Starting /dee2/code/volunteer_pipeline.sh SRR7473329 current disk space = 1543082426368 free memory = 1599810692 SRR7473329 SRAfilesize 4941b53168d346ef0f1f48dbf4f65ad7 SRR7473329.sra SRR7473329.sra file validated SRR7473329 is paired end SRR7473329 is conventional basespace SRR7473329 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473329_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0265 34.0 33.0 34.0 33.0 34.0 2 33.3145 34.0 33.0 34.0 33.0 34.0 3 33.37275 34.0 33.0 34.0 33.0 34.0 4 33.39575 34.0 34.0 34.0 33.0 34.0 5 33.283 34.0 33.0 34.0 33.0 34.0 6 36.98075 38.0 37.0 38.0 35.0 38.0 7 37.333 38.0 38.0 38.0 37.0 38.0 8 37.498 38.0 38.0 38.0 37.0 38.0 9 37.44975 38.0 38.0 38.0 37.0 38.0 10-14 37.487 38.0 38.0 38.0 37.6 38.0 15-19 37.43285 38.0 38.0 38.0 37.6 38.0 20-24 37.45055 38.0 38.0 38.0 37.4 38.0 25-29 37.306 38.0 38.0 38.0 37.0 38.0 30-34 37.161350000000006 38.0 38.0 38.0 36.4 38.0 35-39 37.11704999999999 38.0 38.0 38.0 36.2 38.0 40-44 36.864900000000006 38.0 38.0 38.0 35.4 38.0 45-49 36.9083 38.0 38.0 38.0 35.4 38.0 50-54 36.800349999999995 38.0 38.0 38.0 34.8 38.0 55-59 36.883750000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.75599999999999 38.0 38.0 38.0 34.6 38.0 65-69 36.553 38.0 38.0 38.0 34.2 38.0 70-74 36.4687 38.0 38.0 38.0 34.0 38.0 75-79 36.50005 38.0 38.0 38.0 34.0 38.0 80-84 36.3723 38.0 38.0 38.0 34.0 38.0 85-89 36.120549999999994 38.0 37.6 38.0 33.2 38.0 90-94 35.8776 38.0 37.0 38.0 32.4 38.0 95-99 35.557950000000005 38.0 36.4 38.0 30.8 38.0 100-104 35.39235 38.0 36.0 38.0 29.4 38.0 105-109 35.15069999999999 38.0 35.8 38.0 28.8 38.0 110-114 34.9298 38.0 35.4 38.0 28.0 38.0 115-119 34.3853 38.0 35.0 38.0 24.6 38.0 120-124 34.167750000000005 38.0 34.4 38.0 24.2 38.0 125-129 33.46775 38.0 34.0 38.0 18.6 38.0 130-134 33.110299999999995 38.0 34.0 38.0 15.0 38.0 135-139 32.4582 38.0 33.2 38.0 14.0 38.0 140-144 31.827999999999996 36.8 32.2 38.0 13.6 38.0 145-149 30.12605 36.0 30.0 38.0 4.2 38.0 150-151 25.6025 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 2.0 14 3.0 15 3.0 16 6.0 17 8.0 18 8.0 19 9.0 20 5.0 21 15.0 22 20.0 23 20.0 24 23.0 25 13.0 26 26.0 27 34.0 28 37.0 29 50.0 30 72.0 31 106.0 32 109.0 33 143.0 34 229.0 35 411.0 36 932.0 37 1713.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.92786636294609 11.237661351556568 11.566691976714756 42.26778030878259 2 24.3114672008012 15.42313470205308 31.422133199799703 28.84326489734602 3 22.95 18.025 23.95 35.075 4 27.450000000000003 25.575 19.525000000000002 27.450000000000003 5 25.979899497487434 29.773869346733665 22.66331658291457 21.582914572864322 6 22.075 32.05 23.25 22.625 7 17.349999999999998 23.05 39.4 20.200000000000003 8 20.625 21.5 28.749999999999996 29.125 9 20.775 20.5 31.624999999999996 27.1 10-14 23.22 25.405 24.490000000000002 26.884999999999998 15-19 22.814999999999998 25.275 25.105 26.805 20-24 23.395 25.19 24.94 26.474999999999998 25-29 22.895 25.369999999999997 24.8 26.935 30-34 23.405 24.265 25.145 27.185 35-39 23.407340734073408 25.052505250525055 25.12251225122512 26.41764176417642 40-44 23.399889906420455 25.4115998598809 25.081319121253067 26.107191112445577 45-49 23.452035610683204 24.68740622186656 24.772431729518857 27.088126437931383 50-54 23.380000000000003 25.085 24.93 26.605 55-59 22.81 24.625 25.545 27.02 60-64 23.965 23.724999999999998 25.28 