Starting /dee2/code/volunteer_pipeline.sh SRR7473326 current disk space = 1543096623104 free memory = 1590248196 SRR7473326 SRAfilesize b1e0e7848ad64685be5b5d02a14256da SRR7473326.sra SRR7473326.sra file validated SRR7473326 is paired end SRR7473326 is conventional basespace SRR7473326 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473326_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.392 34.0 33.0 34.0 33.0 34.0 2 33.423 34.0 34.0 34.0 33.0 34.0 3 33.489 34.0 34.0 34.0 33.0 34.0 4 33.5005 34.0 34.0 34.0 33.0 34.0 5 33.32025 34.0 34.0 34.0 33.0 34.0 6 37.1355 38.0 38.0 38.0 36.0 38.0 7 37.461 38.0 38.0 38.0 37.0 38.0 8 37.50175 38.0 38.0 38.0 37.0 38.0 9 37.547 38.0 38.0 38.0 38.0 38.0 10-14 37.50215000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.457100000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.487 38.0 38.0 38.0 38.0 38.0 25-29 37.334050000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.23779999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.1324 38.0 38.0 38.0 36.8 38.0 40-44 36.81105 38.0 38.0 38.0 35.4 38.0 45-49 36.89495 38.0 38.0 38.0 35.6 38.0 50-54 36.900800000000004 38.0 38.0 38.0 35.8 38.0 55-59 36.98725 38.0 38.0 38.0 36.0 38.0 60-64 36.881600000000006 38.0 38.0 38.0 35.6 38.0 65-69 36.685 38.0 38.0 38.0 34.8 38.0 70-74 36.65595 38.0 38.0 38.0 34.8 38.0 75-79 36.5862 38.0 38.0 38.0 34.6 38.0 80-84 36.5693 38.0 38.0 38.0 34.0 38.0 85-89 36.440999999999995 38.0 38.0 38.0 33.8 38.0 90-94 36.161199999999994 38.0 37.8 38.0 33.2 38.0 95-99 35.917950000000005 38.0 37.0 38.0 32.8 38.0 100-104 35.8856 38.0 37.0 38.0 32.8 38.0 105-109 35.80375 38.0 37.0 38.0 32.4 38.0 110-114 35.451 38.0 36.0 38.0 30.0 38.0 115-119 35.23995 38.0 36.0 38.0 29.4 38.0 120-124 35.0056 38.0 35.4 38.0 28.2 38.0 125-129 34.436 38.0 35.0 38.0 25.6 38.0 130-134 33.858450000000005 38.0 34.6 38.0 23.2 38.0 135-139 33.549749999999996 38.0 34.0 38.0 21.4 38.0 140-144 32.896249999999995 38.0 33.8 38.0 14.4 38.0 145-149 32.3043 38.0 32.8 38.0 11.6 38.0 150-151 27.602625 35.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 2.0 7 0.0 8 0.0 9 2.0 10 2.0 11 0.0 12 1.0 13 3.0 14 1.0 15 4.0 16 8.0 17 6.0 18 6.0 19 7.0 20 6.0 21 7.0 22 7.0 23 9.0 24 18.0 25 15.0 26 16.0 27 15.0 28 36.0 29 46.0 30 63.0 31 64.0 32 106.0 33 114.0 34 171.0 35 344.0 36 846.0 37 2074.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.37797842989716 12.916980185603212 10.333584148482569 37.37145723601705 2 25.6390977443609 15.137844611528822 34.01002506265664 25.213032581453632 3 22.625 19.575 25.650000000000002 32.15 4 26.724999999999998 26.525 21.7 25.05 5 26.00401606425703 30.195783132530117 22.665662650602407 21.134538152610443 6 21.55 32.6 24.6 21.25 7 17.7 21.275 40.150000000000006 20.875 8 20.599999999999998 22.8 28.025 28.575 9 19.400000000000002 20.9 32.675 27.025 10-14 23.225 25.11 24.825 26.840000000000003 15-19 23.45 24.545 25.619999999999997 26.384999999999998 20-24 23.24 24.55 25.979999999999997 26.229999999999997 25-29 23.195 25.224999999999998 25.345000000000002 26.235000000000003 30-34 23.875 24.98 25.095 26.05 35-39 23.58386709367494 24.239391513210567 25.180144115292237 26.99659727782226 40-44 23.96271797955502 24.969933854479855 25.48105832832231 25.586289837642813 45-49 