Starting /dee2/code/volunteer_pipeline.sh SRR7473331 current disk space = 1542934122496 free memory = 1593140716 SRR7473331 SRAfilesize 7618c144fcb4c905077139e3b3e9256d SRR7473331.sra SRR7473331.sra file validated SRR7473331 is paired end SRR7473331 is conventional basespace SRR7473331 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473331_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29675 34.0 33.0 34.0 33.0 34.0 2 33.3585 34.0 33.0 34.0 33.0 34.0 3 33.47525 34.0 34.0 34.0 33.0 34.0 4 33.431 34.0 34.0 34.0 33.0 34.0 5 33.40275 34.0 34.0 34.0 33.0 34.0 6 37.078 38.0 37.0 38.0 36.0 38.0 7 37.39975 38.0 38.0 38.0 37.0 38.0 8 37.472 38.0 38.0 38.0 37.0 38.0 9 37.472 38.0 38.0 38.0 37.0 38.0 10-14 37.4433 38.0 38.0 38.0 37.4 38.0 15-19 37.3438 38.0 38.0 38.0 37.0 38.0 20-24 37.43265 38.0 38.0 38.0 37.2 38.0 25-29 37.37305 38.0 38.0 38.0 37.0 38.0 30-34 37.08085 38.0 38.0 38.0 36.2 38.0 35-39 37.0416 38.0 38.0 38.0 36.0 38.0 40-44 36.8817 38.0 38.0 38.0 35.2 38.0 45-49 36.8517 38.0 38.0 38.0 35.0 38.0 50-54 36.821000000000005 38.0 38.0 38.0 35.0 38.0 55-59 36.77759999999999 38.0 38.0 38.0 34.8 38.0 60-64 36.78359999999999 38.0 38.0 38.0 34.8 38.0 65-69 36.62859999999999 38.0 38.0 38.0 34.2 38.0 70-74 36.365950000000005 38.0 38.0 38.0 33.6 38.0 75-79 36.4406 38.0 38.0 38.0 34.0 38.0 80-84 36.420049999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.2889 38.0 37.6 38.0 33.8 38.0 90-94 35.991949999999996 38.0 37.0 38.0 32.4 38.0 95-99 35.674549999999996 38.0 36.4 38.0 31.0 38.0 100-104 35.52719999999999 38.0 36.0 38.0 30.6 38.0 105-109 35.3722 38.0 36.0 38.0 30.2 38.0 110-114 35.1416 38.0 35.6 38.0 28.4 38.0 115-119 34.7563 38.0 35.0 38.0 27.4 38.0 120-124 34.32854999999999 38.0 34.8 38.0 24.4 38.0 125-129 34.0276 38.0 34.0 38.0 23.0 38.0 130-134 33.4347 38.0 34.0 38.0 20.2 38.0 135-139 32.9967 38.0 33.2 38.0 15.0 38.0 140-144 32.188550000000006 36.8 32.2 38.0 14.0 38.0 145-149 30.813100000000002 36.0 31.0 38.0 8.6 38.0 150-151 25.909125000000003 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 2.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 9.0 18 9.0 19 7.0 20 6.0 21 6.0 22 15.0 23 13.0 24 14.0 25 23.0 26 34.0 27 36.0 28 47.0 29 48.0 30 60.0 31 73.0 32 95.0 33 168.0 34 237.0 35 374.0 36 1010.0 37 1708.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.89585947302384 13.048933500627353 10.6900878293601 37.36511919698871 2 25.224999999999998 15.225 33.2 26.35 3 21.5 21.25 23.925 33.324999999999996 4 25.85 28.299999999999997 21.224999999999998 24.625 5 25.663495242864297 30.946419629444165 22.158237356034054 21.231847771657485 6 22.1 30.75 23.799999999999997 23.35 7 19.3 20.5 39.025 21.175 8 19.25 22.1 28.375 30.275000000000002 9 20.3 20.7 31.275 27.725 10-14 23.255 25.14 24.23 27.375 15-19 23.965 24.245 25.019999999999996 26.77 20-24 23.25 24.88 25.619999999999997 26.25 25-29 23.200000000000003 24.95 25.165 26.685 30-34 23.715 23.830000000000002 25.8 26.655 35-39 23.5370611183355 23.777133139941984 25.17255176552966 27.513253976192857 40-44 23.525 24.58 25.405 26.490000000000002 