27.029999999999998 65-69 23.165 24.63 24.975 27.229999999999997 70-74 23.724999999999998 24.875 24.335 27.065 75-79 23.685000000000002 24.765 24.38 27.169999999999998 80-84 24.455 23.925 24.565 27.055 85-89 23.91 24.415 24.875 26.8 90-94 24.085655676189525 23.925551608545554 24.55596137489368 27.432831340371237 95-99 23.92764080978152 23.867508518741232 25.330727600721588 26.87412307075566 100-104 24.455 24.215 25.215 26.115 105-109 25.05 24.015 24.175 26.76 110-114 23.990000000000002 24.445 24.12 27.445000000000004 115-119 24.55 24.195 24.044999999999998 27.21 120-124 24.01220366109833 24.057217165149545 24.612383715114532 27.31819545863759 125-129 24.80826106571758 24.07138202416161 24.913529500225575 26.206827409895233 130-134 24.582724017951694 24.49195703696233 24.0431647420705 26.882154203015478 135-139 24.904272470777915 23.891575977428456 24.274486094316806 26.929665457476826 140-144 25.013771345585656 23.571535880614952 24.047273273574042 27.36741950022535 145-149 24.730478589420652 23.748110831234257 23.717884130982366 27.80352644836272 150-151 24.573594440934933 23.310170562223625 24.68730259001895 27.428932406822486 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 2.0 28 4.5 29 4.5 30 4.0 31 6.5 32 8.5 33 21.0 34 30.5 35 32.5 36 40.0 37 54.0 38 70.5 39 88.0 40 115.5 41 136.0 42 145.0 43 150.0 44 165.5 45 182.0 46 172.5 47 161.0 48 150.5 49 143.0 50 154.5 51 155.5 52 140.5 53 141.0 54 142.5 55 134.0 56 121.0 57 120.5 58 119.5 59 100.0 60 89.0 61 82.5 62 81.0 63 78.0 64 64.5 65 50.5 66 46.0 67 49.0 68 45.5 69 36.5 70 33.5 71 31.5 72 25.0 73 20.0 74 17.5 75 12.0 76 4.5 77 3.5 78 4.5 79 2.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.15 3 0.0 4 0.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.08499999999999999 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.065 95-99 0.22 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.03 125-129 0.255 130-134 0.845 135-139 0.76 140-144 0.155 145-149 0.75 150-151 1.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2622029133657 96.125 2 1.4566828520316892 2.85 3 0.17889087656529518 0.525 4 0.051111679018655765 0.2 5 0.025555839509327882 0.125 6 0.0 0.0 7 0.025555839509327882 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 7 0.17500000000000002 No Hit GTCAGCATTCGCACTTCTGATACCTCCAGCATGCCTCACAGCACACCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.1 0.0 0.0 0.0 0.0 116-117 3.5125 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.175 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.1875 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 7.7125 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCAC 10 0.0064271726 147.9359 1 >>END_MODULE SRR7473329 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473329_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.01825 33.0 33.0 34.0 32.0 34.0 2 32.29425 33.0 33.0 34.0 32.0 34.0 3 32.26775 34.0 33.0 34.0 32.0 34.0 4 32.25525 34.0 33.0 34.0 32.0 34.0 5 32.113 34.0 33.0 34.0 32.0 34.0 6 36.23475 38.0 38.0 38.0 35.0 38.0 7 36.45125 38.0 38.0 38.0 35.0 38.0 8 36.62825 38.0 38.0 38.0 35.0 38.0 9 36.6605 38.0 38.0 38.0 35.0 38.0 10-14 36.77295 38.0 38.0 38.0 36.0 38.0 15-19 36.56595 38.0 38.0 38.0 35.8 38.0 20-24 36.130100000000006 38.0 38.0 38.0 34.6 38.0 25-29 36.34585 38.0 38.0 38.0 35.2 38.0 30-34 36.44175 38.0 38.0 38.0 36.0 38.0 35-39 36.419549999999994 