Starting /dee2/code/volunteer_pipeline.sh SRR7473335 current disk space = 1543200976896 free memory = 1599995376 SRR7473335 SRAfilesize 1d8726ce14f26d6eb4cec479ff2c1a0f SRR7473335.sra SRR7473335.sra file validated SRR7473335 is paired end SRR7473335 is conventional basespace SRR7473335 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473335_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3565 34.0 33.0 34.0 33.0 34.0 2 33.419 34.0 34.0 34.0 33.0 34.0 3 33.47775 34.0 34.0 34.0 33.0 34.0 4 33.45525 34.0 34.0 34.0 33.0 34.0 5 33.46975 34.0 34.0 34.0 33.0 34.0 6 37.12025 38.0 38.0 38.0 36.0 38.0 7 37.47875 38.0 38.0 38.0 37.0 38.0 8 37.52725 38.0 38.0 38.0 38.0 38.0 9 37.56475 38.0 38.0 38.0 38.0 38.0 10-14 37.523199999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.46124999999999 38.0 38.0 38.0 37.4 38.0 20-24 37.4919 38.0 38.0 38.0 37.6 38.0 25-29 37.4012 38.0 38.0 38.0 37.0 38.0 30-34 37.16755 38.0 38.0 38.0 36.8 38.0 35-39 37.1707 38.0 38.0 38.0 36.6 38.0 40-44 37.05935 38.0 38.0 38.0 36.0 38.0 45-49 36.989 38.0 38.0 38.0 36.0 38.0 50-54 36.8393 38.0 38.0 38.0 35.0 38.0 55-59 36.923300000000005 38.0 38.0 38.0 35.2 38.0 60-64 36.87595 38.0 38.0 38.0 35.2 38.0 65-69 36.74285 38.0 38.0 38.0 34.6 38.0 70-74 36.57725000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.697250000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.561550000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.5071 38.0 38.0 38.0 34.0 38.0 90-94 36.17835 38.0 37.6 38.0 33.2 38.0 95-99 35.963350000000005 38.0 37.0 38.0 32.4 38.0 100-104 35.7666 38.0 36.4 38.0 31.6 38.0 105-109 35.5955 38.0 36.0 38.0 31.0 38.0 110-114 35.20505 38.0 35.6 38.0 29.2 38.0 115-119 34.7682 38.0 35.0 38.0 27.2 38.0 120-124 34.7538 38.0 35.0 38.0 27.2 38.0 125-129 34.331 38.0 35.0 38.0 24.6 38.0 130-134 33.8606 38.0 34.0 38.0 22.8 38.0 135-139 33.1955 38.0 33.6 38.0 19.8 38.0 140-144 32.842600000000004 38.0 33.0 38.0 14.6 38.0 145-149 31.6298 36.2 32.6 38.0 11.4 38.0 150-151 26.759124999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 3.0 14 0.0 15 5.0 16 3.0 17 1.0 18 3.0 19 9.0 20 4.0 21 7.0 22 15.0 23 11.0 24 13.0 25 19.0 26 12.0 27 27.0 28 35.0 29 44.0 30 53.0 31 78.0 32 107.0 33 138.0 34 237.0 35 379.0 36 914.0 37 1880.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.45112781954887 11.152882205513784 7.919799498746867 40.476190476190474 2 22.608913370055085 14.546820230345519 38.6579869804707 24.18627941912869 3 21.0 18.224999999999998 26.724999999999998 34.050000000000004 4 28.125 24.5 21.25 26.125 5 27.474999999999998 30.4 22.475 19.650000000000002 6 21.375 31.4 23.45 23.775 7 18.5 22.025 37.675 21.8 8 18.55 21.75 30.049999999999997 29.65 9 21.05 20.200000000000003 32.125 26.625 10-14 23.400000000000002 25.505 24.565 26.529999999999998 15-19 23.93 24.07 25.445 26.555 20-24 23.735 24.815 25.285000000000004 26.165 25-29 23.400000000000002 25.074999999999996 24.935 26.590000000000003 30-34 24.035 24.0 25.25 26.715 35-39 23.69855478321748 23.948592288843326 25.843876581487223 26.508976346451966 40-44 24.494595676541234 24.029223378702962 24.769815852682147 26.706365092073657 45-49 24.12982596519304 