Starting /dee2/code/volunteer_pipeline.sh SRR7473338 current disk space = 1543210831872 free memory = 1603246044 SRR7473338 SRAfilesize 6011b8185eddf4c9388cc3498c24b867 SRR7473338.sra SRR7473338.sra file validated SRR7473338 is paired end SRR7473338 is conventional basespace SRR7473338 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473338_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3035 34.0 33.0 34.0 33.0 34.0 2 33.446 34.0 34.0 34.0 33.0 34.0 3 33.5165 34.0 34.0 34.0 33.0 34.0 4 33.4435 34.0 34.0 34.0 33.0 34.0 5 33.447 34.0 34.0 34.0 33.0 34.0 6 37.13475 38.0 38.0 38.0 36.0 38.0 7 37.45275 38.0 38.0 38.0 37.0 38.0 8 37.53975 38.0 38.0 38.0 37.0 38.0 9 37.529 38.0 38.0 38.0 37.0 38.0 10-14 37.49595 38.0 38.0 38.0 37.8 38.0 15-19 37.3403 38.0 38.0 38.0 37.0 38.0 20-24 37.48935 38.0 38.0 38.0 37.6 38.0 25-29 37.40455000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.122550000000004 38.0 38.0 38.0 36.2 38.0 35-39 37.0707 38.0 38.0 38.0 36.0 38.0 40-44 36.95675 38.0 38.0 38.0 35.8 38.0 45-49 36.8611 38.0 38.0 38.0 35.2 38.0 50-54 36.854600000000005 38.0 38.0 38.0 35.0 38.0 55-59 36.88005 38.0 38.0 38.0 35.0 38.0 60-64 36.95015 38.0 38.0 38.0 35.4 38.0 65-69 36.612249999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.42755 38.0 38.0 38.0 33.8 38.0 75-79 36.5037 38.0 38.0 38.0 34.0 38.0 80-84 36.525 38.0 38.0 38.0 34.0 38.0 85-89 36.3177 38.0 37.6 38.0 33.6 38.0 90-94 35.95025 38.0 37.0 38.0 32.2 38.0 95-99 35.7109 38.0 36.6 38.0 31.0 38.0 100-104 35.6615 38.0 36.2 38.0 30.8 38.0 105-109 35.520599999999995 38.0 36.0 38.0 30.4 38.0 110-114 35.2078 38.0 35.8 38.0 28.8 38.0 115-119 34.76065 38.0 35.0 38.0 27.2 38.0 120-124 34.5341 38.0 34.8 38.0 26.2 38.0 125-129 34.00415 38.0 34.4 38.0 23.0 38.0 130-134 33.389050000000005 38.0 34.0 38.0 19.8 38.0 135-139 33.0031 38.0 33.6 38.0 16.2 38.0 140-144 32.3151 37.2 32.4 38.0 13.8 38.0 145-149 30.855349999999998 36.0 31.0 38.0 8.6 38.0 150-151 25.911875000000002 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 8.0 18 1.0 19 12.0 20 7.0 21 13.0 22 10.0 23 20.0 24 17.0 25 16.0 26 29.0 27 29.0 28 41.0 29 58.0 30 57.0 31 82.0 32 108.0 33 150.0 34 236.0 35 387.0 36 935.0 37 1780.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.45312892686605 13.59638100025132 9.424478512188992 33.52601156069364 2 25.45 15.1 33.1 26.35 3 21.575 23.1 25.900000000000002 29.425 4 26.424999999999997 28.65 21.85 23.075000000000003 5 26.89033550325488 31.27190786179269 22.358537806710068 19.479218828242363 6 22.400000000000002 33.175 22.900000000000002 21.525 7 18.35 20.775 39.725 21.15 8 20.65 22.2 27.250000000000004 29.9 9 20.5 20.75 31.7 27.05 10-14 23.375 25.245 24.63 26.75 15-19 23.27 25.22 25.490000000000002 26.02 20-24 23.49 25.019999999999996 25.47 26.02 25-29 23.43 24.985 25.259999999999998 26.325 30-34 23.505000000000003 24.959999999999997 25.324999999999996 26.21 35-39 23.9221766529959 24.65739721916575 25.65269580874262 25.767730319095726 40-44 23.435 25.174999999999997 25.35 26.040000000000003 45-49 22.795 24.97 25.174999999999997 27.060000000000002 50-54 23.05 25.165 25.545 26.240000000000002 55-59 23.49 25.21 24.97 26.33 60-64 23.77 24.385 25.305 26.540000000000003 65-69 24.25 24.740000000000002 25.080000000000002 25.929999999999996 70-74 23.865 24.54 25.255 26.340000000000003 75-79 23.77 24.654999999999998 25.195 26.38 80-84 23.84 24.65 25.3 26.21 85-89 24.474999999999998 24.495 24.985 26.045 90-94 24.22 24.45 25.335 25.995 95-99 24.092888243831638 24.5583304138932 25.09884390170662 26.249937440568537 100-104 23.82 25.009999999999998 24.925 26.245 105-109 24.615000000000002 24.605 24.445 26.334999999999997 110-114 24.38 24.795 24.59 