38.0 38.0 38.0 35.8 38.0 40-44 36.3327 38.0 38.0 38.0 35.4 38.0 45-49 36.26189999999999 38.0 38.0 38.0 35.2 38.0 50-54 36.3226 38.0 38.0 38.0 35.0 38.0 55-59 36.278800000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.09525 38.0 38.0 38.0 34.2 38.0 65-69 35.7669 38.0 38.0 38.0 33.4 38.0 70-74 35.898250000000004 38.0 38.0 38.0 33.6 38.0 75-79 35.77445 38.0 38.0 38.0 33.0 38.0 80-84 35.802099999999996 38.0 38.0 38.0 33.2 38.0 85-89 35.70715 38.0 38.0 38.0 33.0 38.0 90-94 35.44235 38.0 37.8 38.0 31.0 38.0 95-99 35.00095 38.0 37.0 38.0 29.4 38.0 100-104 34.37095000000001 38.0 36.0 38.0 24.4 38.0 105-109 34.36865 38.0 36.0 38.0 24.6 38.0 110-114 33.99395 38.0 35.4 38.0 21.8 38.0 115-119 33.6528 38.0 35.0 38.0 19.4 38.0 120-124 33.5354 38.0 35.0 38.0 18.6 38.0 125-129 33.15155 38.0 34.4 38.0 14.4 38.0 130-134 32.55095 38.0 33.4 38.0 13.4 38.0 135-139 32.063849999999995 38.0 32.8 38.0 13.0 38.0 140-144 31.3056 38.0 31.2 38.0 8.2 38.0 145-149 29.91735 37.2 29.0 38.0 2.0 38.0 150-151 23.874875000000003 31.0 11.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 20.0 4 21.0 5 1.0 6 1.0 7 2.0 8 3.0 9 1.0 10 5.0 11 2.0 12 5.0 13 4.0 14 10.0 15 9.0 16 7.0 17 13.0 18 15.0 19 13.0 20 9.0 21 17.0 22 19.0 23 14.0 24 31.0 25 25.0 26 38.0 27 30.0 28 52.0 29 44.0 30 51.0 31 83.0 32 101.0 33 112.0 34 170.0 35 296.0 36 683.0 37 2065.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.18876635034624 15.414208771479867 13.875352654526802 34.52167222364709 2 30.341662417134113 21.31565527791943 26.36409994900561 21.978582355940844 3 24.603580562659847 25.294117647058822 23.98976982097187 26.11253196930946 4 27.580932959469795 30.155493244965587 18.939587050726484 23.323986744838134 5 29.846547314578004 30.051150895140665 18.388746803069054 21.713554987212277 6 24.11854879918242 34.28717424629535 18.829841594276957 22.764435360245272 7 23.612870534583227 18.723080820876614 33.113757284013175 24.550291360526984 8 25.40281973816717 22.80966767371601 22.255790533736153 29.531722054380666 9 25.763645468202302 21.732598898347522 25.31296945418127 27.190786179268905 10-14 27.57496740547588 24.611372981646777 21.417109617891885 26.396549994985456 15-19 27.100490072247762 24.281311574799172 23.397160612337693 25.221037740615373 20-24 26.387685407003413 24.85855548193078 22.85539528008563 25.89836383098017 25-29 26.732623033992898 24.819888381532216 22.709284627092845 25.738203957382037 30-34 27.18239886444287 25.10392375544966 22.42218391969989 25.291493460407583 35-39 27.442426701836258 24.637313584254844 23.074972101044942 24.845287612863952 40-44 26.82198024816409 24.97341099012408 22.79564446695366 25.408964294758167 45-49 26.751106363497634 25.14878681519915 23.180222798718145 24.919884022585077 50-54 26.81408764295112 24.714097763384274 23.373140370407853 25.098674223256758 55-59 27.218874993671204 24.798744367373803 23.188699306364235 24.793681332590754 60-64 27.32026807473599 24.65982940698619 23.12652315190902 24.893379366368805 65-69 27.764729909118756 24.512406821198816 22.955172061676706 24.76769120800572 70-74 27.150605768743347 24.626146905256753 23.445024585593348 24.778222740406548 75-79 26.98163791795235 24.685113055794424 23.39015630532652 24.943092720926703 80-84 27.491166077738516 24.674406865219588 23.37708228167592 24.45734477536598 85-89 27.16969727497104 24.842593058983528 23.321412381000354 