24.1998399679936 25.520104020804162 26.150230046009206 50-54 23.825 24.62 25.195 26.36 55-59 24.215 23.7 25.215 26.87 60-64 23.965 24.03 25.590000000000003 26.415 65-69 23.330000000000002 24.275 25.215 27.18 70-74 24.45 24.23 24.8 26.52 75-79 24.395 24.099999999999998 25.155 26.35 80-84 24.015 24.279999999999998 25.345000000000002 26.36 85-89 24.065 23.630000000000003 25.990000000000002 26.314999999999998 90-94 23.998199009455202 23.76306968832858 25.183851118114966 27.054880184101254 95-99 23.92610393511565 24.261540002002604 25.027535796535496 26.784820266346248 100-104 24.665 24.0 24.610000000000003 26.724999999999998 105-109 24.48 24.08 24.93 26.51 110-114 24.425 24.58 24.765 26.229999999999997 115-119 24.495 24.645 24.795 26.064999999999998 120-124 24.665 24.505 24.445 26.384999999999998 125-129 24.445 24.315 24.335 26.905 130-134 24.916111584113786 24.525467020583964 24.074723293434168 26.48369810186808 135-139 24.291233880274977 24.436750464147725 25.12920869085253 26.142806964724773 140-144 24.223478217376083 24.563597259040666 24.598609513329666 26.614315010253588 145-149 24.021842593056462 24.633034417113368 24.66309303141125 26.68202995841892 150-151 25.160397534281042 23.72625487482702 24.40558560825261 26.707761982639326 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 0.5 26 1.0 27 2.0 28 3.5 29 3.0 30 4.5 31 9.5 32 14.5 33 21.5 34 23.5 35 33.0 36 38.5 37 40.5 38 63.0 39 93.0 40 119.0 41 135.0 42 156.5 43 158.5 44 164.5 45 176.5 46 174.5 47 186.5 48 187.0 49 166.5 50 150.5 51 146.0 52 128.5 53 120.0 54 121.5 55 114.5 56 103.0 57 96.0 58 100.5 59 97.5 60 89.0 61 88.5 62 85.0 63 65.0 64 58.0 65 71.0 66 67.0 67 53.0 68 51.5 69 47.0 70 43.0 71 39.0 72 25.5 73 18.0 74 14.0 75 9.5 76 6.5 77 4.0 78 4.0 79 3.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.08 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.055 95-99 0.13 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.165 135-139 0.35500000000000004 140-144 0.034999999999999996 145-149 0.19499999999999998 150-151 0.6375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01440485216074 97.95 2 0.9097801364670205 1.7999999999999998 3 0.050543340914834464 0.15 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.9000000000000004 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.5374999999999996 0.0 0.0 0.0 0.0 116-117 3.9749999999999996 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.5125 0.0 0.0 0.0 0.0 126-127 5.949999999999999 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 7.8375 0.0 0.0 0.0 0.0 136-137 8.425 0.0 0.0 0.0 0.0 138-139 8.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTCC 10 0.006875036 144.6875 5 TCTTCCC 10 0.006875036 144.6875 6 >>END_MODULE SRR7473335 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473335_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09725 33.0 33.0 34.0 32.0 34.0 2 32.1905 33.0 33.0 34.0 32.0 34.0 3 32.2955 34.0 33.0 34.0 32.0 34.0 4 32.14675 34.0 33.0 34.0 32.0 34.0 5 32.278 34.0 33.0 34.0 32.0 34.0 6 36.80925 38.0 38.0 38.0 36.0 38.0 7 36.969 38.0 38.0 38.0 36.0 38.0 8 36.946 38.0 38.0 38.0 36.0 38.0 9 36.99825 38.0 38.0 