45-49 24.104999999999997 24.5 24.715 26.68 50-54 24.125 24.42 24.785 26.669999999999998 55-59 24.21 24.154999999999998 25.019999999999996 26.615 60-64 24.085 24.325 24.834999999999997 26.755000000000003 65-69 23.98 25.180000000000003 24.349999999999998 26.490000000000002 70-74 23.405 25.0 24.595 27.0 75-79 24.2 24.07 24.515 27.215 80-84 23.69 24.585 24.905 26.82 85-89 23.68 24.435000000000002 25.119999999999997 26.765 90-94 24.14 24.095 24.915000000000003 26.85 95-99 24.599759855913547 24.104462677606563 24.51971182709626 26.776065639383628 100-104 24.515 23.905 25.495 26.085 105-109 24.545 24.09 24.445 26.919999999999998 110-114 24.135 23.895 25.405 26.565 115-119 24.529999999999998 24.060000000000002 24.5 26.91 120-124 24.685000000000002 23.945 24.11 27.26 125-129 24.795 23.87 24.765 26.57 130-134 24.83568310671818 24.258692489087352 24.479454116702623 26.426170287491846 135-139 24.48642148511875 24.571600360757593 24.361158432708688 26.580819721414972 140-144 24.8 24.455 24.38 26.365 145-149 24.89115748386128 24.075464144522847 24.155532202372015 26.877846169243856 150-151 25.145165362282253 23.592527139611207 24.450896238323654 26.811411259782886 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 3.5 29 8.5 30 8.5 31 7.0 32 16.0 33 24.5 34 24.0 35 29.0 36 40.0 37 57.5 38 74.5 39 87.0 40 108.5 41 121.0 42 138.5 43 157.5 44 148.0 45 159.0 46 186.5 47 184.0 48 165.0 49 161.5 50 156.5 51 135.5 52 129.5 53 125.0 54 127.0 55 126.0 56 111.5 57 116.5 58 115.0 59 105.0 60 94.5 61 86.5 62 85.0 63 74.5 64 75.0 65 78.0 66 67.5 67 65.0 68 59.5 69 41.5 70 32.5 71 24.5 72 16.0 73 11.0 74 11.0 75 9.0 76 4.0 77 3.5 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.06 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.345 135-139 0.21 140-144 0.0 145-149 0.08499999999999999 150-151 0.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75729140248541 97.35000000000001 2 1.0905401978189198 2.15 3 0.10144559979710879 0.3 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.7625000000000002 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.5875000000000004 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.2625 0.0 0.0 0.0 0.0 136-137 5.824999999999999 0.0 0.0 0.0 0.0 138-139 6.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCTG 10 0.0068910434 144.575 8 TCTGACG 10 0.0068910434 144.575 7 GGGACTG 10 0.0068910434 144.575 2 >>END_MODULE SRR7473331 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473331_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.775 33.0 33.0 34.0 31.0 34.0 2 32.13775 33.0 33.0 34.0 32.0 34.0 3 32.071 34.0 33.0 34.0 31.0 34.0 4 32.0 34.0 33.0 34.0 31.0 34.0 5 32.10975 34.0 33.0 34.0 32.0 34.0 6 36.384 38.0 38.0 38.0 35.0 38.0 7 36.624 38.0 38.0 38.0 35.0 38.0 8 36.7825 38.0 38.0 38.0 35.0 38.0 9 36.84875 38.0 38.0 38.0 36.0 38.0 10-14 36.945049999999995 38.0 38.0 38.0 36.4 38.0 15-19 36.744299999999996 38.0 38.0 38.0 36.2 38.0 20-24 36.26945 38.0 38.0 38.0 35.4 38.0 25-29 36.49589999999999 38.0 38.0 38.0 35.6 38.0 30-34 36.6315 38.0 38.0 38.0 36.0 38.0 35-39 36.5252 38.0 