26.235000000000003 115-119 23.76 23.945 25.415 26.88 120-124 23.84 24.93 24.63 26.6 125-129 23.76 24.44 25.455 26.345000000000002 130-134 24.790232628246997 24.760086419132794 24.910817464703815 25.538863487916398 135-139 24.43586400561629 24.58128572861298 24.68659111423127 26.296259151539463 140-144 24.435000000000002 25.009999999999998 24.505 26.05 145-149 24.54645685075674 24.7970331763055 24.591560589355517 26.06494938358224 150-151 24.617910824807375 24.201086270051785 24.883162814197295 26.29784009094354 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 0.5 27 3.0 28 6.0 29 6.0 30 10.0 31 16.5 32 18.0 33 20.5 34 29.0 35 37.0 36 45.5 37 63.0 38 72.0 39 90.5 40 114.0 41 129.5 42 158.5 43 178.5 44 183.5 45 196.5 46 187.0 47 183.0 48 184.5 49 161.5 50 150.0 51 138.5 52 126.0 53 121.5 54 110.5 55 104.5 56 98.5 57 87.0 58 90.5 59 89.0 60 74.5 61 72.5 62 73.5 63 72.5 64 83.0 65 75.0 66 57.0 67 48.0 68 47.5 69 43.5 70 34.0 71 24.0 72 18.0 73 19.5 74 16.5 75 11.5 76 6.0 77 3.0 78 3.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.095 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.485 135-139 0.29 140-144 0.0 145-149 0.22999999999999998 150-151 1.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01440485216074 97.95 2 0.8845084660096033 1.7500000000000002 3 0.10108668182966893 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 1.9500000000000002 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.4000000000000004 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.0875 0.0 0.0 0.0 0.0 128-129 3.275 0.0 0.0 0.0 0.0 130-131 3.6 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.2875 0.0 0.0 0.0 0.0 136-137 4.737500000000001 0.0 0.0 0.0 0.0 138-139 5.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGATTT 10 0.006594202 146.6962 145 TTTCTAT 10 0.0068502324 144.8625 5 AGAGCAC 55 2.683183E-4 53.344074 145 >>END_MODULE SRR7473338 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473338_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.829 33.0 33.0 34.0 31.0 34.0 2 32.24075 33.0 33.0 34.0 31.0 34.0 3 32.19025 34.0 33.0 34.0 32.0 34.0 4 32.09575 34.0 33.0 34.0 32.0 34.0 5 32.13375 34.0 33.0 34.0 32.0 34.0 6 36.42975 38.0 38.0 38.0 35.0 38.0 7 36.6495 38.0 38.0 38.0 36.0 38.0 8 36.795 38.0 38.0 38.0 35.0 38.0 9 36.985 38.0 38.0 38.0 36.0 38.0 10-14 37.0283 38.0 38.0 38.0 36.6 38.0 15-19 36.79605 38.0 38.0 38.0 36.4 38.0 20-24 36.3061 38.0 38.0 38.0 35.4 38.0 25-29 36.55264999999999 38.0 38.0 38.0 35.8 38.0 30-34 36.65985 38.0 38.0 38.0 36.0 38.0 35-39 36.5544 38.0 38.0 38.0 36.0 38.0 40-44 36.6715 38.0 38.0 38.0 36.0 38.0 45-49 36.464800000000004 38.0 38.0 38.0 35.8 38.0 50-54 36.5162 38.0 38.0 38.0 35.4 38.0 55-59 36.5346 38.0 38.0 38.0 35.4 38.0 60-64 36.3334 38.0 38.0 38.0 34.8 38.0 65-69 36.0107 38.0 38.0 38.0 33.8 38.0 70-74 36.179700000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.14465 38.0 38.0 38.0 34.0 38.0 80-84 36.13875 38.0 38.0 38.0 34.0 38.0 85-89 35.9995 38.0 38.0 38.0 33.8 38.0 90-94 35.6657 38.0 38.0 38.0 32.8 38.0 95-99 35.2163 38.0 37.2 38.0 30.8 38.0 100-104 34.7577 38.0 37.0 38.0 27.6 38.0 105-109 34.631299999999996 38.0 36.2 38.0 27.2 38.0 110-114 34.3172 38.0 35.8 38.0 24.6 38.0 115-119 33.96464999999999 38.0 35.0 38.0 22.2 38.0 120-124 33.82995 38.0 35.0 38.0 21.4 38.0 125-129 33.608349999999994 38.0 35.0 38.0 20.0 38.0 130-134 32.82315 38.0 33.8 38.0 13.8 38.0 135-139 32.537850000000006 38.0 33.4 38.0 13.4 38.0 140-144 31.939900000000005 38.0 32.4 38.0 12.6 38.0 145-149 30.603999999999996 38.0 30.8 38.0 2.0 38.0 150-151 24.8645 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 16.0 4 20.0 5 2.0 6 3.0 7 2.0 8 3.0 9 3.0 10 4.0 11 1.0 12 5.0 13 7.0 14 10.0 15 7.0 16 11.0 17 10.0 18 7.0 19 8.0 20 12.0 21 16.0 22 20.0 23 26.0 24 29.0 25 22.0 26 30.0 27 33.0 28 35.0 29 44.0 30 56.0 31 61.0 32 85.0 33 112.0 34 176.0 35 306.0 36 662.0 37 2147.