Starting /dee2/code/volunteer_pipeline.sh SRR7473332 current disk space = 1542899126272 free memory = 1593522728 SRR7473332 SRAfilesize d84a56e4c59038e48ee931817a57c243 SRR7473332.sra SRR7473332.sra file validated SRR7473332 is paired end SRR7473332 is conventional basespace SRR7473332 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473332_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.272 34.0 33.0 34.0 33.0 34.0 2 33.3595 34.0 33.0 34.0 33.0 34.0 3 33.4045 34.0 34.0 34.0 33.0 34.0 4 33.3845 34.0 34.0 34.0 33.0 34.0 5 33.3245 34.0 33.0 34.0 33.0 34.0 6 37.02 38.0 38.0 38.0 36.0 38.0 7 37.2985 38.0 38.0 38.0 36.0 38.0 8 37.30925 38.0 38.0 38.0 37.0 38.0 9 37.4225 38.0 38.0 38.0 37.0 38.0 10-14 37.35065 38.0 38.0 38.0 37.0 38.0 15-19 37.3052 38.0 38.0 38.0 37.0 38.0 20-24 37.33045 38.0 38.0 38.0 37.0 38.0 25-29 37.112899999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.955149999999996 38.0 38.0 38.0 35.8 38.0 35-39 36.802499999999995 38.0 38.0 38.0 35.2 38.0 40-44 36.765950000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.69155 38.0 38.0 38.0 34.6 38.0 50-54 36.489700000000006 38.0 38.0 38.0 34.0 38.0 55-59 36.5884 38.0 38.0 38.0 34.2 38.0 60-64 36.558299999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.270050000000005 38.0 38.0 38.0 33.2 38.0 70-74 36.16224999999999 38.0 37.0 38.0 33.0 38.0 75-79 36.2188 38.0 37.4 38.0 33.4 38.0 80-84 36.114450000000005 38.0 37.0 38.0 33.0 38.0 85-89 35.9773 38.0 37.0 38.0 32.8 38.0 90-94 35.5552 38.0 36.6 38.0 30.2 38.0 95-99 35.415000000000006 38.0 36.0 38.0 29.4 38.0 100-104 35.16145 38.0 36.0 38.0 28.8 38.0 105-109 35.07615 38.0 35.6 38.0 28.6 38.0 110-114 34.6554 38.0 35.0 38.0 26.6 38.0 115-119 34.24005 38.0 34.6 38.0 23.8 38.0 120-124 33.85039999999999 38.0 34.0 38.0 22.6 38.0 125-129 33.411350000000006 38.0 34.0 38.0 18.6 38.0 130-134 32.92115 38.0 33.0 38.0 15.0 38.0 135-139 32.4379 37.6 32.8 38.0 14.4 38.0 140-144 31.7622 36.0 31.2 38.0 13.8 38.0 145-149 30.674349999999997 36.0 31.0 38.0 8.6 38.0 150-151 25.794375000000002 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 4.0 10 0.0 11 3.0 12 1.0 13 4.0 14 1.0 15 5.0 16 2.0 17 5.0 18 9.0 19 7.0 20 7.0 21 8.0 22 15.0 23 14.0 24 18.0 25 19.0 26 39.0 27 46.0 28 49.0 29 68.0 30 77.0 31 86.0 32 116.0 33 174.0 34 261.0 35 419.0 36 973.0 37 1568.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.764411027568926 13.458646616541353 9.24812030075188 31.528822055137844 2 25.25 17.8 32.45 24.5 3 22.625 22.85 25.650000000000002 28.875 4 25.775 29.349999999999998 22.275 22.6 5 25.6 32.35 22.6 19.45 6 20.775 33.275 23.35 22.6 7 17.2 20.599999999999998 42.325 19.875 8 20.275000000000002 21.375 28.999999999999996 29.349999999999998 9 20.825 21.325 30.65 27.200000000000003 10-14 23.18 26.245 24.91 25.665 15-19 22.994999999999997 25.740000000000002 26.235000000000003 25.03 20-24 23.13 25.69 25.69 25.490000000000002 25-29 23.22868158830304 25.306694707325622 25.78739171799109 25.67723198638025 30-34 22.93 25.46 25.665 25.945 35-39 23.151205844090864 25.522866006204342 25.788051636145305 25.537876513559493 40-44 22.877748284669703 