23.99139052958254 25.157673440784862 24.95745319851837 25.893482831114223 50-54 24.4161040260065 24.971242810702677 24.60615153788447 26.006501625406354 55-59 23.75 24.595 25.06 26.595000000000002 60-64 24.117411741174116 24.392439243924393 24.922492249224923 26.567656765676567 65-69 23.725931482870717 24.346086521630408 25.191297824456115 26.736684171042764 70-74 24.18104526131533 24.58114528632158 24.891222805701425 26.346586646661663 75-79 23.737803352514387 24.808606454841133 25.058794095571677 26.394796097072803 80-84 24.418313735301474 24.353264948711534 25.12884663497623 26.099574681010758 85-89 24.08445067040224 24.699819891935164 24.38963378026816 26.82609565739444 90-94 24.224534720832498 24.474684810886533 25.15009005403242 26.15069041424855 95-99 24.353836906431578 24.679422961330395 24.69445001001803 26.272290122219992 100-104 24.445 24.575 24.845 26.135 105-109 24.303366851768473 24.593526439541748 25.003752063634998 26.099354645054778 110-114 24.888711048867105 25.113789826439252 23.958385434902215 26.039113689791428 115-119 24.286214310715536 24.746237311865592 24.31621581079054 26.651332566628334 120-124 24.413662049307398 24.513677051557732 24.03860579086863 27.03405510826624 125-129 24.680531195189175 24.515159107992986 24.419944875970934 26.384364820846905 130-134 25.243404126519696 24.81460929223629 24.05286788074459 25.88911870049942 135-139 24.29873596212922 25.159893236641988 24.067079619277838 26.47429118195095 140-144 24.638916750250754 25.466399197592775 23.706118355065193 26.188565697091278 145-149 25.30677932005633 25.176020921343795 23.616978475155904 25.900221283443976 150-151 25.663939584644428 24.60667086217747 23.31025802391441 26.41913152926369 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 1.0 25 1.5 26 1.0 27 2.0 28 5.0 29 8.0 30 11.5 31 19.0 32 21.5 33 22.5 34 31.5 35 39.0 36 50.0 37 67.0 38 84.0 39 99.5 40 115.5 41 139.0 42 154.0 43 162.5 44 167.0 45 152.0 46 147.0 47 153.5 48 151.5 49 143.5 50 134.5 51 127.0 52 130.0 53 136.5 54 142.5 55 132.0 56 104.5 57 107.0 58 109.5 59 103.5 60 100.5 61 85.0 62 76.5 63 72.0 64 63.5 65 59.0 66 57.5 67 54.5 68 49.5 69 43.0 70 34.0 71 31.5 72 24.0 73 14.0 74 15.5 75 16.5 76 9.5 77 4.0 78 3.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.25 3 0.0 4 0.0 5 0.4 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.08 40-44 0.22 45-49 0.11 50-54 0.025 55-59 0.0 60-64 0.01 65-69 0.025 70-74 0.025 75-79 0.075 80-84 0.075 85-89 0.06 90-94 0.06 95-99 0.18 100-104 0.0 105-109 0.055 110-114 0.034999999999999996 115-119 0.005 120-124 0.015 125-129 0.22499999999999998 130-134 0.885 135-139 0.715 140-144 0.3 145-149 0.58 150-151 0.6875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.00204918032787 95.65 2 1.639344262295082 3.2 3 0.25614754098360654 0.75 4 0.10245901639344263 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.6500000000000004 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 5.1625 0.0 0.0 0.0 0.0 126-127 5.550000000000001 0.0 0.0 0.0 0.0 128-129 5.975 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473326 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473326_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.286 33.0 33.0 34.0 32.0 34.0 2 32.3945 33.0 33.0 34.0 32.0 34.0 3 