Starting /dee2/code/volunteer_pipeline.sh SRR7473339 current disk space = 1543205322752 free memory = 1591299896 SRR7473339 SRAfilesize a6ced233cd18638fcc54b8b072537e0e SRR7473339.sra SRR7473339.sra file validated SRR7473339 is paired end SRR7473339 is conventional basespace SRR7473339 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473339_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.42725 34.0 33.0 34.0 33.0 34.0 2 33.478 34.0 34.0 34.0 33.0 34.0 3 33.511 34.0 34.0 34.0 33.0 34.0 4 33.4465 34.0 34.0 34.0 33.0 34.0 5 33.46375 34.0 34.0 34.0 33.0 34.0 6 37.0845 38.0 38.0 38.0 36.0 38.0 7 37.36725 38.0 38.0 38.0 37.0 38.0 8 37.45075 38.0 38.0 38.0 37.0 38.0 9 37.49775 38.0 38.0 38.0 37.0 38.0 10-14 37.466449999999995 38.0 38.0 38.0 37.6 38.0 15-19 37.3701 38.0 38.0 38.0 37.0 38.0 20-24 37.480549999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.41335 38.0 38.0 38.0 37.0 38.0 30-34 37.0986 38.0 38.0 38.0 36.4 38.0 35-39 37.04285 38.0 38.0 38.0 36.0 38.0 40-44 36.9394 38.0 38.0 38.0 35.6 38.0 45-49 36.8679 38.0 38.0 38.0 35.2 38.0 50-54 36.829499999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.877750000000006 38.0 38.0 38.0 35.2 38.0 60-64 36.86835 38.0 38.0 38.0 35.4 38.0 65-69 36.6032 38.0 38.0 38.0 34.2 38.0 70-74 36.4351 38.0 38.0 38.0 33.8 38.0 75-79 36.5463 38.0 38.0 38.0 34.0 38.0 80-84 36.51375 38.0 38.0 38.0 34.0 38.0 85-89 36.36755 38.0 37.8 38.0 33.8 38.0 90-94 36.127199999999995 38.0 37.0 38.0 33.2 38.0 95-99 35.82985 38.0 37.0 38.0 31.6 38.0 100-104 35.6393 38.0 36.2 38.0 31.0 38.0 105-109 35.4743 38.0 36.0 38.0 30.4 38.0 110-114 35.21925 38.0 35.8 38.0 29.4 38.0 115-119 34.8335 38.0 35.0 38.0 27.4 38.0 120-124 34.4165 38.0 34.8 38.0 25.4 38.0 125-129 34.18515 38.0 34.4 38.0 24.6 38.0 130-134 33.68209999999999 38.0 34.0 38.0 22.2 38.0 135-139 33.1036 38.0 33.4 38.0 17.4 38.0 140-144 32.4946 37.4 32.8 38.0 14.2 38.0 145-149 31.19285 36.0 31.2 38.0 11.0 38.0 150-151 26.101625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 2.0 13 0.0 14 2.0 15 1.0 16 2.0 17 3.0 18 4.0 19 9.0 20 9.0 21 15.0 22 13.0 23 17.0 24 12.0 25 20.0 26 22.0 27 35.0 28 41.0 29 51.0 30 49.0 31 66.0 32 106.0 33 143.0 34 212.0 35 402.0 36 977.0 37 1785.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.44044044044044 13.763763763763764 10.31031031031031 35.48548548548548 2 25.55 17.175 32.175 25.1 3 20.775 23.400000000000002 25.224999999999998 30.599999999999998 4 25.3 29.549999999999997 21.875 23.275000000000002 5 24.680531195189175 31.27035830618892 22.876472062139815 21.172638436482085 6 21.95 33.0 22.925 22.125 7 17.775 19.925 41.65 20.65 8 22.075 22.425 28.075 27.425 9 20.150000000000002 20.175 31.424999999999997 28.249999999999996 10-14 23.535 25.124999999999996 24.865000000000002 26.474999999999998 15-19 23.175 25.205 25.430000000000003 26.19 20-24 22.795 25.545 25.674999999999997 25.985000000000003 25-29 23.36 24.965 25.795 25.88 30-34 22.79 25.619999999999997 25.145 26.445 35-39 23.81571707268271 24.91621229553299 25.44645090290631 25.82161972887799 40-44 23.405 25.335 25.240000000000002 26.02 45-49 23.47 24.555 25.85 26.125 50-54 23.13 25.415 24.97 