25.607251965743476 26.042970901988284 25.472028847598537 45-49 22.962962962962962 25.83083083083083 25.475475475475474 25.730730730730734 50-54 23.472347234723472 25.50755075507551 25.542554255425543 25.477547754775475 55-59 23.39 25.465 25.895000000000003 25.25 60-64 23.455000000000002 25.380000000000003 25.525 25.64 65-69 23.288493273991097 25.12876931539731 25.49882482372356 26.08391258688803 70-74 23.78618930946547 24.996249812490625 25.331266563328164 25.886294314715734 75-79 23.726186309315466 25.19625981299065 25.646282314115705 25.43127156357818 80-84 23.875968992248062 24.926231557889473 25.506376594148538 25.69142285571393 85-89 23.44617230861543 25.27626381319066 25.166258312915645 26.111305565278265 90-94 23.199518869342956 25.479877712624667 25.790607928632287 25.529995489400093 95-99 23.354702995091657 25.01252128618652 25.458279074426528 26.174496644295303 100-104 24.44744474447445 24.987498749874987 25.267526752675266 25.297529752975294 105-109 23.75356303445517 24.813722058308745 25.683852577886686 25.748862329349404 110-114 24.263639545931888 24.813722058308745 25.323798569785467 25.598839825973897 115-119 23.735933983495876 24.79119779944986 25.70642660665166 25.7664416104026 120-124 23.899874843554443 25.451814768460572 24.640801001251564 26.007509386733418 125-129 24.032872319102026 25.030066145520145 25.220485067147724 25.716576468230105 130-134 24.090130053432805 25.183990321605 24.50851900393185 26.217360621030345 135-139 24.247010746178297 24.6001715352404 25.079461177538974 26.07335654104233 140-144 24.598715890850723 24.914727126805776 24.979935794542534 25.506621187800967 145-149 23.81958063056268 24.99622869211042 25.111882134057424 26.07230854326947 150-151 25.087763289869606 24.5987963891675 25.11283851554664 25.20060180541625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.0 27 4.5 28 4.0 29 3.0 30 3.5 31 7.5 32 20.0 33 27.5 34 23.0 35 32.0 36 50.5 37 69.0 38 91.0 39 110.0 40 127.0 41 150.5 42 187.5 43 194.5 44 202.0 45 204.5 46 191.5 47 190.0 48 179.0 49 158.0 50 156.0 51 156.0 52 123.5 53 107.5 54 111.0 55 113.0 56 111.0 57 95.5 58 80.5 59 86.0 60 80.0 61 68.0 62 66.5 63 61.5 64 54.0 65 47.0 66 45.5 67 48.0 68 40.0 69 25.0 70 22.0 71 19.5 72 15.5 73 12.5 74 8.0 75 4.5 76 3.5 77 2.5 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.145 30-34 0.0 35-39 0.06999999999999999 40-44 0.165 45-49 0.1 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.015 70-74 0.005 75-79 0.005 80-84 0.025 85-89 0.005 90-94 0.23500000000000001 95-99 0.16999999999999998 100-104 0.01 105-109 0.015 110-114 0.015 115-119 0.025 120-124 0.125 125-129 0.22 130-134 0.8099999999999999 135-139 0.895 140-144 0.32 145-149 0.565 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21855306276784 98.4 2 0.7310310057978321 1.4500000000000002 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.9 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTTTT 10 0.00686971 144.72499 6 >>END_MODULE SRR7473332 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473332_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12175 33.0 