38.0 38.0 36.0 38.0 40-44 36.681200000000004 38.0 38.0 38.0 36.2 38.0 45-49 36.4034 38.0 38.0 38.0 36.0 38.0 50-54 36.4897 38.0 38.0 38.0 35.6 38.0 55-59 36.559000000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.38365 38.0 38.0 38.0 34.8 38.0 65-69 35.96405 38.0 38.0 38.0 33.8 38.0 70-74 36.2133 38.0 38.0 38.0 34.4 38.0 75-79 36.19615 38.0 38.0 38.0 34.2 38.0 80-84 36.165150000000004 38.0 38.0 38.0 34.0 38.0 85-89 35.940999999999995 38.0 38.0 38.0 33.4 38.0 90-94 35.7142 38.0 38.0 38.0 32.8 38.0 95-99 35.2408 38.0 38.0 38.0 30.4 38.0 100-104 34.719 38.0 37.2 38.0 27.6 38.0 105-109 34.646699999999996 38.0 36.8 38.0 27.4 38.0 110-114 34.36279999999999 38.0 36.0 38.0 25.0 38.0 115-119 33.88775 38.0 35.6 38.0 21.4 38.0 120-124 33.938599999999994 38.0 35.0 38.0 22.2 38.0 125-129 33.70399999999999 38.0 35.0 38.0 20.2 38.0 130-134 32.99705 38.0 33.8 38.0 14.2 38.0 135-139 32.695100000000004 38.0 33.4 38.0 13.4 38.0 140-144 32.14845 38.0 33.0 38.0 12.6 38.0 145-149 31.1019 38.0 31.4 38.0 4.2 38.0 150-151 25.411625 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 10.0 4 22.0 5 2.0 6 5.0 7 3.0 8 1.0 9 1.0 10 3.0 11 2.0 12 4.0 13 6.0 14 12.0 15 8.0 16 17.0 17 9.0 18 16.0 19 8.0 20 16.0 21 17.0 22 18.0 23 27.0 24 30.0 25 14.0 26 24.0 27 19.0 28 29.0 29 27.0 30 57.0 31 63.0 32 84.0 33 103.0 34 164.0 35 264.0 36 657.0 37 2241.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.9118102114492 18.87570912841671 12.558019597730787 29.654461062403303 2 30.857580398162327 22.919857069933638 25.85502807554875 20.367534456355283 3 24.685977954370674 25.044860292232762 24.22455780569085 26.04460394770572 4 27.097767513471897 32.43520656915576 17.885552989479088 22.581472927893252 5 28.348271446862995 32.804097311139564 18.079385403329066 20.768245838668374 6 24.207054047196145 34.63587921847247 18.599340268967268 22.55772646536412 7 23.036253776435046 18.152064451158108 34.18932527693857 24.622356495468278 8 23.992994746059544 22.291718789091817 22.742056542406804 30.97322992244183 9 24.25 22.95 24.875 27.925 10-14 26.1 25.855 21.895 26.150000000000002 15-19 25.483206988302626 25.638837291028665 23.128671118028013 25.749284602640692 20-24 26.723655421564136 25.482114689869228 22.709001170304788 25.085228718261842 25-29 26.1367650769619 25.102195306585916 23.14408276558163 25.616956850870555 30-34 25.93281705722619 25.404807402192496 22.970934325656238 25.69144121492507 35-39 26.455587537241833 25.117406453567643 22.74402868252285 25.68297732666768 40-44 26.062763184279124 24.964908762783235 23.37577702025266 25.59655103268498 45-49 26.70813735902493 24.381732665756335 23.49163000050574 25.418499974712994 50-54 26.699200080495046 24.344720028173267 23.419027016149318 25.53705287518237 55-59 26.747156956064327 24.482741345623968 23.400631230900256 25.369470467411453 60-64 26.230579717431745 24.97863140429383 23.54065061089044 25.25013826738398 65-69 27.064732142857146 25.0101461038961 22.975852272727273 24.949269480519483 70-74 27.107221886944277 23.83826191913096 23.325286662643332 25.729229531281433 75-79 