26.484999999999996 55-59 23.47 24.779999999999998 25.515 26.235000000000003 60-64 23.785 24.779999999999998 25.264999999999997 26.169999999999998 65-69 23.865 25.264999999999997 25.224999999999998 25.645 70-74 23.745 25.319999999999997 24.865000000000002 26.07 75-79 24.02 25.085 25.14 25.755 80-84 23.630000000000003 24.675 26.009999999999998 25.685000000000002 85-89 23.849999999999998 24.81 24.9 26.44 90-94 23.845 24.79 25.119999999999997 26.245 95-99 23.809761952390478 25.155031006201238 25.065013002600523 25.970194038807758 100-104 24.44 24.75 25.169999999999998 25.64 105-109 23.625 24.635 24.84 26.900000000000002 110-114 23.995 24.48 25.05 26.474999999999998 115-119 23.830000000000002 25.36 24.555 26.255 120-124 24.46 25.005 24.490000000000002 26.045 125-129 23.810000000000002 24.575 25.205 26.41 130-134 24.17230152767343 25.118958176809414 24.768344603055347 25.94039569246181 135-139 24.119471683009806 25.135081048629175 24.734840904542725 26.01060636381829 140-144 24.3 24.91 24.15 26.640000000000004 145-149 23.91075984192887 25.28637887049172 24.38597368815967 26.41688759941974 150-151 23.327875047235167 24.72603602468825 24.801612293739765 27.14447663433682 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 2.5 26 1.5 27 1.5 28 2.5 29 4.0 30 8.0 31 11.0 32 15.0 33 26.0 34 33.0 35 34.0 36 51.0 37 66.5 38 78.0 39 103.0 40 112.0 41 132.5 42 157.5 43 164.0 44 174.0 45 189.5 46 206.5 47 191.0 48 172.0 49 170.5 50 167.0 51 148.5 52 133.5 53 127.5 54 118.5 55 106.0 56 91.5 57 99.5 58 98.0 59 85.5 60 85.0 61 85.0 62 78.5 63 60.5 64 52.0 65 52.5 66 51.0 67 48.0 68 42.5 69 37.5 70 30.5 71 20.5 72 13.5 73 15.0 74 12.0 75 8.5 76 9.0 77 5.5 78 2.5 79 2.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.17500000000000002 135-139 0.06 140-144 0.0 145-149 0.045 150-151 0.7625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06636386575826 98.15 2 0.9336361342417362 1.8499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGATC 10 0.0064271726 147.9359 1 TCGGCCA 10 0.0069393674 144.2375 6 GATCGGC 10 0.0069393674 144.2375 4 ATCGGCC 10 0.0069393674 144.2375 5 CGGCCAC 10 0.0069393674 144.2375 7 GTGAAAG 10 0.0069393674 144.2375 5 CGATCGG 10 0.0069393674 144.2375 3 >>END_MODULE SRR7473339 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473339_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0475 33.0 33.0 34.0 32.0 34.0 2 32.424 34.0 33.0 34.0 32.0 34.0 3 32.28675 34.0 33.0 34.0 32.0 34.0 4 32.307 34.0 33.0 34.0 32.0 34.0 5 32.32825 34.0 33.0 34.0 32.0 34.0 6 36.59775 38.0 38.0 38.0 36.0 38.0 7 36.7655 38.0 38.0 38.0 36.0 38.0 8 36.807 38.0 38.0 38.0 36.0 38.0 9 36.9085 38.0 38.0 38.0 36.0 38.0 10-14 36.988600000000005 38.0 38.0 38.0 36.6 38.0 15-19 36.81505 38.0 38.0 38.0 36.0 38.0 20-24 36.47765 38.0 38.0 38.0 35.8 38.0 25-29 36.668499999999995 38.0 38.0 38.0 36.0 38.0 30-34 36.737849999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.66565000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.7736 38.0 38.0 38.0 36.0 38.0 45-49 36.5585 38.0 38.0 38.0 36.0 38.0 50-54 36.587650000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.56314999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.398999999999994 