38.0 36.0 38.0 10-14 37.06845 38.0 38.0 38.0 37.0 38.0 15-19 36.898 38.0 38.0 38.0 36.8 38.0 20-24 36.6769 38.0 38.0 38.0 36.2 38.0 25-29 36.83290000000001 38.0 38.0 38.0 36.2 38.0 30-34 36.89275 38.0 38.0 38.0 36.8 38.0 35-39 36.7001 38.0 38.0 38.0 36.2 38.0 40-44 36.871 38.0 38.0 38.0 36.6 38.0 45-49 36.5966 38.0 38.0 38.0 36.0 38.0 50-54 36.660849999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.7736 38.0 38.0 38.0 36.0 38.0 60-64 36.61825 38.0 38.0 38.0 35.6 38.0 65-69 36.13785 38.0 38.0 38.0 34.0 38.0 70-74 36.44325 38.0 38.0 38.0 35.0 38.0 75-79 36.5241 38.0 38.0 38.0 35.0 38.0 80-84 36.3787 38.0 38.0 38.0 34.2 38.0 85-89 36.2266 38.0 38.0 38.0 34.0 38.0 90-94 36.06355 38.0 38.0 38.0 34.0 38.0 95-99 35.628949999999996 38.0 38.0 38.0 32.6 38.0 100-104 35.0771 38.0 37.2 38.0 29.6 38.0 105-109 34.9679 38.0 36.8 38.0 28.8 38.0 110-114 34.7827 38.0 36.4 38.0 28.0 38.0 115-119 34.24745 38.0 35.6 38.0 23.2 38.0 120-124 34.19725 38.0 35.2 38.0 23.4 38.0 125-129 33.96039999999999 38.0 35.0 38.0 22.0 38.0 130-134 33.61245 38.0 34.4 38.0 21.8 38.0 135-139 33.137950000000004 38.0 34.0 38.0 14.2 38.0 140-144 32.3525 38.0 32.8 38.0 13.0 38.0 145-149 31.397700000000004 38.0 31.6 38.0 6.4 38.0 150-151 26.072 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 13.0 5 3.0 6 1.0 7 2.0 8 0.0 9 1.0 10 4.0 11 3.0 12 7.0 13 5.0 14 5.0 15 6.0 16 10.0 17 17.0 18 8.0 19 10.0 20 17.0 21 10.0 22 16.0 23 25.0 24 12.0 25 13.0 26 22.0 27 19.0 28 38.0 29 50.0 30 43.0 31 73.0 32 97.0 33 98.0 34 177.0 35 258.0 36 639.0 37 2281.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.481206852467395 18.000511378164152 9.28151367936589 34.236768090002556 2 27.121250961291977 24.66034350166624 29.556523968213277 18.661881568828505 3 25.063938618925828 23.88746803069054 26.11253196930946 24.93606138107417 4 26.179487179487182 31.48717948717949 18.923076923076923 23.410256410256412 5 29.138903126601747 34.31573552024603 18.32393644284982 18.22142491030241 6 21.976364093537843 35.001257229067136 20.995725421171738 22.026653256223284 7 23.654568210262827 17.822277847309138 34.06758448060075 24.455569461827285 8 21.256885327991988 20.555833750625936 26.564847270906363 31.622433650475713 9 23.62953692115144 22.177722152690862 26.357947434292868 27.83479349186483 10-14 25.797565983873387 25.507086693043522 22.166574848500026 26.52877247458306 15-19 25.94306407806056 24.93209938637964 23.79539281762398 25.329443717935824 20-24 26.13785447572913 25.63830860833586 23.503885356746395 24.719951559188615 25-29 25.85218702865762 24.86173956762192 23.634992458521868 25.65108094519859 30-34 26.40714357379352 25.574395505167054 22.935687769639813 25.082773151399618 35-39 26.107602930032836 25.157868148522354 23.40995200808285 25.324576913361962 40-44 26.383939774153077 24.893350062735255 23.83939774153074 24.88331242158093 45-49 26.258283170620665 25.1403712883808 23.724012342556527 24.877333198442006 50-54 26.753456453728937 24.52316076294278 23.534160863861135 25.18922191946715 55-59 26.27411676271611 25.171636181408168 23.367577048358807 25.186670007516916 60-64 27.000100633994162 24.438965482540002 23.674147126899467 