24.66629728504508 90-94 27.265818937129538 24.66183697249101 23.653680530928618 24.418663559450835 95-99 27.231320368474922 24.698055271238488 23.654042988741043 24.416581371545547 100-104 28.075970272502065 24.886457473162675 23.307184145334432 23.730388109000824 105-109 27.400999021576805 25.052783356506513 23.497605437973117 24.04861218394356 110-114 27.853575657725376 24.45039386294599 23.683262111929157 24.012768367399477 115-119 27.844388411465033 24.63850151803633 23.38805125302321 24.12905881747543 120-124 27.815454171804355 25.272297575010278 23.196670776818742 23.715577476366626 125-129 28.03108275010292 25.102923013585837 23.58995471387402 23.276039522437216 130-134 27.919173222273642 25.02442284950383 23.687593192452052 23.368810735770477 135-139 28.118933278839275 24.95146623071421 23.63850005108818 23.291100439358335 140-144 28.22296087957044 25.364356941958576 23.134748146254154 23.277934032216823 145-149 28.962336664104537 25.201127337945174 23.17191903663848 22.66461696131181 150-151 29.39342771788544 25.91245616313807 22.60033770619561 22.093778412780882 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 3.0 2 5.0 3 4.5 4 5.0 5 5.0 6 3.5 7 2.0 8 1.0 9 1.0 10 1.5 11 2.5 12 2.0 13 2.0 14 4.5 15 4.5 16 1.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 3.0 26 3.5 27 4.0 28 5.0 29 6.5 30 8.0 31 6.5 32 6.5 33 11.0 34 14.0 35 17.5 36 30.0 37 46.0 38 59.5 39 62.5 40 80.0 41 104.0 42 114.5 43 120.5 44 128.5 45 146.5 46 149.0 47 146.5 48 147.0 49 148.0 50 154.0 51 142.5 52 142.0 53 162.0 54 164.0 55 149.0 56 132.0 57 117.0 58 115.0 59 121.5 60 111.5 61 98.0 62 97.0 63 95.0 64 87.0 65 75.0 66 65.0 67 62.5 68 58.5 69 51.0 70 45.5 71 39.5 72 27.0 73 20.0 74 18.0 75 12.0 76 6.5 77 2.0 78 1.5 79 2.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 1.95 3 2.25 4 1.925 5 2.25 6 2.15 7 1.325 8 0.7000000000000001 9 0.15 10-14 0.29 15-19 1.035 20-24 1.905 25-29 1.4500000000000002 30-34 1.37 35-39 1.43 40-44 1.275 45-49 1.7049999999999998 50-54 1.1900000000000002 55-59 1.2449999999999999 60-64 1.52 65-69 2.07 70-74 1.365 75-79 1.155 80-84 0.95 85-89 0.735 90-94 1.3050000000000002 95-99 2.3 100-104 3.1199999999999997 105-109 2.905 110-114 2.8850000000000002 115-119 2.835 120-124 2.68 125-129 2.8400000000000003 130-134 2.7550000000000003 135-139 2.13 140-144 2.225 145-149 2.4250000000000003 150-151 3.7624999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.05427547363031 95.75 2 1.7409114183307732 3.4000000000000004 3 0.12800819252432155 0.375 4 0.025601638504864313 0.1 5 0.0 0.0 6 0.025601638504864313 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025601638504864313 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 9 0.22499999999999998 No Hit GCGACTTATATTCTGTAGCAAGGTTAACCGAATAGGGGAGCCGAAGGGAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.05 0.0 0.025 0.0 0.0 80-81 0.1125 0.0 0.025 0.0 0.0 82-83 0.15 0.0 0.025 0.0 0.0 84-85 0.2 0.0 0.025 0.0 0.0 86-87 0.2625 0.0 0.025 0.0 0.0 88-89 0.3 0.0 0.025 0.0 0.0 90-91 0.38749999999999996 0.0 0.025 0.0 0.0 92-93 0.475 0.0 0.025 0.0 0.0 94-95 0.625 0.0 0.025 0.0 0.0 96-97 0.7749999999999999 0.0 0.025 0.0 0.0 98-99 1.0125 0.0 0.025 0.0 0.0 100-101 1.2 0.0 0.025 0.0 0.0 102-103 1.5 0.0 0.025 0.0 0.0 104-105 1.6625 0.0 0.025 0.0 0.0 106-107 2.0 0.0 0.025 0.0 0.0 108-109 2.2875 0.0 0.025 0.0 0.0 110-111 2.5125 0.0 0.025 