32.24825 34.0 33.0 34.0 32.0 34.0 4 32.3915 34.0 33.0 34.0 32.0 34.0 5 32.31725 34.0 33.0 34.0 32.0 34.0 6 36.47325 38.0 38.0 38.0 36.0 38.0 7 36.5365 38.0 38.0 38.0 36.0 38.0 8 36.60925 38.0 38.0 38.0 36.0 38.0 9 36.74925 38.0 38.0 38.0 36.0 38.0 10-14 36.8015 38.0 38.0 38.0 36.0 38.0 15-19 36.5801 38.0 38.0 38.0 36.0 38.0 20-24 36.4259 38.0 38.0 38.0 35.8 38.0 25-29 36.471250000000005 38.0 38.0 38.0 35.8 38.0 30-34 36.46345 38.0 38.0 38.0 35.8 38.0 35-39 36.4538 38.0 38.0 38.0 36.0 38.0 40-44 36.51035 38.0 38.0 38.0 36.0 38.0 45-49 36.38 38.0 38.0 38.0 35.8 38.0 50-54 36.44840000000001 38.0 38.0 38.0 35.8 38.0 55-59 36.37695 38.0 38.0 38.0 35.4 38.0 60-64 36.2625 38.0 38.0 38.0 34.6 38.0 65-69 35.98004999999999 38.0 38.0 38.0 34.2 38.0 70-74 36.1844 38.0 38.0 38.0 34.2 38.0 75-79 36.13145 38.0 38.0 38.0 34.4 38.0 80-84 36.0453 38.0 38.0 38.0 34.2 38.0 85-89 35.88905 38.0 38.0 38.0 33.6 38.0 90-94 35.765049999999995 38.0 38.0 38.0 33.2 38.0 95-99 35.429449999999996 38.0 38.0 38.0 31.8 38.0 100-104 34.55395 38.0 36.8 38.0 27.0 38.0 105-109 34.5184 38.0 36.6 38.0 26.2 38.0 110-114 34.4049 38.0 36.0 38.0 25.4 38.0 115-119 34.050250000000005 38.0 35.6 38.0 23.0 38.0 120-124 33.99055 38.0 35.2 38.0 22.6 38.0 125-129 33.819399999999995 38.0 35.0 38.0 20.6 38.0 130-134 33.17475 38.0 34.2 38.0 14.4 38.0 135-139 32.78135 38.0 33.4 38.0 13.4 38.0 140-144 32.20775 38.0 33.0 38.0 13.0 38.0 145-149 30.9397 38.0 31.0 38.0 4.2 38.0 150-151 25.758125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 24.0 4 9.0 5 1.0 6 0.0 7 4.0 8 2.0 9 1.0 10 2.0 11 6.0 12 4.0 13 2.0 14 3.0 15 10.0 16 6.0 17 10.0 18 19.0 19 4.0 20 12.0 21 13.0 22 14.0 23 20.0 24 17.0 25 35.0 26 16.0 27 28.0 28 39.0 29 44.0 30 48.0 31 62.0 32 65.0 33 123.0 34 153.0 35 257.0 36 656.0 37 2256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.16679360243717 18.98959126681899 11.094186341711094 32.74942878903275 2 31.900279827016025 21.57211905367591 24.319511574662936 22.20808954464513 3 23.5595390524968 24.455825864276566 26.632522407170296 25.352112676056336 4 28.83638211382114 30.46239837398374 19.10569105691057 21.59552845528455 5 27.491057741440983 31.834440470107307 17.78231987736331 22.8921819110884 6 24.44670567285678 33.68099720172984 20.2747392520987 21.59755787331468 7 21.841704718417045 18.41704718417047 33.94216133942161 25.799086757990867 8 25.09467306235799 21.78742741731886 22.721534965917698 30.39636455440545 9 23.390342052313883 22.208249496981892 27.213279678068407 27.188128772635817 10-14 26.630844172148848 24.973635313614224 22.226686084467435 26.1688344297695 15-19 26.90301342111927 24.720182324639147 22.932387946315522 25.44441630792606 20-24 26.560593737291583 24.964416429442863 23.093737291581945 25.38125254168361 25-29 26.694721898291334 24.70719464584495 23.165846980682453 25.43223647518126 30-34 26.852039780799675 25.43129693525472 22.711589202354375 25.005074081591232 35-39 26.73951715374841 24.34053367217281 23.23761118170267 25.682337992376112 40-44 26.70993256603965 23.86046747452213 23.515692338893675 25.913907620544542 45-49 26.9939900173169 24.68676785168585 23.326881939492715 24.992360191504535 50-54 26.7788364078654 24.163794851003445 23.170484492195417 25.886884248935736 55-59 26.862268166615994 