24.886786756566366 65-69 26.69917708015849 24.814589048054454 23.666565071624504 24.819668800162553 70-74 27.10628238016196 24.626527840651878 23.203058196267794 25.064131582918364 75-79 26.801903330828953 24.838467317806163 23.72151264713248 24.638116704232406 80-84 26.926354840326866 24.941093898831905 23.296736351331027 24.8358149095102 85-89 27.131122908945205 24.646899729540216 23.389762596413906 24.832214765100673 90-94 26.5242523247047 24.99120382005529 23.830108067353606 24.654435787886403 95-99 26.58619465435918 25.140741492113406 23.558350661865397 24.714713191662018 100-104 27.574598316755928 25.457791379750063 23.10635042081102 23.86125988268299 105-109 26.345898457452243 25.048523853304726 23.781795893349678 24.82378179589335 110-114 26.75566467188379 25.742928750447547 22.991151347757146 24.51025522991151 115-119 27.443435431737722 25.42712020932738 23.190190344261456 23.939254014673438 120-124 26.794453507340947 25.72389885807504 23.43495106035889 24.04669657422512 125-129 27.96864661271441 24.955463938514786 23.494681121799765 23.58120832697104 130-134 28.399918258914887 25.41636865229386 22.560539491161748 23.62317359762951 135-139 27.599837826880197 25.831137239002633 23.641800121629842 22.927224812487328 140-144 27.934485896269333 25.81134364573855 23.248407643312103 23.00576281468001 145-149 28.27027852741993 25.347522786292583 23.219104842405418 23.16309384388207 150-151 28.474271782368792 26.061850378544847 23.200307968689852 22.26356987039651 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.5 10 1.0 11 0.0 12 0.5 13 1.0 14 2.0 15 2.0 16 1.0 17 0.5 18 1.5 19 2.0 20 1.5 21 2.0 22 2.0 23 2.0 24 1.0 25 1.5 26 3.0 27 4.5 28 8.0 29 10.5 30 11.0 31 11.5 32 12.5 33 16.5 34 22.5 35 29.5 36 34.5 37 40.5 38 52.5 39 79.0 40 113.0 41 129.5 42 139.5 43 139.0 44 149.5 45 162.5 46 159.0 47 163.0 48 158.0 49 144.0 50 137.0 51 137.5 52 137.5 53 136.5 54 123.0 55 120.5 56 115.0 57 94.0 58 103.0 59 115.5 60 104.5 61 92.5 62 92.0 63 96.0 64 81.0 65 67.5 66 68.0 67 66.0 68 69.0 69 61.0 70 50.0 71 43.0 72 29.0 73 15.0 74 9.5 75 9.0 76 4.5 77 1.5 78 2.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 2.475 3 2.25 4 2.5 5 2.45 6 0.575 7 0.125 8 0.15 9 0.125 10-14 0.165 15-19 0.59 20-24 0.91 25-29 0.5499999999999999 30-34 0.33 35-39 1.0250000000000001 40-44 0.375 45-49 1.155 50-54 0.91 55-59 0.22499999999999998 60-64 0.63 65-69 1.5699999999999998 70-74 0.5950000000000001 75-79 0.17500000000000002 80-84 0.265 85-89 0.16999999999999998 90-94 0.525 95-99 1.415 100-104 1.975 105-109 2.11 110-114 2.245 115-119 2.545 120-124 1.92 125-129 1.765 130-134 2.13 135-139 1.34 140-144 1.09 145-149 1.805 150-151 2.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54740061162079 96.675 2 1.0703363914373087 2.1 3 0.2803261977573904 0.8250000000000001 4 0.10193679918450561 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.48750000000000004 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.475 0.0 0.0 0.0 0.0 116-117 3.9124999999999996 0.0 0.0 0.0 0.0 118-119 4.175 0.0 0.0 0.0 0.0 120-121 4.575 0.0 0.0 0.0 0.0 122-123 5.025 0.0 0.0 0.0 0.0 124-125 5.4375 