Starting /dee2/code/volunteer_pipeline.sh SRR7473334 current disk space = 1543163809792 free memory = 1596256248 SRR7473334 SRAfilesize 4dfff65e5596da8d217875bda7c8386d SRR7473334.sra SRR7473334.sra file validated SRR7473334 is paired end SRR7473334 is conventional basespace SRR7473334 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473334_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3385 34.0 33.0 34.0 33.0 34.0 2 33.387 34.0 33.0 34.0 33.0 34.0 3 33.45825 34.0 34.0 34.0 33.0 34.0 4 33.4485 34.0 34.0 34.0 33.0 34.0 5 33.39625 34.0 34.0 34.0 33.0 34.0 6 37.12175 38.0 38.0 38.0 36.0 38.0 7 37.38975 38.0 38.0 38.0 37.0 38.0 8 37.49675 38.0 38.0 38.0 37.0 38.0 9 37.51925 38.0 38.0 38.0 38.0 38.0 10-14 37.48175 38.0 38.0 38.0 37.8 38.0 15-19 37.384049999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.514149999999994 38.0 38.0 38.0 37.8 38.0 25-29 37.41935 38.0 38.0 38.0 37.2 38.0 30-34 37.1726 38.0 38.0 38.0 36.8 38.0 35-39 37.130849999999995 38.0 38.0 38.0 36.6 38.0 40-44 37.04575 38.0 38.0 38.0 36.0 38.0 45-49 37.002750000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.90165 38.0 38.0 38.0 35.2 38.0 55-59 36.9679 38.0 38.0 38.0 35.4 38.0 60-64 36.98065 38.0 38.0 38.0 35.4 38.0 65-69 36.728899999999996 38.0 38.0 38.0 34.4 38.0 70-74 36.5233 38.0 38.0 38.0 34.0 38.0 75-79 36.5827 38.0 38.0 38.0 34.0 38.0 80-84 36.55075 38.0 38.0 38.0 34.0 38.0 85-89 36.44555 38.0 38.0 38.0 34.0 38.0 90-94 36.134100000000004 38.0 37.0 38.0 33.0 38.0 95-99 35.823949999999996 38.0 37.0 38.0 31.8 38.0 100-104 35.72205 38.0 36.6 38.0 31.6 38.0 105-109 35.60785 38.0 36.2 38.0 31.2 38.0 110-114 35.3645 38.0 36.0 38.0 30.0 38.0 115-119 34.97915 38.0 35.4 38.0 28.2 38.0 120-124 34.56945 38.0 35.0 38.0 26.2 38.0 125-129 34.356 38.0 34.8 38.0 24.8 38.0 130-134 33.912 38.0 34.2 38.0 22.2 38.0 135-139 33.417 38.0 33.6 38.0 21.4 38.0 140-144 32.550650000000005 37.6 32.8 38.0 14.2 38.0 145-149 31.332550000000005 36.2 31.6 38.0 11.0 38.0 150-151 26.693875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 2.0 13 2.0 14 5.0 15 2.0 16 4.0 17 2.0 18 3.0 19 7.0 20 8.0 21 7.0 22 5.0 23 13.0 24 18.0 25 15.0 26 11.0 27 32.0 28 32.0 29 44.0 30 71.0 31 104.0 32 99.0 33 141.0 34 182.0 35 378.0 36 875.0 37 1935.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.700927550764604 10.052644773126097 9.852093256455252 43.394334419654044 2 24.125 15.675 34.2 26.0 3 22.1 17.8 24.3 35.8 4 27.400000000000002 26.525 20.9 25.174999999999997 5 27.407221664994985 31.569709127382144 21.36409227683049 19.658976930792377 6 22.0 32.025 23.075000000000003 22.900000000000002 7 19.1 21.15 38.175 21.575 8 20.3 22.675 29.4 27.625 9 20.3 20.674999999999997 31.95 27.075 10-14 23.830000000000002 25.319999999999997 24.4 26.450000000000003 15-19 23.5 24.79 24.95 26.76 20-24 23.285 24.77 25.564999999999998 26.38 25-29 23.775 24.38 25.205 26.640000000000004 30-34 23.53 24.779999999999998 25.03 26.66 35-39 23.644186511907144 24.5347208324995 25.020012007204322 26.801080648389032 40-44 23.695 24.685000000000002 25.165 26.455000000000002 45-49 23.755000000000003 24.27 24.975 27.0 50-54 23.325000000000003 24.97 24.845 26.86 55-59 23.830000000000002 24.490000000000002 24.765 26.915 60-64 23.674999999999997 23.674999999999997 25.95 26.700000000000003 65-69 23.785 24.205 25.374999999999996 26.634999999999998 70-74 23.885 24.34 24.72 27.055 75-79 24.075 24.355 24.635 26.935 80-84 24.21 23.68 25.569999999999997 26.540000000000003 85-89 23.935000000000002 23.76 24.745 27.560000000000002 90-94 24.63 24.19 24.43 26.75 95-99 23.836918459229615 24.042021010505252 24.722361180590298 27.39869934967484 100-104 24.425 