24.5008614573832 23.244147157190636 25.392723218810175 60-64 26.26129326971881 24.215815653233175 24.07877372855548 25.44411734849254 65-69 27.329033579033577 24.26289926289926 23.454135954135953 24.953931203931205 70-74 26.746719359578456 23.519278512438568 23.965141612200437 25.76886051578254 75-79 26.691004969070075 24.850420849812394 23.66899908731366 24.789575093803872 80-84 26.944079280008086 24.74466579027202 23.14187481039539 25.1693801193245 85-89 27.079762024805888 24.246243823737018 23.560552586467683 25.113441564989415 90-94 26.99696663296259 24.09504550050556 23.503538928210315 25.40444893832154 95-99 27.119163051798928 24.322531257973974 23.766266904822658 24.79203878540444 100-104 27.17035960770069 24.456437133516683 23.01904415961808 25.354159099164548 105-109 27.078483108282892 25.412592477624298 23.05344301308914 24.455481401003674 110-114 27.066072908036453 25.22783761391881 23.62261806130903 24.08347141673571 115-119 27.228232869654818 24.837712519319936 23.204533745492014 24.72952086553323 120-124 27.082474226804127 25.175257731958762 23.438144329896907 24.304123711340207 125-129 26.8423495436027 24.97034706822753 23.846114176679905 24.341189211489866 130-134 27.42677067727437 24.90571886139381 23.32489538668182 24.34261507465 135-139 27.23743359215366 26.088067020841848 23.007764609726195 23.6667347772783 140-144 27.892129322233007 25.476275601409675 23.14724960416773 23.48434547218959 145-149 28.39907192575406 25.403454498582107 23.212168084557877 22.985305491105954 150-151 28.72437655046351 25.96944770857814 22.875048962005483 22.431126778952866 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 6.5 2 7.5 3 5.5 4 4.0 5 3.0 6 1.5 7 1.5 8 2.0 9 2.0 10 1.5 11 1.5 12 1.5 13 1.0 14 1.0 15 0.5 16 1.5 17 2.5 18 2.0 19 1.5 20 3.0 21 2.0 22 2.5 23 3.0 24 1.0 25 1.0 26 2.5 27 4.5 28 3.5 29 5.5 30 12.0 31 13.0 32 12.0 33 14.5 34 23.0 35 35.5 36 43.0 37 51.0 38 63.0 39 70.0 40 84.5 41 92.0 42 103.5 43 119.0 44 124.0 45 133.5 46 142.0 47 152.5 48 163.0 49 149.0 50 142.5 51 138.0 52 121.0 53 141.5 54 147.5 55 133.0 56 117.5 57 107.5 58 113.5 59 119.5 60 110.5 61 98.0 62 98.0 63 99.5 64 89.5 65 79.0 66 76.5 67 68.0 68 65.0 69 59.0 70 48.0 71 39.0 72 34.0 73 28.0 74 18.0 75 11.0 76 5.0 77 3.0 78 4.0 79 2.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 1.725 3 2.375 4 1.6 5 2.15 6 1.725 7 1.4500000000000002 8 0.975 9 0.6 10-14 0.43499999999999994 15-19 1.275 20-24 1.6400000000000001 25-29 1.385 30-34 1.46 35-39 1.625 40-44 1.385 45-49 1.83 50-54 1.34 55-59 1.3299999999999998 60-64 1.49 65-69 2.32 70-74 1.315 75-79 1.39 80-84 1.11 85-89 0.83 90-94 1.0999999999999999 95-99 2.025 100-104 3.6450000000000005 105-109 3.3550000000000004 110-114 3.44 115-119 2.9499999999999997 120-124 3.0 125-129 3.045 130-134 3.215 135-139 2.12 140-144 2.105 145-149 3.025 150-151 4.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.23013202174475 93.89999999999999 2 2.2521356458710846 4.35 3 0.38829924928811804 1.125 4 0.05177323323841575 0.2 5 0.025886616619207874 0.125 6 0.05177323323841575 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 6 0.15 No Hit GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.775 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.112500000000001 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.824999999999999 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157474 spots for SRR7473326.sra Written 1157474 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra Read 1157467 spots for SRR7473326.sra Written 1157467 spots for SRR7473326.sra SRR ids: ['SRR7473326.