38.0 38.0 38.0 34.6 38.0 65-69 36.1032 38.0 38.0 38.0 34.0 38.0 70-74 36.24175 38.0 38.0 38.0 34.0 38.0 75-79 36.2957 38.0 38.0 38.0 34.0 38.0 80-84 36.23355 38.0 38.0 38.0 34.2 38.0 85-89 36.022600000000004 38.0 38.0 38.0 34.0 38.0 90-94 35.7598 38.0 38.0 38.0 32.6 38.0 95-99 35.3986 38.0 37.8 38.0 31.2 38.0 100-104 34.883250000000004 38.0 37.0 38.0 28.2 38.0 105-109 34.7323 38.0 37.0 38.0 27.0 38.0 110-114 34.458 38.0 36.0 38.0 25.0 38.0 115-119 34.1385 38.0 35.4 38.0 23.2 38.0 120-124 34.158249999999995 38.0 35.2 38.0 23.0 38.0 125-129 33.83605 38.0 35.0 38.0 21.0 38.0 130-134 33.0347 38.0 33.8 38.0 14.2 38.0 135-139 32.785849999999996 38.0 33.4 38.0 13.4 38.0 140-144 32.15885 38.0 33.0 38.0 12.6 38.0 145-149 30.97135 38.0 31.2 38.0 4.2 38.0 150-151 25.306875 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 11.0 4 12.0 5 2.0 6 1.0 7 2.0 8 1.0 9 4.0 10 0.0 11 3.0 12 7.0 13 7.0 14 6.0 15 10.0 16 12.0 17 9.0 18 8.0 19 11.0 20 16.0 21 19.0 22 21.0 23 31.0 24 32.0 25 26.0 26 35.0 27 31.0 28 35.0 29 44.0 30 40.0 31 63.0 32 71.0 33 103.0 34 156.0 35 277.0 36 621.0 37 2264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.471915875865605 18.286740189792255 11.464478071300334 29.776865863041806 2 31.013462026924053 20.980441960883923 27.30505461010922 20.701041402082804 3 24.43991853360489 26.14562118126273 25.35641547861507 24.058044806517312 4 26.43239113827349 33.409727527374585 18.207282913165265 21.95059842118666 5 27.168659374205035 31.925718646654794 19.30806410582549 21.59755787331468 6 23.302196415046705 34.13279474880081 19.010350921484473 23.554657914668013 7 22.79116465863454 17.82128514056225 34.66365461847389 24.723895582329316 8 24.61230615307654 22.26113056528264 22.686343171585793 30.440220110055026 9 23.275000000000002 21.95 25.900000000000002 28.875 10-14 26.0 24.62 23.275000000000002 26.105 15-19 26.420013034541533 24.695442923747933 23.677746026971473 25.206798014739057 20-24 26.35811836115326 24.86595852301467 24.10217501264542 24.673748103186647 25-29 26.671698113207547 24.58364779874214 23.456603773584906 25.28805031446541 30-34 26.64125583028236 24.830733737900594 23.677215507297255 24.850794924519786 35-39 26.43475634313331 25.352396294804674 23.18264196536448 25.030205396697543 40-44 26.74377847879425 25.01126633618747 23.63927695157979 24.605678233438486 45-49 26.685152508192587 24.64834887824553 23.488782455255862 25.177716158306023 50-54 26.64894417414857 24.79309825951748 23.960475497818127 24.597482068515824 55-59 26.576576576576578 25.025025025025027 23.4984984984985 24.8998998998999 60-64 26.10244318466864 25.194401244167963 24.085687051622937 24.617468519540463 65-69 26.356980560464528 24.236303963645543 24.63519313304721 24.771522342842715 70-74 26.475751040674055 23.822659110286374 24.805657254626613 24.895932594412958 75-79 26.558509839266936 24.365329728105753 24.034850533273246 25.041309899354065 80-84 25.876051261513815 25.100120144173005 24.148978774529436 24.87484981978374 85-89 26.948295710496023 24.410631162720854 23.66484809049502 24.976225036288103 90-94 26.620440156768165 25.404481961611896 