26.76995587645407 24.86462093862816 23.184917769755316 25.180505415162457 80-84 26.952772485711417 24.952371402787527 23.172565928005614 24.922290183495438 85-89 26.86275492308463 24.923585709274942 23.009470361276747 25.20418900636368 90-94 26.57864234238774 24.70896537821902 23.670815904853097 25.041576374540142 95-99 26.67312793307488 24.78575800856968 23.5207100591716 25.020403999183838 100-104 26.917935006170303 24.732620320855613 23.6013986013986 24.748046071575484 105-109 26.6601662732218 25.526018680078007 23.437339628451195 24.376475418249 110-114 27.977782349310843 24.423986833984777 23.25138860316807 24.34684221353631 115-119 27.60306757939163 25.18400329404498 22.301713932780896 24.91121519378249 120-124 27.594702802587 24.925572323170105 23.313828149060672 24.165896725182222 125-129 27.06365503080082 25.282340862423 23.203285420944557 24.45071868583162 130-134 28.109081553897607 24.980704913815284 23.087213789554927 23.822999742732183 135-139 27.694892815316464 25.413717602729264 23.45842456336881 23.432965018585467 140-144 27.97319932998325 25.237297599106647 23.069894929191413 23.719608141718695 145-149 27.65577119509704 26.062308478038815 23.268641470888664 23.013278855975486 150-151 28.10034915298073 25.38471485839907 23.069959912065173 23.444976076555022 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 0.5 13 1.0 14 1.0 15 2.0 16 3.5 17 2.0 18 2.0 19 1.5 20 0.5 21 1.0 22 3.0 23 3.5 24 1.5 25 1.5 26 3.5 27 5.0 28 5.5 29 6.0 30 10.5 31 14.5 32 11.5 33 11.5 34 16.5 35 26.5 36 36.0 37 42.5 38 51.5 39 70.5 40 99.0 41 118.0 42 127.5 43 141.5 44 157.0 45 158.0 46 151.5 47 148.5 48 148.5 49 149.5 50 143.5 51 138.0 52 136.5 53 137.0 54 134.0 55 125.5 56 116.0 57 106.5 58 105.0 59 115.5 60 110.5 61 98.5 62 97.5 63 92.5 64 87.5 65 77.0 66 73.5 67 69.0 68 60.5 69 53.5 70 42.5 71 38.0 72 35.0 73 25.0 74 12.5 75 8.0 76 8.0 77 6.0 78 2.5 79 2.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 2.0500000000000003 3 2.475 4 2.5749999999999997 5 2.375 6 1.4749999999999999 7 0.7000000000000001 8 0.075 9 0.0 10-14 0.0 15-19 0.40499999999999997 20-24 1.735 25-29 0.9249999999999999 30-34 0.5700000000000001 35-39 0.985 40-44 0.26 45-49 1.135 50-54 0.615 55-59 0.19499999999999998 60-64 0.555 65-69 1.44 70-74 0.58 75-79 0.27999999999999997 80-84 0.27 85-89 0.215 90-94 0.7849999999999999 95-99 1.9800000000000002 100-104 2.76 105-109 2.5700000000000003 110-114 2.78 115-119 2.855 120-124 2.59 125-129 2.6 130-134 2.825 135-139 1.805 140-144 1.4949999999999999 145-149 2.1 150-151 3.3375000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.02766393442623 95.675 2 1.6137295081967213 3.15 3 0.2817622950819672 0.8250000000000001 4 0.025614754098360656 0.1 5 0.05122950819672131 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAACCGAGTCTTAACTGGGCGTTAAGTTGCAGGGTATAGACCCGAAA 5 0.125 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 4.9875 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGATCG 20 0.0056465063 29.290577 120-124 >>END_MODULE Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176600 spots for SRR7473331.sra Written 1176600 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra Read 1176585 spots for SRR7473331.sra Written 1176585 spots for SRR7473331.sra SRR ids: ['SRR7473331.