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.237500000000001 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 7.05 0.0 0.0 0.0 0.0 134-135 7.575 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAAGG 10 0.0067329993 145.65384 2 AGGTTGG 10 0.0067329993 145.65384 4 TCTCTCA 10 0.0067329993 145.65384 145 >>END_MODULE Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981057 spots for SRR7473335.sra Written 981057 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra Read 981052 spots for SRR7473335.sra Written 981052 spots for SRR7473335.sra SRR ids: ['SRR7473335.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a72o4uwr SRR7473335.sra spots: 19621045 blocks: [[1, 981052], [981053, 1962104], [1962105, 2943156], [2943157, 3924208], [3924209, 4905260], [4905261, 5886312], [5886313, 6867364], [6867365, 7848416], [7848417, 8829468], [8829469, 9810520], [9810521, 10791572], [10791573, 11772624], [11772625, 12753676], [12753677, 13734728], [13734729, 14715780], [14715781, 15696832], [15696833, 16677884], [16677885, 17658936], [17658937, 18639988], [18639989, 19621045]] SRR7473335 file size 6627227 SRR7473335 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473335 SRR7473335_1.fastq SRR7473335_2.fastq Input file: SRR7473335_1.fastq Paired file: SRR7473335_2.fastq trimmed: SRR7473335-trimmed-pair1.fastq, SRR7473335-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:58:12 2024 >> started Sat Dec 7 13:58:33 2024 >> done (21.758s) 19621045 read pairs processed; of these: 26249 ( 0.13%) short read pairs filtered out after trimming by size control 48344 ( 0.25%) empty read pairs filtered out after trimming by size control 19546452 (99.62%) read pairs available; of these: 11244655 (57.53%) trimmed read pairs available after processing 8301797 (42.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 35 0.00% 19 42 0.00% 20 38 0.00% 21 29 0.00% 22 23 0.00% 23 33 0.00% 24 39 0.00% 25 40 0.00% 26 36 0.00% 27 33 0.00% 28 35 0.00% 29 39 0.00% 30 55 0.00% 31 51 0.00% 32 42 0.00% 33 56 0.00% 34 57 0.00% 35 61 0.00% 36 60 0.00% 37 87 0.00% 38 69 0.00% 39 93 0.00% 40 90 0.00% 41 126 0.00% 42 132 0.00% 43 155 0.00% 44 135 0.00% 45 136 0.00% 46 180 0.00% 47 173 0.00% 48 198 0.00% 49 237 0.00% 50 240 0.00% 51 263 0.00% 52 325 0.00% 53 316 0.00% 54 377 0.00% 55 383 0.00% 56 411 0.00% 57 505 0.00% 58 523 0.00% 59 607 0.00% 60 667 0.00% 61 776 0.00% 62 831 0.00% 63 949 0.00% 64 1109 0.01% 65 1203 0.01% 66 1308 0.01% 67 1631 0.01% 68 1918 0.01% 69 2536 0.01% 70 2737 0.01% 71 2365 0.01% 72 2489 0.01% 73 2750 0.01% 74 3004 0.02% 75 3309 0.02% 76 3682 0.02% 77 4170 0.02% 78 4453 0.02% 79 5071 0.03% 80 5532 0.03% 81 5988 0.03% 82 6739 0.03% 83 7714 0.04% 84 9468 0.05% 85 10209 0.05% 86 11037 0.06% 87 11757 0.06% 88 13066 0.07% 89 13800 0.07% 90 14570 0.07% 91 15541 0.08% 92 16239 0.08% 93 17891 0.09% 94 18786 0.10% 95 19917 0.10% 96 21067 0.11% 97 22512 0.12% 98 23436 0.12% 99 24531 0.13% 100 26012 0.13% 101 26119 0.13% 102 27703 0.14% 103 28890 0.15% 104 30387 0.16% 105 32434 0.17% 106 33981 0.17% 107 34827 0.18% 108 36215 0.19% 109 38695 0.20% 110 39738 0.20% 111 40110 0.21% 112 41796 0.21% 113 