Starting /dee2/code/volunteer_pipeline.sh SRR7473337 current disk space = 1543204835328 free memory = 1594128140 SRR7473337 SRAfilesize 0c39a10a54c4f783375f290760243ac3 SRR7473337.sra SRR7473337.sra file validated SRR7473337 is paired end SRR7473337 is conventional basespace SRR7473337 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473337_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36325 34.0 33.0 34.0 33.0 34.0 2 33.38425 34.0 34.0 34.0 33.0 34.0 3 33.47425 34.0 34.0 34.0 33.0 34.0 4 33.416 34.0 34.0 34.0 33.0 34.0 5 33.405 34.0 34.0 34.0 33.0 34.0 6 37.1645 38.0 38.0 38.0 36.0 38.0 7 37.45275 38.0 38.0 38.0 37.0 38.0 8 37.52625 38.0 38.0 38.0 37.0 38.0 9 37.50475 38.0 38.0 38.0 37.0 38.0 10-14 37.5117 38.0 38.0 38.0 38.0 38.0 15-19 37.439800000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.46465 38.0 38.0 38.0 37.8 38.0 25-29 37.394349999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.09195 38.0 38.0 38.0 36.4 38.0 35-39 37.072500000000005 38.0 38.0 38.0 36.0 38.0 40-44 37.07445 38.0 38.0 38.0 36.0 38.0 45-49 37.06825 38.0 38.0 38.0 36.0 38.0 50-54 36.8575 38.0 38.0 38.0 35.2 38.0 55-59 36.94675 38.0 38.0 38.0 35.8 38.0 60-64 36.8972 38.0 38.0 38.0 35.4 38.0 65-69 36.7179 38.0 38.0 38.0 34.8 38.0 70-74 36.59155 38.0 38.0 38.0 34.2 38.0 75-79 36.7445 38.0 38.0 38.0 34.8 38.0 80-84 36.613350000000004 38.0 38.0 38.0 34.4 38.0 85-89 36.57084999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.202749999999995 38.0 37.6 38.0 33.6 38.0 95-99 35.9808 38.0 37.0 38.0 32.8 38.0 100-104 35.900349999999996 38.0 37.0 38.0 32.4 38.0 105-109 35.76325 38.0 36.4 38.0 31.8 38.0 110-114 35.42229999999999 38.0 36.0 38.0 30.6 38.0 115-119 34.984700000000004 38.0 35.2 38.0 27.8 38.0 120-124 34.8129 38.0 35.0 38.0 27.6 38.0 125-129 34.48935 38.0 35.0 38.0 26.0 38.0 130-134 34.02055 38.0 34.2 38.0 23.2 38.0 135-139 33.2614 38.0 33.6 38.0 19.0 38.0 140-144 32.9285 38.0 33.4 38.0 14.8 38.0 145-149 31.954 36.8 32.6 38.0 11.4 38.0 150-151 27.146375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 2.0 13 1.0 14 2.0 15 2.0 16 1.0 17 1.0 18 11.0 19 4.0 20 5.0 21 7.0 22 4.0 23 8.0 24 16.0 25 11.0 26 22.0 27 20.0 28 43.0 29 52.0 30 59.0 31 88.0 32 96.0 33 130.0 34 205.0 35 373.0 36 892.0 37 1942.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.58858858858859 12.162162162162163 9.40940940940941 39.83983983983984 2 24.498997995991985 16.53306613226453 35.921843687374746 23.04609218436874 3 21.55 20.474999999999998 25.5 32.475 4 26.075 28.1 21.125 24.7 5 24.625 32.15 22.650000000000002 20.575 6 22.3 32.1 25.25 20.349999999999998 7 18.0 22.15 40.475 19.375 8 20.1 22.25 29.825000000000003 27.825 9 19.75 20.349999999999998 33.7 26.200000000000003 10-14 23.095 25.305 25.395 26.205000000000002 15-19 23.064999999999998 25.615 25.695 25.624999999999996 20-24 22.99 25.41 26.090000000000003 25.509999999999998 25-29 22.8 25.900000000000002 25.264999999999997 26.035000000000004 30-34 23.355 24.755 26.290000000000003 25.6 35-39 23.286164308215408 24.90624531226561 26.256312815640783 25.551277563878195 40-44 23.53853077961694 24.90373556033405 26.1039155873381 25.453818072710906 45-49 23.225 25.575 25.1 26.1 50-54 23.165 24.81 26.035000000000004 25.990000000000002 55-59 23.56 25.25 25.445 25.745 60-64 23.05 24.865000000000002 25.855 26.229999999999997 65-69 23.845 24.77 25.61 25.775 70-74 23.415 25.055 25.61 25.919999999999998 75-79 24.005000000000003 24.695 25.465 25.835 80-84 23.355 25.380000000000003 25.69 25.575 85-89 24.474999999999998 24.675 24.81 26.040000000000003 90-94 23.84145731158042 25.337804023621256 24.972475227704933 