24.33 24.945 26.3 105-109 24.09 24.16 24.915000000000003 26.834999999999997 110-114 24.169999999999998 24.169999999999998 24.92 26.740000000000002 115-119 24.175 23.625 24.79 27.41 120-124 24.474999999999998 24.005000000000003 24.44 27.08 125-129 24.94 24.395 24.595 26.07 130-134 24.351007316828706 24.025258093615314 24.591560589355517 27.03217400020046 135-139 24.29508689337407 24.049681975259176 24.795913256873842 26.85931787449291 140-144 25.025 23.945 24.395 26.634999999999998 145-149 24.26926926926927 23.998998998999 24.904904904904903 26.826826826826828 150-151 24.118831822759315 23.48942598187311 25.08811681772407 27.303625377643503 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.5 25 0.5 26 1.0 27 1.0 28 0.5 29 2.0 30 6.5 31 9.0 32 13.0 33 18.0 34 25.5 35 35.5 36 40.0 37 44.0 38 61.0 39 86.5 40 106.0 41 136.0 42 158.5 43 152.5 44 163.0 45 181.5 46 172.5 47 167.5 48 165.5 49 155.5 50 161.5 51 158.5 52 142.0 53 138.5 54 130.0 55 114.0 56 103.5 57 101.5 58 100.5 59 92.0 60 92.5 61 99.5 62 86.5 63 69.5 64 66.0 65 71.5 66 65.5 67 59.5 68 60.0 69 42.0 70 30.0 71 29.5 72 22.5 73 16.0 74 13.0 75 10.5 76 7.5 77 5.5 78 3.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.05 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.22999999999999998 135-139 0.165 140-144 0.0 145-149 0.1 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98811029597773 97.82499999999999 2 0.8854034910194789 1.7500000000000002 3 0.07589172780166961 0.22499999999999998 4 0.05059448520111307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.15 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.8499999999999996 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.9125 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACATCA 10 0.006830828 145.0 7 >>END_MODULE SRR7473334 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473334_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.989 33.0 33.0 34.0 32.0 34.0 2 32.36525 33.0 33.0 34.0 32.0 34.0 3 32.24625 34.0 33.0 34.0 32.0 34.0 4 32.16475 34.0 33.0 34.0 32.0 34.0 5 32.29025 34.0 33.0 34.0 32.0 34.0 6 36.60975 38.0 38.0 38.0 35.0 38.0 7 36.69825 38.0 38.0 38.0 35.0 38.0 8 36.89625 38.0 38.0 38.0 36.0 38.0 9 36.89225 38.0 38.0 38.0 36.0 38.0 10-14 36.94005 38.0 38.0 38.0 36.2 38.0 15-19 36.7673 38.0 38.0 38.0 36.0 38.0 20-24 36.389599999999994 38.0 38.0 38.0 35.0 38.0 25-29 36.606 38.0 38.0 38.0 35.8 38.0 30-34 36.6871 38.0 38.0 38.0 35.8 38.0 35-39 36.63125 38.0 38.0 38.0 35.8 38.0 40-44 36.6941 38.0 38.0 38.0 36.0 38.0 45-49 36.535000000000004 38.0 38.0 38.0 35.4 38.0 50-54 36.5481 38.0 38.0 38.0 35.2 38.0 55-59 36.5779 38.0 38.0 38.0 35.4 38.0 60-64 36.427800000000005 38.0 38.0 38.0 34.4 38.0 65-69 36.06295 38.0 38.0 38.0 33.4 38.0 70-74 36.23555 38.0 38.0 38.0 34.0 38.0 75-79 36.2375 38.0 38.0 38.0 34.0 38.0 80-84 36.14995 38.0 38.0 38.0 34.0 38.0 85-89 36.01885 38.0 38.0 38.0 33.4 38.0 90-94 35.7522 38.0 38.0 38.0 32.4 38.0 95-99 35.35445 38.0 37.4 38.0 31.2 38.0 100-104 34.76085 38.0 36.6 38.0 27.0 38.0 105-109 34.7168 38.0 36.0 38.0 27.2 38.0 110-114 34.351 38.0 35.6 38.0 24.2 38.0 115-119 33.920399999999994 38.0 35.0 38.0 22.2 38.0 120-124 34.0023 38.0 35.0 38.0 22.6 38.0 125-129 33.684000000000005 38.0 34.8 38.0 19.8 38.0 130-134 32.87495 38.0 33.8 38.0 14.2 38.0 135-139 32.5517 38.0 33.4 38.0 13.2 38.0 140-144 31.8567 38.0 31.8 38.0 12.6 38.0 145-149 30.681550000000005 38.0 31.0 38.0 2.0 38.0 150-151 24.381999999999998 32.0 14.