0.0 0.0 112-113 2.7249999999999996 0.0 0.025 0.0 0.0 114-115 3.05 0.0 0.025 0.0 0.0 116-117 3.4375 0.0 0.025 0.0 0.0 118-119 3.8125 0.0 0.025 0.0 0.0 120-121 4.35 0.0 0.025 0.0 0.0 122-123 4.7375 0.0 0.025 0.0 0.0 124-125 5.075 0.0 0.025 0.0 0.0 126-127 5.6 0.0 0.025 0.0 0.0 128-129 6.074999999999999 0.0 0.025 0.0 0.0 130-131 6.6625 0.0 0.025 0.0 0.0 132-133 7.1625 0.0 0.025 0.0 0.0 134-135 7.6375 0.0 0.025 0.0 0.0 136-137 8.0625 0.0 0.025 0.0 0.0 138-139 8.5625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAAGT 10 0.0070585394 143.3718 3 GAAGAAG 45 0.009348197 47.7906 2 >>END_MODULE Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219268 spots for SRR7473329.sra Written 1219268 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra Read 1219253 spots for SRR7473329.sra Written 1219253 spots for SRR7473329.sra SRR ids: ['SRR7473329.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d48uaduv SRR7473329.sra spots: 24385075 blocks: [[1, 1219253], [1219254, 2438506], [2438507, 3657759], [3657760, 4877012], [4877013, 6096265], [6096266, 7315518], [7315519, 8534771], [8534772, 9754024], [9754025, 10973277], [10973278, 12192530], [12192531, 13411783], [13411784, 14631036], [14631037, 15850289], [15850290, 17069542], [17069543, 18288795], [18288796, 19508048], [19508049, 20727301], [20727302, 21946554], [21946555, 23165807], [23165808, 24385075]] SRR7473329 file size 8241601 SRR7473329 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473329 SRR7473329_1.fastq SRR7473329_2.fastq Input file: SRR7473329_1.fastq Paired file: SRR7473329_2.fastq trimmed: SRR7473329-trimmed-pair1.fastq, SRR7473329-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:36:56 2024 >> started Sat Dec 7 13:37:27 2024 >> done (31.288s) 24385075 read pairs processed; of these: 38575 ( 0.16%) short read pairs filtered out after trimming by size control 80419 ( 0.33%) empty read pairs filtered out after trimming by size control 24266081 (99.51%) read pairs available; of these: 14390661 (59.30%) trimmed read pairs available after processing 9875420 (40.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 13 0.00% 21 16 0.00% 22 18 0.00% 23 15 0.00% 24 13 0.00% 25 9 0.00% 26 16 0.00% 27 26 0.00% 28 32 0.00% 29 36 0.00% 30 31 0.00% 31 35 0.00% 32 40 0.00% 33 53 0.00% 34 39 0.00% 35 58 0.00% 36 54 0.00% 37 68 0.00% 38 65 0.00% 39 63 0.00% 40 83 0.00% 41 88 0.00% 42 78 0.00% 43 116 0.00% 44 121 0.00% 45 135 0.00% 46 142 0.00% 47 156 0.00% 48 203 0.00% 49 196 0.00% 50 244 0.00% 51 303 0.00% 52 333 0.00% 53 307 0.00% 54 340 0.00% 55 358 0.00% 56 396 0.00% 57 450 0.00% 58 477 0.00% 59 590 0.00% 60 617 0.00% 61 748 0.00% 62 796 0.00% 63 902 0.00% 64 1026 0.00% 65 1168 0.00% 66 1373 0.01% 67 1915 0.01% 68 2957 0.01% 69 5229 0.02% 70 4065 0.02% 71 2442 0.01% 72 2504 0.01% 73 2683 0.01% 74 2908 0.01% 75 3169 0.01% 76 3449 0.01% 77 3861 0.02% 78 4340 0.02% 79 5009 0.02% 80 5458 0.02% 81 5939 0.02% 82 6772 0.03% 83 7777 0.03% 84 9999 0.04% 85 11032 0.05% 86 11915 0.05% 87 12651 0.05% 88 14594 0.06% 89 15034 0.06% 90 15605 0.06% 91 16465 0.07% 92 17293 0.07% 93 19783 0.08% 94 20639 0.09% 95 23154 0.10% 96 23949 0.10% 97 25393 0.10% 98 26462 0.11% 99 28072 0.12% 100 29983 0.12% 101 29858 0.12% 102 31736 0.13% 103 33620 0.14% 104 35582 0.15% 105 39011 0.16% 106 39725 0.16% 107 40692 0.17% 108 43736 0.18% 109 47388 0.20% 110 