25.848263437093383 95-99 23.88941753893925 24.280062102469074 24.916111584113786 26.914408774477888 100-104 24.060000000000002 24.6 24.925 26.415 105-109 24.005000000000003 24.595 25.34 26.06 110-114 24.13 25.11 25.295 25.465 115-119 24.19 25.115 24.925 25.77 120-124 23.845 25.635 24.43 26.090000000000003 125-129 23.87 24.75 25.34 26.040000000000003 130-134 24.411027568922307 25.203007518796994 24.67669172932331 25.709273182957393 135-139 23.808806547170757 25.199578249736405 25.229703268564542 25.761911934528293 140-144 24.544817927170868 25.115046018407362 24.67987194877951 25.660264105642256 145-149 24.582685848914732 25.37470549902251 24.4673918492155 25.57521680284726 150-151 25.543409976127656 23.784395024500565 24.588516145244377 26.083678854127403 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 1.0 27 0.5 28 2.5 29 6.0 30 9.5 31 10.0 32 16.0 33 25.5 34 33.0 35 38.5 36 51.5 37 68.0 38 74.5 39 93.5 40 113.0 41 135.0 42 159.5 43 170.0 44 189.0 45 205.5 46 200.5 47 189.5 48 172.0 49 168.5 50 169.5 51 148.0 52 125.5 53 120.0 54 116.5 55 110.0 56 114.5 57 108.0 58 100.0 59 100.0 60 85.0 61 75.5 62 76.0 63 63.0 64 57.0 65 57.5 66 44.5 67 33.0 68 31.0 69 30.0 70 25.5 71 16.5 72 17.0 73 16.5 74 8.5 75 5.5 76 4.5 77 2.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.09 95-99 0.165 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.25 135-139 0.415 140-144 0.04 145-149 0.255 150-151 0.5125000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8619119878604 97.725 2 1.112797167425392 2.1999999999999997 3 0.025290844714213456 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.8 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 5.05 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTTG 10 0.006830828 145.0 5 >>END_MODULE SRR7473337 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473337_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.99625 33.0 33.0 34.0 31.0 34.0 2 32.001 33.0 33.0 34.0 32.0 34.0 3 32.09875 34.0 33.0 34.0 31.0 34.0 4 31.93475 34.0 33.0 34.0 31.0 34.0 5 32.01175 34.0 33.0 34.0 32.0 34.0 6 36.58575 38.0 38.0 38.0 34.0 38.0 7 36.8765 38.0 38.0 38.0 35.0 38.0 8 36.90725 38.0 38.0 38.0 36.0 38.0 9 36.9575 38.0 38.0 38.0 36.0 38.0 10-14 36.98945 38.0 38.0 38.0 36.0 38.0 15-19 36.812349999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.62055 38.0 38.0 38.0 36.0 38.0 25-29 36.656600000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.73315 38.0 38.0 38.0 36.0 38.0 35-39 36.6123 38.0 38.0 38.0 35.8 38.0 40-44 36.744249999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.44935 38.0 38.0 38.0 35.6 38.0 50-54 36.5789 38.0 38.0 38.0 35.6 38.0 55-59 36.6201 38.0 38.0 38.0 35.6 38.0 60-64 36.489399999999996 38.0 38.0 38.0 35.2 38.0 65-69 35.93315 38.0 38.0 38.0 33.6 38.0 70-74 36.3327 38.0 38.0 38.0 34.2 38.0 75-79 36.38674999999999 38.0 38.0 38.0 34.2 38.0 80-84 36.2293 38.0 38.0 38.0 34.0 38.0 85-89 36.101699999999994 38.0 38.0 38.0 33.6 38.0 90-94 35.9653 38.0 38.0 38.0 33.2 38.0 95-99 35.5363 38.0 38.0 38.0 32.6 38.0 100-104 34.81914999999999 38.0 36.8 38.0 27.8 38.0 105-109 34.7147 38.0 36.6 38.0 27.0 38.0 110-114 34.4842 38.0 36.0 38.0 26.0 38.0 115-119 33.9067 38.0 35.2 38.0 21.8 38.0 120-124 33.9129 38.0 35.0 38.0 22.2 38.0 125-129 33.77075 38.0 35.0 38.0 20.2 38.0 130-134 33.3266 38.0 34.4 38.0 14.8 38.0 135-139 32.9063 38.0 33.8 38.0 13.8 38.0 140-144 32.334900000000005 38.0 33.0 38.0 13.0 38.0 145-149 31.403700000000004 38.0 31.8 38.0 6.4 38.0 150-151 26.13325 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 9.0 4 19.0 5 4.0 6 2.0 7 2.0 8 0.0 9 2.0 10 1.0 11 2.0 12 1.0 13 4.0 14 5.0 15 7.0 16 13.0 17 14.0 18 17.0 19 15.0 20 11.0 21 20.0 22 21.0 23 36.0 24 16.0 25 22.0 26 34.0 27 33.0 28 32.0 29 42.0 30 67.0 31 65.0 32 78.0 33 103.0 34 146.0 35 260.0 36 625.0 37 2269.