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 12.0 4 13.0 5 2.0 6 3.0 7 0.0 8 0.0 9 0.0 10 3.0 11 3.0 12 5.0 13 0.0 14 5.0 15 5.0 16 13.0 17 14.0 18 15.0 19 9.0 20 13.0 21 16.0 22 18.0 23 35.0 24 30.0 25 35.0 26 20.0 27 31.0 28 38.0 29 51.0 30 65.0 31 76.0 32 84.0 33 112.0 34 167.0 35 301.0 36 674.0 37 2121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.32632119035403 17.393535146228835 12.442278091328888 33.83786557208825 2 29.38785877571755 23.520447040894084 27.15265430530861 19.939039878079758 3 23.62987509559011 27.580932959469795 23.604384399694112 25.184807545245985 4 25.73979591836735 32.04081632653061 19.71938775510204 22.5 5 29.717341482047367 32.23834988540871 18.89483065953654 19.149477973007382 6 24.142280524722505 34.08173562058527 18.920282542885975 22.855701311806257 7 22.425916624811652 18.181818181818183 35.05775991963837 24.334505273731793 8 23.879849812265334 23.35419274092616 22.002503128911137 30.76345431789737 9 23.799999999999997 23.075000000000003 25.5 27.625 10-14 26.595000000000002 25.28 22.52 25.605 15-19 26.97417899222863 24.60767109551266 23.47956881423916 24.938581098019554 20-24 26.354667341259802 25.68682013660511 23.050847457627118 24.90766506450797 25-29 26.171560740144812 25.271520514883345 22.95353982300885 25.603378921962992 30-34 26.29308182411077 25.59574574825666 22.55054432348367 25.560628104148897 35-39 26.38728178296524 25.612516979423454 22.644262212607536 25.35593902500377 40-44 27.062772406192074 24.643053955212665 23.039927859325683 25.254245779269574 45-49 26.802515723270442 24.925786163522012 23.41132075471698 24.860377358490567 50-54 26.48195552878583 24.96611956030718 23.2344526426743 25.317472268232695 55-59 27.06653982876884 24.808491463475693 23.151254193160767 24.973714514594704 60-64 26.646255771933347 24.834370608311584 23.15298132905039 25.366392290704674 65-69 26.80969207470974 25.29530540131247 23.37203432609793 24.52296819787986 70-74 26.775407779171896 24.5069008782936 23.322459222082813 25.395232120451695 75-79 26.60187365362457 25.16406993637593 23.445719152347078 24.788337257652422 80-84 27.364306119380544 24.522628176214102 23.11431864882474 24.998747055580615 85-89 27.281835487426108 24.982466686704736 22.948602344454464 24.787095481414685 90-94 26.95962592387752 24.767459399668155 23.379757654985166 24.893157021469154 95-99 26.151115618661258 25.329614604462474 23.70689655172414 24.81237322515213 100-104 27.052324689274204 24.679044550150888 23.308270676691727 24.960360083883177 105-109 27.342753660154056 24.771718614497782 23.13421415089527 24.75131357445289 110-114 27.405173295164094 25.278601370003067 23.30027604539413 24.015949289438705 115-119 27.306235282072283 25.197092249411284 22.87805876932528 24.61861369919115 120-124 27.6734693877551 25.102040816326532 23.091836734693878 24.13265306122449 125-129 27.815481961524725 25.3099964280247 23.166811246619382 23.7077103638312 130-134 27.72039271834731 24.621599509102065 23.53241971773369 24.125588054816934 135-139 27.228073728985215 24.746809803524407 23.723921409763012 24.301195057727366 140-144 28.13715093672676 24.96086451547745 23.486340453466646 23.415644094329142 145-149 27.387661843107384 25.229753744605233 23.396801218583395 23.985783193703984 150-151 27.713328177365298 25.934519205980923 22.840938386182007 23.511214230471772 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.5 8 2.0 9 1.0 10 1.5 11 1.5 12 1.5 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 3.0 26 3.0 27 2.0 28 3.5 29 4.0 30 5.0 31 6.0 32 7.5 33 11.5 34 17.0 35 26.0 36 33.0 37 46.0 38 63.0 39 78.5 40 94.0 41 110.0 42 131.5 43 143.5 44 153.0 45 161.0 46 168.0 47 167.5 48 159.5 49 170.5 50 146.5 51 127.0 52 143.0 53 136.5 54 131.0 55 123.0 56 100.5 57 105.0 58 112.5 59 103.0 60 101.0 61 99.5 62 107.0 63 106.5 64 89.0 65 70.0 66 67.5 67 68.5 68 69.0 69 57.5 70 41.5 71 32.5 72 24.0 73 20.0 74 12.5 75 9.0 76 6.0 77 4.0 78 2.