33.0 34.0 31.0 34.0 2 32.101 33.0 33.0 34.0 31.0 34.0 3 32.149 33.0 33.0 34.0 31.0 34.0 4 32.04325 33.0 33.0 34.0 31.0 34.0 5 32.24825 34.0 33.0 34.0 32.0 34.0 6 36.14125 38.0 38.0 38.0 34.0 38.0 7 36.37775 38.0 38.0 38.0 35.0 38.0 8 36.44425 38.0 38.0 38.0 35.0 38.0 9 36.3745 38.0 38.0 38.0 34.0 38.0 10-14 36.45135 38.0 38.0 38.0 35.0 38.0 15-19 36.23485000000001 38.0 38.0 38.0 34.8 38.0 20-24 36.03725 38.0 38.0 38.0 34.0 38.0 25-29 36.02435 38.0 38.0 38.0 34.0 38.0 30-34 36.106950000000005 38.0 38.0 38.0 34.4 38.0 35-39 36.04255 38.0 38.0 38.0 34.2 38.0 40-44 36.079499999999996 38.0 38.0 38.0 34.2 38.0 45-49 35.92515000000001 38.0 38.0 38.0 34.0 38.0 50-54 35.931200000000004 38.0 38.0 38.0 34.0 38.0 55-59 35.8369 38.0 38.0 38.0 33.4 38.0 60-64 35.7849 38.0 38.0 38.0 33.2 38.0 65-69 35.532500000000006 38.0 38.0 38.0 32.6 38.0 70-74 35.61705 38.0 38.0 38.0 32.2 38.0 75-79 35.52015 38.0 38.0 38.0 31.6 38.0 80-84 35.42385 38.0 38.0 38.0 30.8 38.0 85-89 35.324749999999995 38.0 37.6 38.0 30.6 38.0 90-94 35.148799999999994 38.0 37.0 38.0 29.0 38.0 95-99 34.7585 38.0 36.6 38.0 26.8 38.0 100-104 34.178599999999996 38.0 36.0 38.0 22.8 38.0 105-109 33.93545 38.0 35.4 38.0 21.0 38.0 110-114 33.65215 38.0 35.0 38.0 17.4 38.0 115-119 33.3314 38.0 34.8 38.0 15.0 38.0 120-124 33.01385 38.0 34.2 38.0 14.8 38.0 125-129 32.81395 38.0 34.0 38.0 14.2 38.0 130-134 32.292500000000004 38.0 33.6 38.0 13.6 38.0 135-139 31.977999999999998 38.0 32.6 38.0 13.0 38.0 140-144 31.346899999999998 38.0 31.2 38.0 8.6 38.0 145-149 30.22385 37.6 31.0 38.0 2.0 38.0 150-151 25.462875 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 25.0 4 19.0 5 4.0 6 5.0 7 1.0 8 1.0 9 2.0 10 4.0 11 7.0 12 2.0 13 7.0 14 9.0 15 4.0 16 6.0 17 15.0 18 7.0 19 14.0 20 15.0 21 14.0 22 24.0 23 25.0 24 33.0 25 41.0 26 25.0 27 38.0 28 41.0 29 48.0 30 65.0 31 79.0 32 98.0 33 127.0 34 164.0 35 297.0 36 603.0 37 2090.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.67935058346017 19.964485032978182 11.364789446981227 26.991374936580414 2 30.56757444642403 22.193942479002292 26.444387884958005 20.79409518961568 3 22.714540361599187 25.515660809778456 26.661573720397254 25.108225108225106 4 26.204435381085904 31.684934998725467 20.800407851134338 21.310221769054294 5 27.417721518987342 33.77215189873418 18.860759493670887 19.949367088607595 6 22.323925756420035 35.18942283244343 19.349097381133994 23.137554030002544 7 21.258847320525785 18.579373104145603 37.03235591506572 23.12942366026289 8 22.64720684448918 22.093608454957224 24.911927528938097 30.3472571716155 9 23.68487289202114 23.00528567832872 26.62975081802165 26.680090611628493 10-14 26.283501785085733 25.564439080806554 23.472620304721676 24.67943882938603 15-19 26.22568881685575 25.25830632090762 23.931320907617504 24.584683954619123 20-24 26.036164160910197 25.650142218610323 23.97907354733848 24.334620073141 25-29 25.59517779353662 25.65596190862121 23.695674197143145 25.053186100699016 30-34 25.93399908754499 25.310488163430833 24.06853550970751 24.686977239316672 35-39 26.034780840028475 25.800874605918843 23.29909488457236 