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sz1ne176 SRR7473326.sra spots: 23149347 blocks: [[1, 1157467], [1157468, 2314934], [2314935, 3472401], [3472402, 4629868], [4629869, 5787335], [5787336, 6944802], [6944803, 8102269], [8102270, 9259736], [9259737, 10417203], [10417204, 11574670], [11574671, 12732137], [12732138, 13889604], [13889605, 15047071], [15047072, 16204538], [16204539, 17362005], [17362006, 18519472], [18519473, 19676939], [19676940, 20834406], [20834407, 21991873], [21991874, 23149347]] SRR7473326 file size 7822853 SRR7473326 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473326 SRR7473326_1.fastq SRR7473326_2.fastq Input file: SRR7473326_1.fastq Paired file: SRR7473326_2.fastq trimmed: SRR7473326-trimmed-pair1.fastq, SRR7473326-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:32:35 2024 >> started Sat Dec 7 13:33:13 2024 >> done (38.042s) 23149347 read pairs processed; of these: 41744 ( 0.18%) short read pairs filtered out after trimming by size control 68088 ( 0.29%) empty read pairs filtered out after trimming by size control 23039515 (99.53%) read pairs available; of these: 12909967 (56.03%) trimmed read pairs available after processing 10129548 (43.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 17 0.00% 20 8 0.00% 21 12 0.00% 22 14 0.00% 23 22 0.00% 24 25 0.00% 25 26 0.00% 26 36 0.00% 27 16 0.00% 28 44 0.00% 29 32 0.00% 30 48 0.00% 31 48 0.00% 32 52 0.00% 33 41 0.00% 34 58 0.00% 35 41 0.00% 36 47 0.00% 37 83 0.00% 38 68 0.00% 39 72 0.00% 40 86 0.00% 41 95 0.00% 42 123 0.00% 43 106 0.00% 44 109 0.00% 45 162 0.00% 46 152 0.00% 47 162 0.00% 48 173 0.00% 49 204 0.00% 50 246 0.00% 51 277 0.00% 52 304 0.00% 53 311 0.00% 54 319 0.00% 55 398 0.00% 56 373 0.00% 57 463 0.00% 58 506 0.00% 59 592 0.00% 60 693 0.00% 61 791 0.00% 62 836 0.00% 63 1032 0.00% 64 1029 0.00% 65 1184 0.01% 66 1273 0.01% 67 1419 0.01% 68 1701 0.01% 69 2597 0.01% 70 3310 0.01% 71 2773 0.01% 72 2802 0.01% 73 3058 0.01% 74 3179 0.01% 75 3566 0.02% 76 3851 0.02% 77 4224 0.02% 78 4763 0.02% 79 5393 0.02% 80 5783 0.03% 81 6585 0.03% 82 7524 0.03% 83 8615 0.04% 84 10814 0.05% 85 11795 0.05% 86 12639 0.05% 87 13299 0.06% 88 14647 0.06% 89 15100 0.07% 90 16310 0.07% 91 17401 0.08% 92 17910 0.08% 93 20466 0.09% 94 22096 0.10% 95 24022 0.10% 96 24637 0.11% 97 25810 0.11% 98 26067 0.11% 99 27516 0.12% 100 29145 0.13% 101 29444 0.13% 102 31461 0.14% 103 33326 0.14% 104 34850 0.15% 105 38118 0.17% 106 39010 0.17% 107 39394 0.17% 108 42024 0.18% 109 44221 0.19% 110 45516 0.20% 111 45124 0.20% 112 47035 0.20% 113 51872 0.23% 114 52027 0.23% 115 55630 0.24% 116 57859 0.25% 117 57191 0.25% 118 58714 0.25% 119 59784 0.26% 120 63094 0.27% 121 62510 0.27% 122 65975 0.29% 123 69137 0.30% 124 73581 0.32% 125 74470 0.32% 126 76956 0.33% 127 79356 0.34% 128 81698 0.35% 129 83826 0.36% 130 87469 0.38% 131 90054 0.39% 132 93517 0.41% 133 98790 0.43% 134 103955 0.45% 135 109110 0.47% 136 115199 