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.6903592659602 19.643318686999226 10.59705350219695 28.069268544843627 2 30.36261491317671 22.26762002042901 26.327885597548516 21.04187946884576 3 25.461538461538463 23.794871794871796 27.333333333333332 23.410256410256412 4 27.51540041067762 30.67248459958932 18.83983572895277 22.972279260780287 5 28.4688381636317 32.880225698897156 18.055911772249296 20.59502436522185 6 23.323170731707318 34.27337398373984 18.851626016260163 23.551829268292682 7 21.630489651691065 17.79404341241797 35.94144371529531 24.634023220595658 8 23.727113117632307 21.62026586405819 24.078254326561325 30.574366691748185 9 25.45 21.6 23.7 29.25 10-14 26.224999999999998 24.895 22.435 26.445 15-19 25.85964206716268 24.3464709430927 23.818620550975268 25.975266438769356 20-24 26.289237668161437 25.050958010599267 23.048308194048104 25.611496127191195 25-29 25.539022168235654 24.56726389310659 23.93460876606944 25.95910517258832 30-34 26.30120421222351 24.73421675820023 23.640852521791704 25.32372650778455 35-39 25.976394306266148 24.14264728230586 23.84884251051112 26.032115900916875 40-44 26.512375119232896 24.48918118379437 23.590541693860136 25.407902003112603 45-49 26.748136504234065 24.405456112773187 23.54343086050403 25.30297652248872 50-54 26.851151771762687 25.42970915872776 23.18665255305207 24.53248651645748 55-59 26.75724456031284 24.536247869246967 23.698987265617166 25.00752030482302 60-64 26.320830812663843 24.490824763057066 23.56825972978423 25.62008469449486 65-69 27.330013212724868 24.22502286817766 23.39160483789003 25.05335908120744 70-74 26.58234226970369 24.092924813545654 23.861116710340657 25.463616206410002 75-79 26.640558317015618 24.094994226038057 24.07993171662399 25.18451574032234 80-84 26.67771750050231 24.588105284307815 23.573437813944143 25.16073940124573 85-89 26.361491743211364 24.288510766450834 23.565728053004065 25.784269437333734 90-94 26.025459688826025 24.893917963224894 24.196807435845624 24.883814912103457 95-99 26.91168963757019 24.828994384890247 23.20061255742726 25.058703420112305 100-104 27.267582445850696 24.23213458867109 23.892576014817102 24.60770695066111 105-109 26.37633525061627 24.815119145439606 23.649342645850453 25.159202958093672 110-114 26.872427983539094 25.390946502057616 23.287037037037038 24.449588477366255 115-119 26.836682122617205 25.270479134466772 23.34363730036064 24.549201442555386 120-124 27.1854134565999 25.017976373908578 24.021571648690294 23.775038520801235 125-129 27.07937323400976 25.26072437708708 23.39070125866941 24.269201130233753 130-134 26.957327430895145 25.104236372059507 23.52396149688578 24.414474700159573 135-139 27.375184864093015 25.503595287878017 23.611606915192006 23.509612932836962 140-144 27.560256279873897 25.10424082172277 24.29065392047188 23.044848977931455 145-149 28.02964477383082 25.39739330437005 23.542039355992845 23.030922565806286 150-151 27.12303902502269 26.65629456761312 22.805652793984184 23.415013613380008 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 1.0 8 2.5 9 3.0 10 2.0 11 3.5 12 3.