24.86524966948032 40-44 25.729040097205345 25.48602673147023 24.372215471850954 24.412717699473472 45-49 26.01547388781431 25.572635651023106 24.188129899216126 24.223760561946452 50-54 25.903920373755838 25.213284582571603 24.375380865326022 24.507414178346536 55-59 26.368890691543296 24.969580206854594 24.10768606773474 24.55384303386737 60-64 25.78843126301356 24.30044182621502 25.412625057132697 24.498501853638718 65-69 25.490797546012274 25.506134969325156 23.99284253578732 25.010224948875255 70-74 26.455106792185447 24.82032594392145 24.521712723959915 24.202854539933192 75-79 25.391770296228895 25.624304923667978 24.75988272166616 24.22404205843696 80-84 25.465398624038848 25.151760420882237 24.78753541076487 24.59530554431404 85-89 25.81117222586668 24.872584144926073 24.62027552101731 24.695968108189938 90-94 25.888787602552416 25.06836827711942 25.01772510888281 24.025119011445355 95-99 25.8323530915972 25.090778908607376 24.968035595560785 24.108832404234644 100-104 25.225364446504923 25.024468139906247 24.875083706794417 24.875083706794417 105-109 26.153369800805038 25.632160181649294 23.90339560326143 24.31107441428424 110-114 25.95940292340272 25.964567945870563 24.167140127059554 23.908889003667166 115-119 25.76023090403051 25.559220698897022 24.719101123595504 23.96144727347696 120-124 26.536816612562475 25.794816303395685 24.223218426341013 23.44514865770083 125-129 26.320119286338628 25.286647128387063 24.53596585942722 23.857267725847088 130-134 26.417320814735007 25.88374121389359 23.995690318608588 23.703247652762812 135-139 26.272787621916972 25.90512178930705 24.577439615993462 23.244650972782516 140-144 26.403061224489793 25.698979591836736 24.392857142857142 23.505102040816325 145-149 26.459684893419833 25.75944804860468 23.99855833590773 23.782308722067757 150-151 28.254704820830113 25.418922402681105 23.640113431296726 22.68625934519206 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 15.0 1 10.5 2 5.5 3 2.5 4 0.0 5 2.5 6 2.5 7 1.5 8 1.5 9 0.5 10 1.5 11 1.5 12 1.0 13 1.5 14 2.5 15 2.5 16 1.5 17 0.5 18 0.5 19 2.0 20 2.0 21 1.5 22 1.5 23 2.0 24 2.5 25 2.5 26 3.0 27 3.5 28 6.0 29 8.5 30 10.5 31 11.0 32 14.0 33 17.0 34 19.5 35 29.5 36 40.5 37 50.0 38 64.5 39 87.0 40 107.0 41 132.5 42 148.0 43 165.0 44 181.5 45 187.0 46 194.5 47 179.0 48 167.0 49 165.0 50 154.0 51 134.0 52 121.0 53 125.0 54 119.5 55 107.5 56 97.0 57 95.5 58 94.5 59 90.0 60 89.0 61 74.0 62 82.5 63 89.0 64 67.5 65 52.5 66 62.0 67 66.0 68 51.5 69 41.5 70 30.5 71 30.5 72 29.5 73 17.5 74 9.5 75 6.5 76 2.5 77 1.0 78 3.0 79 2.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 1.775 3 1.825 4 1.925 5 1.25 6 1.675 7 1.0999999999999999 8 0.65 9 0.675 10-14 0.565 15-19 1.28 20-24 1.5599999999999998 25-29 1.29 30-34 1.365 35-39 1.67 40-44 1.24 45-49 1.77 50-54 1.54 55-59 1.38 60-64 1.545 65-69 2.1999999999999997 70-74 1.21 75-79 1.09 80-84 1.16 85-89 0.915 90-94 1.27 95-99 2.235 100-104 2.935 105-109 3.11 110-114 3.195 115-119 2.9899999999999998 120-124 2.965 125-129 2.7550000000000003 130-134 2.545 135-139 2.085 140-144 2.0 145-149 2.8899999999999997 150-151 3.