49351 0.20% 111 48463 0.20% 112 49719 0.20% 113 55008 0.23% 114 54801 0.23% 115 58571 0.24% 116 61045 0.25% 117 61545 0.25% 118 64758 0.27% 119 66456 0.27% 120 70142 0.29% 121 70499 0.29% 122 74884 0.31% 123 78056 0.32% 124 80602 0.33% 125 81980 0.34% 126 84801 0.35% 127 88685 0.37% 128 91967 0.38% 129 95689 0.39% 130 100383 0.41% 131 103623 0.43% 132 108250 0.45% 133 114430 0.47% 134 119987 0.49% 135 125364 0.52% 136 132064 0.54% 137 141525 0.58% 138 150437 0.62% 139 161408 0.67% 140 172019 0.71% 141 190507 0.79% 142 209348 0.86% 143 234428 0.97% 144 270789 1.12% 145 320437 1.32% 146 402872 1.66% 147 539964 2.23% 148 810074 3.34% 149 1567324 6.46% 150 6282091 25.89% 151 9875420 40.70% 24266081 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=33 prefix-density=0.45 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.16 sequence-density-rank=29 fanout-score=13.30 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=4.5 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=26 prefix-density=0.98 prefix-fanout=2.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.15 sequence-density-rank=25 fanout-score=10.10 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=5.7 sequence=GTCAAGTTCGGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR7473329 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:38:20 Started mapping on | Dec 07 13:38:20 Finished on | Dec 07 13:45:55 Mapping speed, Million of reads per hour | 192.00 Number of input reads | 24266081 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 21376994 Uniquely mapped reads % | 88.09% Average mapped length | 292.14 Number of splices: Total | 21248126 Number of splices: Annotated (sjdb) | 20027014 Number of splices: GT/AG | 20991462 Number of splices: GC/AG | 227982 Number of splices: AT/AC | 9657 Number of splices: Non-canonical | 19025 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221616 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 24801 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.87% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2687179 2687179 2687179 N_multimapping 221616 221616 221616 N_noFeature 528599 20655646 791056 N_ambiguous 519950 2425 61925 UnstrandedReadsAssigned:20328445 PositiveStrandReadsAssigned:718923 NegativeStrandReadsAssigned:20524013 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7473329 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473329-trimmed-pair1.fastq SRR7473329-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,266,081 reads, 20,649,763 reads pseudoaligned [quant] estimated average fragment length: 258.718 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR7473329.ke.tsv 35125 SRR7473329.se.tsv 88098 total ==> SRR7473329.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.835 26.7448 2.31638 PNS24247 1044 786.282 22.7843 1.7037 PNS24249 1928 1670.28 57.4398 2.02189 PNS24246 1044 786.282 22.7843 1.7037 PNS24248 1044 786.282 22.7843 1.7037 PNS24244 1471 1213.28 162.462 7.87275 PNS24243 293 94.3837 0 0 KQK14069 1603 1345.28 305.451 13.3495 KQK14071 474 234.983 6.79389 1.69988 ==> SRR7473329.se.tsv <== BRADI_1g14170v3 347 BRADI_1g53295v3 40 BRADI_1g59795v3 280 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 1386 BRADI_1g74790v3 355 BRADI_1g09890v3 6 BRADI_1g77505v3 231 BRADI_1g48960v3 0 SRR7473329 completed mapping pipeline successfully