0.50% 137 123385 0.54% 138 128906 0.56% 139 136580 0.59% 140 145673 0.63% 141 158895 0.69% 142 172835 0.75% 143 195337 0.85% 144 222968 0.97% 145 266400 1.16% 146 330468 1.43% 147 442431 1.92% 148 677246 2.94% 149 1326067 5.76% 150 5877841 25.51% 151 10129548 43.97% 23039515 reads passed initial QC criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=23 prefix-density=1.06 prefix-fanout=2.4 sequence=CGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=25.67 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TTATATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGAT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=27 prefix-density=0.70 prefix-fanout=2.6 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=34.04 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.5 sequence=CTGCCGGGTGAGGAAGGTGCGGCCGCTGAGGAGGGCCCTCAAGGGCCTCAAGGCCTGGATCACCGGCCAGAGGAAGGACCAGTCCCCTGGCACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCGACCGCCACCATGGCCCTCTCCTCCTCGACCTTCGCCGGGAAGGCGGTGAAGAACCTGCCGGCGCTCGGAGAGGCCCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA SRR7473326 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:34:04 Started mapping on | Dec 07 13:34:04 Finished on | Dec 07 13:43:33 Mapping speed, Million of reads per hour | 145.77 Number of input reads | 23039515 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19847414 Uniquely mapped reads % | 86.15% Average mapped length | 292.15 Number of splices: Total | 20177871 Number of splices: Annotated (sjdb) | 19054814 Number of splices: GT/AG | 19921426 Number of splices: GC/AG | 231512 Number of splices: AT/AC | 6508 Number of splices: Non-canonical | 18425 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.01% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 174955 % of reads mapped to multiple loci | 0.76% Number of reads mapped to too many loci | 7553 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.56% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3036431 3036431 3036431 N_multimapping 174955 174955 174955 N_noFeature 500467 19183547 691203 N_ambiguous 566713 2504 94934 UnstrandedReadsAssigned:18780234 PositiveStrandReadsAssigned:661363 NegativeStrandReadsAssigned:19061277 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473326 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473326-trimmed-pair1.fastq SRR7473326-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,039,515 reads, 19,128,614 reads pseudoaligned [quant] estimated average fragment length: 261.377 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR7473326.ke.tsv 35125 SRR7473326.se.tsv 88098 total ==> SRR7473326.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.201 0 0 PNS24247 1044 783.623 25.0597 2.01647 PNS24249 1928 1667.62 56.0768 2.12036 PNS24246 1044 783.623 25.0597 2.01647 PNS24248 1044 783.623 25.0597 2.01647 PNS24244 1471 1210.62 99.7442 5.1952 PNS24243 293 95.1478 0 0 KQK14069 1603 1342.62 2430.62 114.153 KQK14071 474 235.123 44.7854 12.0106 ==> SRR7473326.se.tsv <== BRADI_1g14170v3 2710 BRADI_1g53295v3 95 BRADI_1g59795v3 662 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 186 BRADI_1g74790v3 82 BRADI_1g09890v3 0 BRADI_1g77505v3 356 BRADI_1g48960v3 0 SRR7473326 completed mapping pipeline successfully