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 1.575 3 1.925 4 2.0 5 1.825 6 0.8999999999999999 7 0.44999999999999996 8 0.125 9 0.0 10-14 0.0 15-19 0.27499999999999997 20-24 1.175 25-29 0.5599999999999999 30-34 0.335 35-39 0.615 40-44 0.19499999999999998 45-49 0.625 50-54 0.385 55-59 0.135 60-64 0.38 65-69 0.95 70-74 0.375 75-79 0.19499999999999998 80-84 0.23500000000000001 85-89 0.19 90-94 0.555 95-99 1.4000000000000001 100-104 2.245 105-109 1.9849999999999999 110-114 2.19 115-119 2.33 120-124 2.0 125-129 2.015 130-134 2.22 135-139 1.26 140-144 0.985 145-149 1.525 150-151 3.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5234215885947 96.75 2 1.1710794297352343 2.3 3 0.2545824847250509 0.75 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5499999999999998 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.3375000000000004 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.7125 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.475 0.0 0.0 0.0 0.0 136-137 4.8625 0.0 0.0 0.0 0.0 138-139 5.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197516 spots for SRR7473334.sra Written 1197516 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra Read 1197507 spots for SRR7473334.sra Written 1197507 spots for SRR7473334.sra SRR ids: ['SRR7473334.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uwoh01gr SRR7473334.sra spots: 23950149 blocks: [[1, 1197507], [1197508, 2395014], [2395015, 3592521], [3592522, 4790028], [4790029, 5987535], [5987536, 7185042], [7185043, 8382549], [8382550, 9580056], [9580057, 10777563], [10777564, 11975070], [11975071, 13172577], [13172578, 14370084], [14370085, 15567591], [15567592, 16765098], [16765099, 17962605], [17962606, 19160112], [19160113, 20357619], [20357620, 21555126], [21555127, 22752633], [22752634, 23950149]] SRR7473334 file size 8094219 SRR7473334 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473334 SRR7473334_1.fastq SRR7473334_2.fastq Input file: SRR7473334_1.fastq Paired file: SRR7473334_2.fastq trimmed: SRR7473334-trimmed-pair1.fastq, SRR7473334-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:56:00 2024 >> started Sat Dec 7 13:56:27 2024 >> done (27.399s) 23950149 read pairs processed; of these: 36122 ( 0.15%) short read pairs filtered out after trimming by size control 54153 ( 0.23%) empty read pairs filtered out after trimming by size control 23859874 (99.62%) read pairs available; of these: 13725124 (57.52%) trimmed read pairs available after processing 10134750 (42.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 20 0.00% 20 11 0.00% 21 12 0.00% 22 30 0.00% 23 22 0.00% 24 21 0.00% 25 28 0.00% 26 22 0.00% 27 15 0.00% 28 40 0.00% 29 36 0.00% 30 28 0.00% 31 56 0.00% 32 45 0.00% 33 38 0.00% 34 42 0.00% 35 51 0.00% 36 46 0.00% 37 60 0.00% 38 69 0.00% 39 63 0.00% 40 72 0.00% 41 65 0.00% 42 76 0.00% 43 80 0.00% 44 84 0.00% 45 116 0.00% 46 120 0.00% 47 171 0.00% 48 160 0.00% 49 182 0.00% 50 192 0.00% 51 224 0.00% 52 234 0.00% 53 258 0.00% 54 268 0.00% 55 257 0.00% 56 340 0.00% 57 343 0.00% 58 436 0.00% 59 424 0.00% 60 457 0.00% 61 522 0.00% 62 660 0.00% 63 716 0.00% 64 762 0.00% 65 895 0.00% 66 1050 0.00% 67 1332 0.01% 68 1567 0.01% 69 1952 0.01% 70 1927 0.01% 71 1707 0.01% 72 1826 0.01% 73 2114 0.01% 74 2280 0.01% 75 2539 0.01% 76 2790 0.01% 77 3021 0.01% 78 3351 0.01% 79 3906 0.02% 80 4265 0.02% 81 4671 0.02% 82 5395 0.02% 83 6110 0.03% 84 7569 0.03% 85 8402 0.04% 86 9096 0.04% 87 9734 0.04% 88 10505 0.04% 89 10922 0.05% 90 11726 0.05% 91 12688 0.05% 92 