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.5 18 1.5 19 2.5 20 1.5 21 3.0 22 3.5 23 2.0 24 2.0 25 1.5 26 2.5 27 6.0 28 7.5 29 6.5 30 7.0 31 7.5 32 11.0 33 16.0 34 21.5 35 31.0 36 44.5 37 48.0 38 56.5 39 74.0 40 86.5 41 112.0 42 133.5 43 146.0 44 157.0 45 164.5 46 157.5 47 165.0 48 164.0 49 136.0 50 130.0 51 141.0 52 135.0 53 124.5 54 114.5 55 106.0 56 108.5 57 101.0 58 103.5 59 104.5 60 98.0 61 98.5 62 100.0 63 95.5 64 84.0 65 75.0 66 72.0 67 71.0 68 69.0 69 61.5 70 48.0 71 41.5 72 36.0 73 26.0 74 17.5 75 11.5 76 9.5 77 6.5 78 4.5 79 2.5 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 2.1 3 2.5 4 2.6 5 2.5250000000000004 6 1.6 7 0.95 8 0.325 9 0.0 10-14 0.0 15-19 0.54 20-24 1.8800000000000001 25-29 1.21 30-34 0.765 35-39 1.295 40-44 0.40499999999999997 45-49 1.395 50-54 0.8049999999999999 55-59 0.27 60-64 0.8200000000000001 65-69 1.6099999999999999 70-74 0.7799999999999999 75-79 0.415 80-84 0.45999999999999996 85-89 0.385 90-94 1.02 95-99 2.0500000000000003 100-104 2.815 105-109 2.64 110-114 2.8000000000000003 115-119 2.9499999999999997 120-124 2.65 125-129 2.675 130-134 2.8649999999999998 135-139 1.955 140-144 1.67 145-149 2.175 150-151 3.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65139949109415 96.925 2 1.0432569974554706 2.0500000000000003 3 0.2544529262086514 0.75 4 0.02544529262086514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02544529262086514 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.15 0.0 0.0 0.0 0.0 130-131 3.475 0.0 0.0 0.0 0.0 132-133 3.9000000000000004 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.5 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGCT 10 0.0068507707 144.83545 1 GACTCGG 10 0.0068507707 144.83545 4 AGAGCGT 55 2.679145E-4 53.34266 145 >>END_MODULE Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110185 spots for SRR7473338.sra Written 1110185 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra Read 1110169 spots for SRR7473338.sra Written 1110169 spots for SRR7473338.sra SRR ids: ['SRR7473338.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_px2ez6bk SRR7473338.sra spots: 22203396 blocks: [[1, 1110169], [1110170, 2220338], [2220339, 3330507], [3330508, 4440676], [4440677, 5550845], [5550846, 6661014], [6661015, 7771183], [7771184, 8881352], [8881353, 9991521], [9991522, 11101690], [11101691, 12211859], [12211860, 13322028], [13322029, 14432197], [14432198, 15542366], [15542367, 16652535], [16652536, 17762704], [17762705, 18872873], [18872874, 19983042], [19983043, 21093211], [21093212, 22203396]] SRR7473338 file size 7502301 SRR7473338 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473338 SRR7473338_1.fastq SRR7473338_2.fastq Input file: SRR7473338_1.fastq Paired file: SRR7473338_2.fastq trimmed: SRR7473338-trimmed-pair1.fastq, SRR7473338-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:03:33 2024 >> started Sat Dec 7 14:04:01 2024 >> done (27.702s) 22203396 read pairs processed; of these: 37936 ( 0.17%) short read pairs filtered out after trimming by size control 57565 ( 0.26%) empty read pairs filtered out after trimming by size control 22107895 (99.57%) read pairs available; of these: 12831825 (58.04%) trimmed read pairs available after processing 9276070 (41.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 19 0.00% 20 20 0.00% 21 23 0.00% 22 24 0.00% 23 21 0.00% 24 19 0.00% 25 25 0.00% 26 17 0.00% 27 26 0.00% 28 33 0.00% 29 28 0.00% 30 40 0.00% 31 39 0.00% 32 31 0.00% 33 41 0.00% 34 54 0.00% 35 27 0.00% 36 49 0.00% 37 45 0.00% 38 61 0.00% 39 56 0.00% 40 58 0.00% 41 80 0.00% 42 81 0.00% 43 69 0.00% 44 91 0.00% 45 99 0.00% 46 112 0.00% 47 113 0.00% 48 146 0.00% 49 173 0.00% 50 172 0.00% 51 213 0.00% 52 253 0.00% 53 237 0.00% 54 254 0.00% 55 303 0.00% 56 307 0.00% 57 392 0.00% 58 444 0.00% 59 440 0.00% 60 565 0.00% 61 610 0.00% 62 705 0.00% 63 780 0.00% 64 800 0.00% 65 1000 0.00% 66 1085 0.00% 67 1328 0.01% 68 1940 0.01% 69 3006 0.01% 70 2653 0.01% 71 2174 0.01% 72 2269 0.01% 73 2422 0.01% 74 2572 0.01% 75 3038 0.01% 76 3034 0.01% 77 