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yn1uhbwf SRR7473331.sra spots: 23531715 blocks: [[1, 1176585], [1176586, 2353170], [2353171, 3529755], [3529756, 4706340], [4706341, 5882925], [5882926, 7059510], [7059511, 8236095], [8236096, 9412680], [9412681, 10589265], [10589266, 11765850], [11765851, 12942435], [12942436, 14119020], [14119021, 15295605], [15295606, 16472190], [16472191, 17648775], [17648776, 18825360], [18825361, 20001945], [20001946, 21178530], [21178531, 22355115], [22355116, 23531715]] SRR7473331 file size 7952425 SRR7473331 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473331 SRR7473331_1.fastq SRR7473331_2.fastq Input file: SRR7473331_1.fastq Paired file: SRR7473331_2.fastq trimmed: SRR7473331-trimmed-pair1.fastq, SRR7473331-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:44:31 2024 >> started Sat Dec 7 13:45:02 2024 >> done (31.340s) 23531715 read pairs processed; of these: 40660 ( 0.17%) short read pairs filtered out after trimming by size control 64842 ( 0.28%) empty read pairs filtered out after trimming by size control 23426213 (99.55%) read pairs available; of these: 13666075 (58.34%) trimmed read pairs available after processing 9760138 (41.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 24 0.00% 20 25 0.00% 21 19 0.00% 22 23 0.00% 23 33 0.00% 24 30 0.00% 25 29 0.00% 26 25 0.00% 27 23 0.00% 28 28 0.00% 29 44 0.00% 30 48 0.00% 31 48 0.00% 32 45 0.00% 33 41 0.00% 34 56 0.00% 35 42 0.00% 36 52 0.00% 37 55 0.00% 38 68 0.00% 39 67 0.00% 40 78 0.00% 41 89 0.00% 42 84 0.00% 43 86 0.00% 44 96 0.00% 45 93 0.00% 46 146 0.00% 47 151 0.00% 48 166 0.00% 49 174 0.00% 50 208 0.00% 51 240 0.00% 52 236 0.00% 53 250 0.00% 54 279 0.00% 55 323 0.00% 56 338 0.00% 57 380 0.00% 58 383 0.00% 59 482 0.00% 60 500 0.00% 61 567 0.00% 62 661 0.00% 63 703 0.00% 64 780 0.00% 65 906 0.00% 66 1037 0.00% 67 1217 0.01% 68 1853 0.01% 69 3761 0.02% 70 4697 0.02% 71 3938 0.02% 72 3018 0.01% 73 2584 0.01% 74 2509 0.01% 75 2556 0.01% 76 2887 0.01% 77 2970 0.01% 78 3359 0.01% 79 3767 0.02% 80 4220 0.02% 81 4578 0.02% 82 5245 0.02% 83 6150 0.03% 84 7983 0.03% 85 8781 0.04% 86 9353 0.04% 87 9900 0.04% 88 10625 0.05% 89 11173 0.05% 90 11782 0.05% 91 13102 0.06% 92 13606 0.06% 93 15324 0.07% 94 16460 0.07% 95 17633 0.08% 96 18136 0.08% 97 18880 0.08% 98 19689 0.08% 99 20793 0.09% 100 22444 0.10% 101 23265 0.10% 102 24756 0.11% 103 26079 0.11% 104 28350 0.12% 105 30421 0.13% 106 31720 0.14% 107 32446 0.14% 108 33668 0.14% 109 36823 0.16% 110 37625 0.16% 111 38023 0.16% 112 40316 0.17% 113 43945 0.19% 114 44905 0.19% 115 47622 0.20% 116 49591 0.21% 117 50583 0.22% 118 52040 0.22% 119 53745 0.23% 120 56339 0.24% 121 58441 0.25% 122 60938 0.26% 123 63481 0.27% 124 68368 0.29% 125 69380 0.30% 126 72515 0.31% 127 75101 0.32% 128 77744 0.33% 129 81127 0.35% 130 84290 0.36% 131 87840 0.37% 132 92722 0.40% 133 97380 