13304 0.06% 93 14737 0.06% 94 15117 0.06% 95 16307 0.07% 96 16933 0.07% 97 18622 0.08% 98 19157 0.08% 99 20333 0.09% 100 21934 0.09% 101 22406 0.09% 102 23724 0.10% 103 24999 0.10% 104 26346 0.11% 105 28694 0.12% 106 30107 0.13% 107 31243 0.13% 108 32282 0.14% 109 34410 0.14% 110 35898 0.15% 111 36716 0.15% 112 38531 0.16% 113 40819 0.17% 114 42062 0.18% 115 44983 0.19% 116 46273 0.19% 117 48335 0.20% 118 49958 0.21% 119 51562 0.22% 120 54078 0.23% 121 56265 0.24% 122 59833 0.25% 123 61295 0.26% 124 65121 0.27% 125 66506 0.28% 126 69536 0.29% 127 71911 0.30% 128 75506 0.32% 129 79459 0.33% 130 82781 0.35% 131 86506 0.36% 132 90835 0.38% 133 95788 0.40% 134 100306 0.42% 135 106388 0.45% 136 114598 0.48% 137 122115 0.51% 138 130045 0.55% 139 141250 0.59% 140 152688 0.64% 141 169611 0.71% 142 191586 0.80% 143 219154 0.92% 144 256754 1.08% 145 312893 1.31% 146 395954 1.66% 147 542441 2.27% 148 840640 3.52% 149 1578073 6.61% 150 6348087 26.61% 151 10134750 42.48% 23859874 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=22 prefix-density=0.91 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.14 sequence-density-rank=27 fanout-score=31.93 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=5.9 sequence=TCCTTCTTCACTCCGGGAAGGTCCGCCTTGAACACGTG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=31 prefix-density=0.75 prefix-fanout=2.3 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.15 sequence-density-rank=36 fanout-score=36.34 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=10.4 sequence=GGAGAAGGAGGACAAGAACGACAAGTGGCACCGCGTCGAGCGCAGCAGCGGCAAGTTC SRR7473334 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:57:08 Started mapping on | Dec 07 13:57:08 Finished on | Dec 07 14:00:14 Mapping speed, Million of reads per hour | 461.80 Number of input reads | 23859874 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 22802677 Uniquely mapped reads % | 95.57% Average mapped length | 293.26 Number of splices: Total | 23152978 Number of splices: Annotated (sjdb) | 21831132 Number of splices: GT/AG | 22874892 Number of splices: GC/AG | 243778 Number of splices: AT/AC | 13709 Number of splices: Non-canonical | 20599 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190397 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 21191 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 886050 886050 886050 N_multimapping 190397 190397 190397 N_noFeature 699866 22011362 1021332 N_ambiguous 541793 2558 74808 UnstrandedReadsAssigned:21561018 PositiveStrandReadsAssigned:788757 NegativeStrandReadsAssigned:21706537 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473334 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473334-trimmed-pair1.fastq SRR7473334-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,859,874 reads, 21,754,777 reads pseudoaligned [quant] estimated average fragment length: 276.288 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR7473334.ke.tsv 35125 SRR7473334.se.tsv 88098 total ==> SRR7473334.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.399 96.5387 8.52563 PNS24247 1044 768.712 25.1304 1.90952 PNS24249 1928 1652.71 43.7588 1.54652 PNS24246 1044 768.712 25.1304 1.90952 PNS24248 1044 768.712 25.1304 1.90952 PNS24244 1471 1195.71 83.3112 4.06972 PNS24243 293 89.7474 0 0 KQK14069 1603 1327.71 544.843 23.9693 KQK14071 474 225.629 4.56244 1.18111 ==> SRR7473334.se.tsv <== BRADI_1g14170v3 608 BRADI_1g53295v3 6281 BRADI_1g59795v3 505 BRADI_1g07683v3 0 BRADI_1g00485v3 56 BRADI_1g20270v3 995 BRADI_1g74790v3 68 BRADI_1g09890v3 3 BRADI_1g77505v3 153 BRADI_1g48960v3 0 SRR7473334 completed mapping pipeline successfully