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1132505700532 97.8 2 0.6840638459589561 1.35 3 0.15201418799087915 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.05067139599695972 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.4 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.7625 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.2625 0.0 0.0 0.0 0.0 138-139 3.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAGT 10 0.007344661 141.525 8 >>END_MODULE Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra Read 1101536 spots for SRR7473332.sra Written 1101536 spots for SRR7473332.sra SRR ids: ['SRR7473332.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_172i457i SRR7473332.sra spots: 22030720 blocks: [[1, 1101536], [1101537, 2203072], [2203073, 3304608], [3304609, 4406144], [4406145, 5507680], [5507681, 6609216], [6609217, 7710752], [7710753, 8812288], [8812289, 9913824], [9913825, 11015360], [11015361, 12116896], [12116897, 13218432], [13218433, 14319968], [14319969, 15421504], [15421505, 16523040], [16523041, 17624576], [17624577, 18726112], [18726113, 19827648], [19827649, 20929184], [20929185, 22030720]] SRR7473332 file size 7443787 SRR7473332 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473332 SRR7473332_1.fastq SRR7473332_2.fastq Input file: SRR7473332_1.fastq Paired file: SRR7473332_2.fastq trimmed: SRR7473332-trimmed-pair1.fastq, SRR7473332-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:46:38 2024 >> started Sat Dec 7 13:47:08 2024 >> done (30.111s) 22030720 read pairs processed; of these: 52516 ( 0.24%) short read pairs filtered out after trimming by size control 66496 ( 0.30%) empty read pairs filtered out after trimming by size control 21911708 (99.46%) read pairs available; of these: 12442703 (56.79%) trimmed read pairs available after processing 9469005 (43.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 19 0.00% 20 17 0.00% 21 25 0.00% 22 23 0.00% 23 31 0.00% 24 39 0.00% 25 24 0.00% 26 19 0.00% 27 24 0.00% 28 27 0.00% 29 37 0.00% 30 28 0.00% 31 40 0.00% 32 37 0.00% 33 39 0.00% 34 36 0.00% 35 37 0.00% 36 45 0.00% 37 55 0.00% 38 64 0.00% 39 54 0.00% 40 85 0.00% 41 57 0.00% 42 74 0.00% 43 83 0.00% 44 106 0.00% 45 94 0.00% 46 114 0.00% 47 130 0.00% 48 142 0.00% 49 144 0.00% 50 157 0.00% 51 186 0.00% 52 177 0.00% 53 204 0.00% 54 256 0.00% 55 231 0.00% 56 289 0.00% 57 309 0.00% 58 356 0.00% 59 417 0.00% 60 473 0.00% 61 489 0.00% 62 508 0.00% 63 578 0.00% 64 703 0.00% 65 787 0.00% 66 867 0.00% 67 1035 0.00% 68 1200 0.01% 69 1580 0.01% 70 1672 0.01% 71 1615 0.01% 72 1564 0.01% 73 1768 0.01% 74 1868 0.01% 75 2117 0.01% 76 2319 0.01% 77 2589 0.01% 78 2896 0.01% 79 3234 0.01% 80 3487 0.02% 81 3928 0.02% 82 4491 0.02% 83 5002 0.02% 84 6619 0.03% 85 7939 0.04% 86 7971 0.04% 87 8290 0.04% 88 8858 0.04% 89 9320 0.04% 90 9751 0.04% 91 10474 0.05% 92 11258 0.05% 93 11795 0.05% 94 12553 0.06% 95 13141 0.06% 96 14331 0.07% 97 14532 0.07% 98 15275 0.07% 99 16376 0.07% 100 17343 0.08% 101 18035 0.08% 102 19156 0.09% 103 20176 0.09% 104 21424 0.10% 105 22622 0.10% 106 23861 0.11% 107 