23.776504873882022 24.198573007737917 95-99 26.547371622649163 24.69711562832666 24.413240736047044 24.342272012977137 100-104 26.73979591836735 24.744897959183675 23.74489795918367 24.770408163265305 105-109 26.708770500152795 25.08403789345014 23.978812264439238 24.22837934195783 110-114 26.995305164319248 25.25005103082262 23.70381710553174 24.050826699326393 115-119 27.14723926380368 25.65950920245399 23.44069529652352 23.752556237218812 120-124 26.79262578936647 24.602770421674474 24.205540843348953 24.399062945610105 125-129 26.098257058403835 25.28284578534298 24.161655284884315 24.457241871368872 130-134 27.412930242059037 24.834031253191707 23.97099376978858 23.782044734960678 135-139 26.892884274499874 25.039250443150163 24.64927829830337 23.418586984046595 140-144 27.468309681329227 25.877480935306295 23.81192869047018 22.8422806928943 145-149 27.801713214050384 25.449845405241017 23.919103857265952 22.829337523442646 150-151 27.474929287734636 25.867832347647212 23.65646695808691 23.000771406531243 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 3.5 22 4.0 23 2.0 24 2.0 25 2.0 26 2.0 27 3.5 28 4.0 29 5.0 30 7.0 31 8.5 32 13.5 33 21.0 34 24.5 35 29.5 36 36.0 37 51.5 38 70.5 39 82.0 40 95.0 41 118.5 42 131.0 43 131.0 44 151.5 45 157.5 46 159.0 47 169.5 48 162.5 49 161.0 50 159.5 51 151.0 52 143.0 53 123.0 54 108.0 55 115.5 56 113.0 57 108.0 58 111.0 59 96.0 60 97.0 61 99.0 62 91.0 63 91.5 64 81.0 65 74.0 66 75.5 67 74.0 68 64.5 69 48.0 70 41.0 71 33.5 72 24.0 73 18.0 74 11.0 75 10.5 76 9.0 77 4.5 78 1.0 79 2.5 80 2.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5250000000000004 2 1.575 3 1.7999999999999998 4 1.825 5 1.725 6 0.975 7 0.4 8 0.05 9 0.0 10-14 0.0 15-19 0.265 20-24 1.15 25-29 0.625 30-34 0.305 35-39 0.6799999999999999 40-44 0.145 45-49 0.8250000000000001 50-54 0.315 55-59 0.1 60-64 0.335 65-69 0.975 70-74 0.305 75-79 0.145 80-84 0.12 85-89 0.105 90-94 0.49 95-99 1.365 100-104 2.0 105-109 1.83 110-114 2.02 115-119 2.1999999999999997 120-124 1.82 125-129 1.8900000000000001 130-134 2.09 135-139 1.275 140-144 0.9950000000000001 145-149 1.355 150-151 2.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85989359006841 97.55 2 0.9627565239422345 1.9 3 0.15201418799087915 0.44999999999999996 4 0.02533569799847986 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0125 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.0625 0.0 0.0 0.0 0.025 86-87 0.125 0.0 0.0 0.0 0.025 88-89 0.175 0.0 0.0 0.0 0.025 90-91 0.1875 0.0 0.0 0.0 0.025 92-93 0.32499999999999996 0.0 0.0 0.0 0.025 94-95 0.4375 0.0 0.0 0.0 0.025 96-97 0.5125 0.0 0.0 0.0 0.025 98-99 0.5625 0.0 0.0 0.0 0.025 100-101 0.5874999999999999 0.0 0.0 0.0 0.025 102-103 0.6375 0.0 0.0 0.0 0.025 104-105 0.75 0.0 0.0 0.0 0.025 106-107 0.9375 0.0 0.0 0.0 0.025 108-109 1.175 0.0 0.0 0.0 0.025 110-111 1.3125 0.0 0.0 0.0 0.025 112-113 1.475 0.0 0.0 0.0 0.025 114-115 1.7625 0.0 0.0 0.0 0.025 116-117 1.9625 0.0 0.0 0.0 0.025 118-119 2.25 0.0 0.0 0.0 0.025 120-121 2.5375 0.0 0.0 0.0 0.025 122-123 2.75 0.0 0.0 0.0 0.025 124-125 3.075 0.0 0.0 0.0 0.025 126-127 3.3875 0.0 0.0 0.0 0.025 128-129 3.7625 