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.10546574287914 18.501411342057995 12.034898639979472 32.358224275083394 2 30.836550836550835 22.239382239382238 27.335907335907333 19.588159588159588 3 23.183568677792042 25.776636713735556 25.59691912708601 25.442875481386395 4 25.663488791548573 31.022932233960322 20.896676114403505 22.416902860087607 5 28.24800617442758 32.209930537689736 19.835348597890405 19.706714689992282 6 23.307324439969797 34.68411779511704 20.563805688396677 21.444752076516487 7 21.73043260815204 16.454113528382095 36.48412103025757 25.331332833208304 8 22.380595148787197 21.780445111277817 24.63115778944736 31.207801950487625 9 23.13078269567392 21.555388847211805 27.831957989497376 27.481870467616904 10-14 26.04541816726691 24.814925970388156 22.88915566226491 26.250500200080033 15-19 25.329112651994773 24.7764043814692 24.324188523766455 25.57029444276957 20-24 25.653446361893227 24.88646684831971 23.821778181451204 25.63830860833586 25-29 26.000402171727327 24.80394128292781 24.069977880554998 25.125678664789863 30-34 25.68347128166541 25.026335590669675 24.088286932530725 25.20190619513419 35-39 25.95061354340251 25.243649952027468 23.834772509215778 24.97096399535424 40-44 25.92109225981327 24.686276478265235 24.013653247665896 25.378978014255598 45-49 25.57821752112961 25.39096108102637 23.87772660559745 25.153094792246574 50-54 26.33383761976803 24.599092284417548 24.155320221886033 24.91174987392839 55-59 26.6302440980402 24.90100746829733 23.903563731141297 24.565184702521176 60-64 26.10817610062893 24.67924528301887 24.281761006289308 24.930817610062896 65-69 26.77517802644964 24.053916581892167 24.155645981688707 25.01525940996948 70-74 26.402855993563957 24.77373290426388 23.848551890587288 24.974859211584878 75-79 26.091528139395155 25.340476667334265 24.0686961746445 24.49929901862608 80-84 26.048399218397716 24.475174106919184 24.645523322811762 24.830903351871335 85-89 26.128789776998246 24.650463542971686 24.32974191931847 24.891004760711603 90-94 26.325310285915283 25.832872719963824 23.451082860157783 24.390734133963118 95-99 26.32220079179779 24.956857171860726 24.398538219470105 24.322403816871383 100-104 26.165736807083995 25.16251215642115 24.374264216614627 24.297486819880227 105-109 26.13624705037447 25.058992510516052 24.64860982866523 24.15615061044424 110-114 26.454265159301134 25.84789311408017 23.083247687564235 24.61459403905447 115-119 26.65841328793975 25.404931393789333 23.785205818632 24.151449499638915 120-124 26.667689789236746 25.649682832003272 23.34254143646409 24.340085942295886 125-129 26.65101561702562 25.7578850668572 24.400326630601203 23.190772685515974 130-134 26.704632907495768 25.44764250166744 24.359961007644554 23.48776358319224 135-139 26.73362755542028 26.50027900370314 23.03556029016385 23.730533150712727 140-144 26.866275541169333 26.229010722233458 23.320857778676917 23.583855957920292 145-149 27.439865175425155 25.938409682855827 23.400234921607684 23.22149022011133 150-151 27.42643262777491 25.60660815694373 23.322147651006713 23.64481156427465 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.5 15 2.0 16 2.0 17 1.0 18 1.0 19 1.0 20 0.5 21 2.0 22 5.5 23 5.5 24 3.0 25 1.0 26 2.0 27 3.0 28 3.0 29 5.5 30 6.5 31 5.0 32 11.5 33 19.5 34 23.0 35 29.0 36 38.5 37 51.0 38 66.5 39 84.0 40 93.0 41 105.0 42 135.5 43 150.0 44 166.0 45 178.0 46 171.0 47 176.0 48 164.0 49 160.0 50 167.5 51 155.0 52 135.0 53 117.5 54 112.5 55 107.5 56 101.0 57 114.5 58 128.5 59 118.5 60 104.5 61 95.5 62 89.0 63 82.5 64 79.5 65 79.0 66 64.0 67 53.5 68 52.0 69 44.0 70 31.5 71 27.0 72 22.0 73 12.5 74 12.0 75 8.5 76 3.5 77 3.0 78 1.