 0.02% 77 4042 0.02% 78 4563 0.02% 79 5089 0.02% 80 5460 0.02% 81 6392 0.03% 82 7622 0.03% 83 8635 0.04% 84 11158 0.05% 85 11910 0.05% 86 12545 0.05% 87 12670 0.05% 88 13714 0.06% 89 14301 0.06% 90 15632 0.07% 91 17058 0.07% 92 18390 0.08% 93 20947 0.09% 94 22328 0.10% 95 24257 0.10% 96 24468 0.10% 97 24853 0.11% 98 25364 0.11% 99 26068 0.11% 100 28536 0.12% 101 29203 0.12% 102 32042 0.14% 103 34722 0.15% 104 36707 0.16% 105 39285 0.17% 106 40138 0.17% 107 39880 0.17% 108 41679 0.18% 109 43708 0.19% 110 45079 0.19% 111 45116 0.19% 112 48829 0.21% 113 53947 0.23% 114 55146 0.24% 115 58611 0.25% 116 60242 0.26% 117 59529 0.25% 118 59578 0.25% 119 60649 0.26% 120 63775 0.27% 121 64832 0.28% 122 68931 0.29% 123 72992 0.31% 124 78674 0.34% 125 80877 0.35% 126 82313 0.35% 127 84764 0.36% 128 85862 0.37% 129 87135 0.37% 130 89939 0.38% 131 92177 0.39% 132 97130 0.41% 133 104195 0.45% 134 111913 0.48% 135 118571 0.51% 136 124205 0.53% 137 131599 0.56% 138 136895 0.58% 139 144815 0.62% 140 152372 0.65% 141 166049 0.71% 142 181250 0.77% 143 205444 0.88% 144 237189 1.01% 145 283187 1.21% 146 351208 1.50% 147 467578 2.00% 148 707079 3.02% 149 1367338 5.84% 150 5957449 25.45% 151 10116120 43.22% 23407236 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=13 prefix-density=0.89 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.25 sequence-density-rank=24 fanout-score=10.64 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=18 prefix-density=0.74 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.26 sequence-density-rank=18 fanout-score=32.85 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=11.2 sequence=CAAGAAGAAGGT SRR7473325 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:26:33 Started mapping on | Dec 07 13:26:33 Finished on | Dec 07 13:32:08 Mapping speed, Million of reads per hour | 251.54 Number of input reads | 23407236 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 21483990 Uniquely mapped reads % | 91.78% Average mapped length | 292.05 Number of splices: Total | 22012104 Number of splices: Annotated (sjdb) | 20789128 Number of splices: GT/AG | 21732395 Number of splices: GC/AG | 249425 Number of splices: AT/AC | 9332 Number of splices: Non-canonical | 20952 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 175996 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 21775 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.59% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1768225 1768225 1768225 N_multimapping 175996 175996 175996 N_noFeature 573546 20769634 785013 N_ambiguous 578721 2757 76649 UnstrandedReadsAssigned:20331723 PositiveStrandReadsAssigned:711599 NegativeStrandReadsAssigned:20622328 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473325 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473325-trimmed-pair1.fastq SRR7473325-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,407,236 reads, 20,677,897 reads pseudoaligned [quant] estimated average fragment length: 261.795 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR7473325.ke.tsv 35125 SRR7473325.se.tsv 88098 total ==> SRR7473325.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.743 86.0874 7.87997 PNS24247 1044 783.205 28.8066 2.27501 PNS24249 1928 1667.2 67.7244 2.51259 PNS24246 1044 783.205 28.8066 2.27501 PNS24248 1044 783.205 28.8066 2.27501 PNS24244 1471 1210.2 128.768 6.58137 PNS24243 293 96.5028 0 0 KQK14069 1603 1342.2 2424.44 111.727 KQK14071 474 235.775 29.5665 7.75655 ==> SRR7473325.se.tsv <== BRADI_1g14170v3 2595 BRADI_1g53295v3 50 BRADI_1g59795v3 747 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 2641 BRADI_1g74790v3 480 BRADI_1g09890v3 0 BRADI_1g77505v3 328 BRADI_1g48960v3 0 SRR7473325 completed mapping pipeline successfully