0.0 0.0 0.0 0.025 130-131 4.15 0.0 0.0 0.0 0.025 132-133 4.5 0.0 0.0 0.0 0.025 134-135 4.7875 0.0 0.0 0.0 0.025 136-137 5.2625 0.0 0.0 0.0 0.025 138-139 5.7875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACATG 10 0.0067716585 145.35065 2 >>END_MODULE Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063045 spots for SRR7473339.sra Written 1063045 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra Read 1063032 spots for SRR7473339.sra Written 1063032 spots for SRR7473339.sra SRR ids: ['SRR7473339.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2k7ob44k SRR7473339.sra spots: 21260653 blocks: [[1, 1063032], [1063033, 2126064], [2126065, 3189096], [3189097, 4252128], [4252129, 5315160], [5315161, 6378192], [6378193, 7441224], [7441225, 8504256], [8504257, 9567288], [9567289, 10630320], [10630321, 11693352], [11693353, 12756384], [12756385, 13819416], [13819417, 14882448], [14882449, 15945480], [15945481, 17008512], [17008513, 18071544], [18071545, 19134576], [19134577, 20197608], [20197609, 21260653]] SRR7473339 file size 7182837 SRR7473339 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473339 SRR7473339_1.fastq SRR7473339_2.fastq Input file: SRR7473339_1.fastq Paired file: SRR7473339_2.fastq trimmed: SRR7473339-trimmed-pair1.fastq, SRR7473339-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:03:04 2024 >> started Sat Dec 7 14:03:29 2024 >> done (25.424s) 21260653 read pairs processed; of these: 35448 ( 0.17%) short read pairs filtered out after trimming by size control 51106 ( 0.24%) empty read pairs filtered out after trimming by size control 21174099 (99.59%) read pairs available; of these: 12230802 (57.76%) trimmed read pairs available after processing 8943297 (42.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 21 0.00% 20 17 0.00% 21 16 0.00% 22 22 0.00% 23 23 0.00% 24 22 0.00% 25 19 0.00% 26 21 0.00% 27 29 0.00% 28 39 0.00% 29 26 0.00% 30 33 0.00% 31 30 0.00% 32 28 0.00% 33 42 0.00% 34 42 0.00% 35 41 0.00% 36 44 0.00% 37 43 0.00% 38 66 0.00% 39 39 0.00% 40 67 0.00% 41 55 0.00% 42 66 0.00% 43 94 0.00% 44 84 0.00% 45 86 0.00% 46 83 0.00% 47 119 0.00% 48 132 0.00% 49 144 0.00% 50 128 0.00% 51 169 0.00% 52 186 0.00% 53 191 0.00% 54 221 0.00% 55 265 0.00% 56 280 0.00% 57 296 0.00% 58 329 0.00% 59 384 0.00% 60 423 0.00% 61 464 0.00% 62 513 0.00% 63 624 0.00% 64 705 0.00% 65 741 0.00% 66 858 0.00% 67 1030 0.00% 68 1457 0.01% 69 2071 0.01% 70 1927 0.01% 71 1604 0.01% 72 1629 0.01% 73 1758 0.01% 74 1849 0.01% 75 2089 0.01% 76 2259 0.01% 77 2484 0.01% 78 2762 0.01% 79 3204 0.02% 80 3465 0.02% 81 4032 0.02% 82 4589 0.02% 83 5257 0.02% 84 6771 0.03% 85 7510 0.04% 86 7852 0.04% 87 8121 0.04% 88 8801 0.04% 89 9046 0.04% 90 9848 0.05% 91 10747 0.05% 92 11620 0.05% 93 12749 0.06% 94 13716 0.06% 95 14645 0.07% 96 15339 0.07% 97 15572 0.07% 98 16170 0.08% 99 17054 0.08% 100 18439 0.09% 101 19285 0.09% 102 20473 0.10% 103 22372 0.11% 104 23690 0.11% 105 25408 0.12% 106 26753 0.13% 107 27520 0.13% 108 28409 0.13% 109 29909 0.14% 110 30918 0.15% 111 31789 0.15% 112 33821 0.16% 113 36719 0.17% 114 37870 0.18% 115 40261 0.19% 116 42507 0.20% 117 42676 0.20% 