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 2.875 3 2.625 4 2.9749999999999996 5 2.825 6 0.675 7 0.025 8 0.025 9 0.025 10-14 0.04 15-19 0.49 20-24 0.91 25-29 0.54 30-34 0.325 35-39 0.985 40-44 0.38999999999999996 45-49 1.205 50-54 0.8500000000000001 55-59 0.245 60-64 0.625 65-69 1.7000000000000002 70-74 0.5599999999999999 75-79 0.13999999999999999 80-84 0.20500000000000002 85-89 0.22499999999999998 90-94 0.49500000000000005 95-99 1.49 100-104 2.315 105-109 2.53 110-114 2.7 115-119 3.0700000000000003 120-124 2.26 125-129 2.03 130-134 2.545 135-139 1.435 140-144 1.1400000000000001 145-149 2.095 150-151 3.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67684478371501 96.95 2 1.0178117048346056 2.0 3 0.22900763358778628 0.675 4 0.02544529262086514 0.1 5 0.02544529262086514 0.125 6 0.02544529262086514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.7249999999999996 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.2875 0.0 0.0 0.0 0.0 130-131 3.5875000000000004 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.8 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215127 spots for SRR7473337.sra Written 1215127 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra Read 1215125 spots for SRR7473337.sra Written 1215125 spots for SRR7473337.sra SRR ids: ['SRR7473337.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ouwcmpua SRR7473337.sra spots: 24302502 blocks: [[1, 1215125], [1215126, 2430250], [2430251, 3645375], [3645376, 4860500], [4860501, 6075625], [6075626, 7290750], [7290751, 8505875], [8505876, 9721000], [9721001, 10936125], [10936126, 12151250], [12151251, 13366375], [13366376, 14581500], [14581501, 15796625], [15796626, 17011750], [17011751, 18226875], [18226876, 19442000], [19442001, 20657125], [20657126, 21872250], [21872251, 23087375], [23087376, 24302502]] SRR7473337 file size 8213620 SRR7473337 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473337 SRR7473337_1.fastq SRR7473337_2.fastq Input file: SRR7473337_1.fastq Paired file: SRR7473337_2.fastq trimmed: SRR7473337-trimmed-pair1.fastq, SRR7473337-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:59:20 2024 >> started Sat Dec 7 13:59:49 2024 >> done (29.813s) 24302502 read pairs processed; of these: 33572 ( 0.14%) short read pairs filtered out after trimming by size control 53347 ( 0.22%) empty read pairs filtered out after trimming by size control 24215583 (99.64%) read pairs available; of these: 13460087 (55.58%) trimmed read pairs available after processing 10755496 (44.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 23 0.00% 20 24 0.00% 21 18 0.00% 22 31 0.00% 23 28 0.00% 24 41 0.00% 25 38 0.00% 26 22 0.00% 27 33 0.00% 28 52 0.00% 29 60 0.00% 30 36 0.00% 31 48 0.00% 32 42 0.00% 33 44 0.00% 34 60 0.00% 35 61 0.00% 36 52 0.00% 37 58 0.00% 38 66 0.00% 39 78 0.00% 40 83 0.00% 41 91 0.00% 42 96 0.00% 43 93 0.00% 44 108 0.00% 45 110 0.00% 46 116 0.00% 47 147 0.00% 48 151 0.00% 49 177 0.00% 50 172 0.00% 51 198 0.00% 52 202 0.00% 53 247 0.00% 54 299 0.00% 55 292 0.00% 56 324 0.00% 57 380 0.00% 58 426 0.00% 59 449 0.00% 60 523 0.00% 61 565 0.00% 62 691 0.00% 63 774 0.00% 64 758 0.00% 65 889 0.00% 66 972 0.00% 67 1055 0.00% 68 1256 0.01% 69 1563 0.01% 70 1891 0.01% 71 2004 0.01% 72 1951 0.01% 73 2208 0.01% 74 2285 0.01% 75 2581 0.01% 76 2811 0.01% 77 3204 0.01% 78 3456 0.01% 79 3917 0.02% 