3339 0.02% 78 3715 0.02% 79 4252 0.02% 80 4651 0.02% 81 5319 0.02% 82 6217 0.03% 83 7102 0.03% 84 8902 0.04% 85 9843 0.04% 86 10153 0.05% 87 10691 0.05% 88 11077 0.05% 89 11496 0.05% 90 12348 0.06% 91 13444 0.06% 92 14238 0.06% 93 15468 0.07% 94 16958 0.08% 95 17716 0.08% 96 18146 0.08% 97 18380 0.08% 98 18991 0.09% 99 19565 0.09% 100 21089 0.10% 101 22132 0.10% 102 23261 0.11% 103 25158 0.11% 104 26731 0.12% 105 28691 0.13% 106 29724 0.13% 107 29947 0.14% 108 30779 0.14% 109 32986 0.15% 110 33753 0.15% 111 34499 0.16% 112 36914 0.17% 113 39486 0.18% 114 41629 0.19% 115 43451 0.20% 116 45312 0.20% 117 45980 0.21% 118 46950 0.21% 119 48100 0.22% 120 50381 0.23% 121 51997 0.24% 122 55397 0.25% 123 57731 0.26% 124 62428 0.28% 125 63692 0.29% 126 66486 0.30% 127 68910 0.31% 128 70247 0.32% 129 73311 0.33% 130 76127 0.34% 131 79066 0.36% 132 84843 0.38% 133 88041 0.40% 134 94815 0.43% 135 101237 0.46% 136 107994 0.49% 137 115504 0.52% 138 123191 0.56% 139 131180 0.59% 140 142294 0.64% 141 158596 0.72% 142 177862 0.80% 143 203581 0.92% 144 240699 1.09% 145 296671 1.34% 146 372330 1.68% 147 509316 2.30% 148 788310 3.57% 149 1473822 6.67% 150 5862452 26.52% 151 9276070 41.96% 22107895 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.89 prefix-fanout=2.0 sequence=GGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=87.34 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=10.3 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=27 prefix-density=1.02 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=95.44 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.9 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7473338 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:04:42 Started mapping on | Dec 07 14:04:43 Finished on | Dec 07 14:08:33 Mapping speed, Million of reads per hour | 346.04 Number of input reads | 22107895 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 20879066 Uniquely mapped reads % | 94.44% Average mapped length | 292.98 Number of splices: Total | 22954340 Number of splices: Annotated (sjdb) | 21562776 Number of splices: GT/AG | 22646729 Number of splices: GC/AG | 275547 Number of splices: AT/AC | 10366 Number of splices: Non-canonical | 21698 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 176358 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 16642 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1073580 1073580 1073580 N_multimapping 176358 176358 176358 N_noFeature 731970 20185375 925792 N_ambiguous 593496 3752 93956 UnstrandedReadsAssigned:19553600 PositiveStrandReadsAssigned:689939 NegativeStrandReadsAssigned:19859318 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473338 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473338-trimmed-pair1.fastq SRR7473338-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,107,895 reads, 19,936,797 reads pseudoaligned [quant] estimated average fragment length: 281.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR7473338.ke.tsv 35125 SRR7473338.se.tsv 88098 total ==> SRR7473338.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.381 0 0 PNS24247 1044 763.371 41.3872 3.40952 PNS24249 1928 1647.37 62.2669 2.377 PNS24246 1044 763.371 41.3872 3.40952 PNS24248 1044 763.371 41.3872 3.40952 PNS24244 1471 1190.37 78.5714 4.15092 PNS24243 293 90.9029 0 0 KQK14069 1603 1322.37 2556.18 121.563 KQK14071 474 223.636 45.1538 12.6974 ==> SRR7473338.se.tsv <== BRADI_1g14170v3 2777 BRADI_1g53295v3 333 BRADI_1g59795v3 939 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1276 BRADI_1g74790v3 312 BRADI_1g09890v3 0 BRADI_1g77505v3 273 BRADI_1g48960v3 0 SRR7473338 completed mapping pipeline successfully