24402 0.11% 108 26328 0.12% 109 27271 0.12% 110 28603 0.13% 111 29751 0.14% 112 31493 0.14% 113 32924 0.15% 114 34930 0.16% 115 36533 0.17% 116 38488 0.18% 117 40017 0.18% 118 41470 0.19% 119 42961 0.20% 120 45316 0.21% 121 47926 0.22% 122 50260 0.23% 123 53549 0.24% 124 55847 0.25% 125 57967 0.26% 126 60480 0.28% 127 63006 0.29% 128 66226 0.30% 129 69776 0.32% 130 73695 0.34% 131 76816 0.35% 132 81868 0.37% 133 86910 0.40% 134 91846 0.42% 135 98243 0.45% 136 104228 0.48% 137 112952 0.52% 138 121189 0.55% 139 131834 0.60% 140 143852 0.66% 141 160523 0.73% 142 180286 0.82% 143 206552 0.94% 144 240708 1.10% 145 291299 1.33% 146 367387 1.68% 147 499423 2.28% 148 759707 3.47% 149 1461324 6.67% 150 5774325 26.35% 151 9469005 43.21% 21911708 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=16 prefix-density=0.96 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=14.14 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=11 prefix-density=0.77 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=69.38 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473332 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:47:53 Started mapping on | Dec 07 13:47:53 Finished on | Dec 07 13:51:14 Mapping speed, Million of reads per hour | 392.45 Number of input reads | 21911708 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 20734381 Uniquely mapped reads % | 94.63% Average mapped length | 293.53 Number of splices: Total | 22827328 Number of splices: Annotated (sjdb) | 21591405 Number of splices: GT/AG | 22527324 Number of splices: GC/AG | 266646 Number of splices: AT/AC | 12306 Number of splices: Non-canonical | 21052 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203932 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 24485 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1000823 1000823 1000823 N_multimapping 203932 203932 203932 N_noFeature 667227 20141548 861161 N_ambiguous 471185 2928 73443 UnstrandedReadsAssigned:19595969 PositiveStrandReadsAssigned:589905 NegativeStrandReadsAssigned:19799777 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473332 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473332-trimmed-pair1.fastq SRR7473332-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,911,708 reads, 19,903,197 reads pseudoaligned [quant] estimated average fragment length: 291.231 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR7473332.ke.tsv 35125 SRR7473332.se.tsv 88098 total ==> SRR7473332.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 646.63 0 0 PNS24247 1044 753.769 41.2317 3.90522 PNS24249 1928 1637.77 45.0716 1.96473 PNS24246 1044 753.769 41.2317 3.90522 PNS24248 1044 753.769 41.2317 3.90522 PNS24244 1471 1180.77 132.233 7.99518 PNS24243 293 85.7014 0 0 KQK14069 1603 1312.77 842.448 45.8149 KQK14071 474 215.353 4.91693 1.63003 ==> SRR7473332.se.tsv <== BRADI_1g14170v3 864 BRADI_1g53295v3 197 BRADI_1g59795v3 661 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 2972 BRADI_1g74790v3 51 BRADI_1g09890v3 3 BRADI_1g77505v3 275 BRADI_1g48960v3 0 SRR7473332 completed mapping pipeline successfully