80 4343 0.02% 81 4736 0.02% 82 5303 0.02% 83 5998 0.02% 84 7451 0.03% 85 8483 0.04% 86 8943 0.04% 87 9350 0.04% 88 10550 0.04% 89 11383 0.05% 90 11790 0.05% 91 12864 0.05% 92 13576 0.06% 93 14778 0.06% 94 15685 0.06% 95 16703 0.07% 96 17499 0.07% 97 18633 0.08% 98 19977 0.08% 99 20899 0.09% 100 22558 0.09% 101 23264 0.10% 102 24911 0.10% 103 26169 0.11% 104 27953 0.12% 105 29616 0.12% 106 31392 0.13% 107 32437 0.13% 108 34340 0.14% 109 36018 0.15% 110 37689 0.16% 111 39042 0.16% 112 41120 0.17% 113 43028 0.18% 114 44459 0.18% 115 47586 0.20% 116 49097 0.20% 117 50090 0.21% 118 52500 0.22% 119 54321 0.22% 120 57038 0.24% 121 59796 0.25% 122 62615 0.26% 123 65087 0.27% 124 68405 0.28% 125 69812 0.29% 126 72704 0.30% 127 76144 0.31% 128 78917 0.33% 129 82536 0.34% 130 87040 0.36% 131 90366 0.37% 132 94886 0.39% 133 99383 0.41% 134 104926 0.43% 135 111032 0.46% 136 117537 0.49% 137 124303 0.51% 138 131927 0.54% 139 144357 0.60% 140 156098 0.64% 141 171633 0.71% 142 190899 0.79% 143 215028 0.89% 144 249318 1.03% 145 297819 1.23% 146 373796 1.54% 147 505595 2.09% 148 773724 3.20% 149 1475791 6.09% 150 6224597 25.70% 151 10755496 44.42% 24215583 reads passed initial QC criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=14 prefix-density=1.15 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=14.24 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGCC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=12 prefix-density=0.87 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=44.44 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473337 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:00:31 Started mapping on | Dec 07 14:00:31 Finished on | Dec 07 14:05:28 Mapping speed, Million of reads per hour | 293.52 Number of input reads | 24215583 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 22847012 Uniquely mapped reads % | 94.35% Average mapped length | 293.16 Number of splices: Total | 24583705 Number of splices: Annotated (sjdb) | 23172993 Number of splices: GT/AG | 24269695 Number of splices: GC/AG | 280827 Number of splices: AT/AC | 10772 Number of splices: Non-canonical | 22411 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 208333 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 42950 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1178845 1178845 1178845 N_multimapping 208333 208333 208333 N_noFeature 731810 22117438 989686 N_ambiguous 557658 3168 87163 UnstrandedReadsAssigned:21557544 PositiveStrandReadsAssigned:726406 NegativeStrandReadsAssigned:21770163 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473337 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473337-trimmed-pair1.fastq SRR7473337-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,215,583 reads, 21,848,837 reads pseudoaligned [quant] estimated average fragment length: 285.477 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52973 SRR7473337.ke.tsv 35125 SRR7473337.se.tsv 88098 total ==> SRR7473337.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 652.606 0 0 PNS24247 1044 759.523 43.6535 3.67072 PNS24249 1928 1643.52 45.2262 1.75747 PNS24246 1044 759.523 43.6535 3.67072 PNS24248 1044 759.523 43.6535 3.67072 PNS24244 1471 1186.52 85.8132 4.61903 PNS24243 293 91.2732 0 0 KQK14069 1603 1318.52 993.993 48.1469 KQK14071 474 223.13 4.21814 1.20736 ==> SRR7473337.se.tsv <== BRADI_1g14170v3 1014 BRADI_1g53295v3 129 BRADI_1g59795v3 683 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 2879 BRADI_1g74790v3 91 BRADI_1g09890v3 9 BRADI_1g77505v3 224 BRADI_1g48960v3 0 SRR7473337 completed mapping pipeline successfully