44667 0.23% 114 44737 0.23% 115 47407 0.24% 116 49093 0.25% 117 50049 0.26% 118 51962 0.27% 119 52980 0.27% 120 55347 0.28% 121 56593 0.29% 122 59160 0.30% 123 61217 0.31% 124 62689 0.32% 125 64800 0.33% 126 66758 0.34% 127 69225 0.35% 128 71492 0.37% 129 75046 0.38% 130 76951 0.39% 131 80227 0.41% 132 82847 0.42% 133 86913 0.44% 134 91254 0.47% 135 95678 0.49% 136 100306 0.51% 137 106773 0.55% 138 112140 0.57% 139 121734 0.62% 140 129459 0.66% 141 144233 0.74% 142 156129 0.80% 143 175388 0.90% 144 201233 1.03% 145 239504 1.23% 146 297383 1.52% 147 401264 2.05% 148 617736 3.16% 149 1180787 6.04% 150 4983264 25.49% 151 8301797 42.47% 19546452 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=20 prefix-density=0.81 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=55.03 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=6.7 sequence=TCCTTCTTCACTCCGGGAAGGTCCGCCTTGAACACGTG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=34 prefix-density=0.83 prefix-fanout=2.3 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=127.41 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGA SRR7473335 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:59:13 Started mapping on | Dec 07 13:59:13 Finished on | Dec 07 14:01:59 Mapping speed, Million of reads per hour | 423.90 Number of input reads | 19546452 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18456164 Uniquely mapped reads % | 94.42% Average mapped length | 291.59 Number of splices: Total | 18767817 Number of splices: Annotated (sjdb) | 17593530 Number of splices: GT/AG | 18537890 Number of splices: GC/AG | 198525 Number of splices: AT/AC | 11976 Number of splices: Non-canonical | 19426 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181527 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 23740 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 922123 922123 922123 N_multimapping 181527 181527 181527 N_noFeature 693438 17825303 974441 N_ambiguous 410815 2313 63015 UnstrandedReadsAssigned:17351911 PositiveStrandReadsAssigned:628548 NegativeStrandReadsAssigned:17418708 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473335 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473335-trimmed-pair1.fastq SRR7473335-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,546,452 reads, 17,492,533 reads pseudoaligned [quant] estimated average fragment length: 263.643 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR7473335.ke.tsv 35125 SRR7473335.se.tsv 88098 total ==> SRR7473335.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.975 6.82323 0.780854 PNS24247 1044 781.357 38.977 3.84753 PNS24249 1928 1665.36 36.4411 1.68775 PNS24246 1044 781.357 38.977 3.84753 PNS24248 1044 781.357 38.977 3.84753 PNS24244 1471 1208.36 54.8046 3.4982 PNS24243 293 96.7264 0 0 KQK14069 1603 1340.36 485.402 27.9322 KQK14071 474 235.511 2.69854 0.883774 ==> SRR7473335.se.tsv <== BRADI_1g14170v3 523 BRADI_1g53295v3 4609 BRADI_1g59795v3 364 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 1291 BRADI_1g74790v3 84 BRADI_1g09890v3 2 BRADI_1g77505v3 114 BRADI_1g48960v3 0 SRR7473335 completed mapping pipeline successfully