118 44152 0.21% 119 45411 0.21% 120 47335 0.22% 121 49470 0.23% 122 51730 0.24% 123 54631 0.26% 124 58785 0.28% 125 60513 0.29% 126 62720 0.30% 127 65360 0.31% 128 67194 0.32% 129 69793 0.33% 130 72324 0.34% 131 75742 0.36% 132 80518 0.38% 133 84580 0.40% 134 90533 0.43% 135 97006 0.46% 136 103721 0.49% 137 109773 0.52% 138 117013 0.55% 139 126033 0.60% 140 136145 0.64% 141 150383 0.71% 142 170454 0.81% 143 194739 0.92% 144 230417 1.09% 145 282402 1.33% 146 357648 1.69% 147 487942 2.30% 148 755570 3.57% 149 1417587 6.69% 150 5636949 26.62% 151 8943297 42.24% 21174099 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=34 prefix-density=0.69 prefix-fanout=2.0 sequence=GGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=383.62 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.2 sequence=TCTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=27 prefix-density=0.78 prefix-fanout=2.2 sequence=CTCAAGTCCACCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=121.64 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGA SRR7473339 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:04:18 Started mapping on | Dec 07 14:04:18 Finished on | Dec 07 14:08:38 Mapping speed, Million of reads per hour | 293.18 Number of input reads | 21174099 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19769572 Uniquely mapped reads % | 93.37% Average mapped length | 293.27 Number of splices: Total | 21546339 Number of splices: Annotated (sjdb) | 20331926 Number of splices: GT/AG | 21272427 Number of splices: GC/AG | 243365 Number of splices: AT/AC | 10857 Number of splices: Non-canonical | 19690 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169139 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 14728 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.29% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1254354 1254354 1254354 N_multimapping 169139 169139 169139 N_noFeature 660035 19087088 887366 N_ambiguous 536073 3003 82636 UnstrandedReadsAssigned:18573464 PositiveStrandReadsAssigned:679481 NegativeStrandReadsAssigned:18799570 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473339 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473339-trimmed-pair1.fastq SRR7473339-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,174,099 reads, 18,875,245 reads pseudoaligned [quant] estimated average fragment length: 276.305 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR7473339.ke.tsv 35125 SRR7473339.se.tsv 88098 total ==> SRR7473339.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.479 12.2233 1.28172 PNS24247 1044 768.695 39.6291 3.57588 PNS24249 1928 1652.69 54.5421 2.28908 PNS24246 1044 768.695 39.6291 3.57588 PNS24248 1044 768.695 39.6291 3.57588 PNS24244 1471 1195.69 93.3475 5.41508 PNS24243 293 89.7486 0 0 KQK14069 1603 1327.69 148.866 7.77715 KQK14071 474 224.274 1.592 0.492365 ==> SRR7473339.se.tsv <== BRADI_1g14170v3 156 BRADI_1g53295v3 390 BRADI_1g59795v3 575 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 1635 BRADI_1g74790v3 142 BRADI_1g09890v3 2 BRADI_1g77505v3 164 BRADI_1g48960v3 0 SRR7473339 completed mapping pipeline successfully