0.42% 134 103831 0.44% 135 109845 0.47% 136 116697 0.50% 137 124592 0.53% 138 132948 0.57% 139 143801 0.61% 140 154351 0.66% 141 171050 0.73% 142 191935 0.82% 143 219300 0.94% 144 256525 1.10% 145 313102 1.34% 146 393229 1.68% 147 540135 2.31% 148 834946 3.56% 149 1561751 6.67% 150 6211192 26.51% 151 9760138 41.66% 23426213 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=22 prefix-density=0.92 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=28 fanout-score=27.50 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=5.1 sequence=TCCTTCTTCACTCCGGGAAGGTCCGCCTTGAACACGTG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=31 prefix-density=0.85 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=180.30 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.0 sequence=CGAGGAAGACCATCGAAAGCCATTTGATAGTCCAACATCCAAAACAAATCCGCTCTCAGTCACCCTTCCACTAAAAGCATTCAATCAATCCATCGCCCATCCGCCAGCCGACGATGTCGCTGATTCGCCGTGGCGACGTGTTCGACC SRR7473331 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:45:44 Started mapping on | Dec 07 13:45:44 Finished on | Dec 07 13:51:07 Mapping speed, Million of reads per hour | 261.10 Number of input reads | 23426213 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21947606 Uniquely mapped reads % | 93.69% Average mapped length | 292.98 Number of splices: Total | 22299376 Number of splices: Annotated (sjdb) | 20959792 Number of splices: GT/AG | 22034979 Number of splices: GC/AG | 229909 Number of splices: AT/AC | 12245 Number of splices: Non-canonical | 22243 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 171250 % of reads mapped to multiple loci | 0.73% Number of reads mapped to too many loci | 24939 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.73% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1329314 1329314 1329314 N_multimapping 171250 171250 171250 N_noFeature 717632 21104829 1125740 N_ambiguous 506536 2848 74423 UnstrandedReadsAssigned:20723438 PositiveStrandReadsAssigned:839929 NegativeStrandReadsAssigned:20747443 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473331 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473331-trimmed-pair1.fastq SRR7473331-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,426,213 reads, 20,795,583 reads pseudoaligned [quant] estimated average fragment length: 272.466 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR7473331.ke.tsv 35125 SRR7473331.se.tsv 88098 total ==> SRR7473331.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.056 0.0910804 0.00827001 PNS24247 1044 772.534 45.3358 3.54376 PNS24249 1928 1656.53 61.5 2.24189 PNS24246 1044 772.534 45.3358 3.54376 PNS24248 1044 772.534 45.3358 3.54376 PNS24244 1471 1199.53 73.4015 3.69515 PNS24243 293 91.3277 0 0 KQK14069 1603 1331.53 505.811 22.9391 KQK14071 474 227.555 7.32417 1.94362 ==> SRR7473331.se.tsv <== BRADI_1g14170v3 546 BRADI_1g53295v3 4973 BRADI_1g59795v3 359 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 876 BRADI_1g74790v3 137 BRADI_1g09890v3 10 BRADI_1g77505v3 130 BRADI_1g48960v3 0 SRR7473331 completed mapping pipeline successfully