Starting /dee2/code/volunteer_pipeline.sh SRR7473340 current disk space = 1543205126144 free memory = 1606384000 SRR7473340 SRAfilesize 61c6bd2c844cc1dc8cf6412dbc9d2703 SRR7473340.sra SRR7473340.sra file validated SRR7473340 is paired end SRR7473340 is conventional basespace SRR7473340 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473340_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33375 34.0 33.0 34.0 33.0 34.0 2 33.412 34.0 34.0 34.0 33.0 34.0 3 33.468 34.0 34.0 34.0 33.0 34.0 4 33.5045 34.0 34.0 34.0 33.0 34.0 5 33.43575 34.0 34.0 34.0 33.0 34.0 6 37.19175 38.0 38.0 38.0 36.0 38.0 7 37.4445 38.0 38.0 38.0 37.0 38.0 8 37.525 38.0 38.0 38.0 38.0 38.0 9 37.605 38.0 38.0 38.0 38.0 38.0 10-14 37.533699999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.490899999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.52974999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.45845 38.0 38.0 38.0 37.8 38.0 30-34 37.2794 38.0 38.0 38.0 37.0 38.0 35-39 37.16735 38.0 38.0 38.0 36.8 38.0 40-44 36.98795 38.0 38.0 38.0 35.8 38.0 45-49 36.93305 38.0 38.0 38.0 36.0 38.0 50-54 36.97815 38.0 38.0 38.0 35.8 38.0 55-59 37.02645 38.0 38.0 38.0 36.0 38.0 60-64 36.92895 38.0 38.0 38.0 35.8 38.0 65-69 36.78425 38.0 38.0 38.0 35.2 38.0 70-74 36.76135 38.0 38.0 38.0 35.0 38.0 75-79 36.72645 38.0 38.0 38.0 34.8 38.0 80-84 36.7445 38.0 38.0 38.0 35.0 38.0 85-89 36.6308 38.0 38.0 38.0 34.6 38.0 90-94 36.31245 38.0 38.0 38.0 34.0 38.0 95-99 36.14305 38.0 37.2 38.0 33.4 38.0 100-104 36.1116 38.0 37.2 38.0 33.2 38.0 105-109 35.998149999999995 38.0 37.4 38.0 33.2 38.0 110-114 35.615 38.0 36.6 38.0 31.6 38.0 115-119 35.4474 38.0 36.0 38.0 30.6 38.0 120-124 35.16015 38.0 35.8 38.0 28.8 38.0 125-129 34.563 38.0 35.0 38.0 26.6 38.0 130-134 34.1351 38.0 35.0 38.0 24.0 38.0 135-139 33.88695 38.0 34.8 38.0 22.6 38.0 140-144 33.24445000000001 38.0 33.8 38.0 18.6 38.0 145-149 32.57155 38.0 33.6 38.0 11.8 38.0 150-151 28.127875 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 2.0 16 3.0 17 4.0 18 6.0 19 4.0 20 6.0 21 8.0 22 16.0 23 11.0 24 23.0 25 15.0 26 20.0 27 28.0 28 34.0 29 40.0 30 54.0 31 57.0 32 73.0 33 115.0 34 166.0 35 279.0 36 754.0 37 2276.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.56210790464241 12.245922208281055 11.267252195734002 39.924717691342536 2 24.686716791979947 14.360902255639097 33.45864661654135 27.493734335839598 3 21.775 18.875 24.575 34.775 4 26.900000000000002 25.874999999999996 21.175 26.05 5 26.059694005517937 31.050915475294712 22.573363431151243 20.31602708803612 6 21.85 33.275 22.925 21.95 7 17.724999999999998 23.175 39.625 19.475 8 20.849999999999998 22.3 29.025000000000002 27.825 9 19.25 20.65 33.875 26.224999999999998 10-14 22.61 26.715 24.705 25.97 15-19 22.509999999999998 25.045 26.284999999999997 26.16 20-24 22.650000000000002 25.72 25.47 26.16 25-29 22.825 25.974999999999998 25.09 26.11 30-34 23.05 25.81 25.169999999999998 25.97 35-39 22.637450597828806 25.118815348441643 25.824203311821503 26.419530741908048 40-44 23.610415623435152 25.53329994992489 25.15773660490736 25.698547821732596 45-49 23.19239429572179 25.68426319739805 25.313985489116835 25.809357017763325 50-54 23.081154057702886 25.03625181259063 25.6262813140657 26.256312815640783 55-59 23.0 25.55 25.405 26.045 60-64 22.656132806640333 25.256262813140655 25.131256562828142 26.95634781739087 65-69 22.953443016452468 25.173776066409964 25.6888533279992 26.183927589138374 70-74 23.1911595579779 25.11125556277814 25.281264063203164 26.416320816040802 75-79 23.47438975590236 25.215086034413766 25.31512605042017 25.995398159263704 80-84 23.412023607082126 24.852455736721016 25.517655296588977 26.217865359607885 85-89 23.629725945189037 25.02000400080016 24.72994598919784 26.620324064812962 90-94 23.96599149787447 25.2863215803951 24.886221555388847 25.861465366341584 95-99 24.108573717948715 25.030048076923077 24.914863782051285 25.946514423076923 100-104 23.73 25.21 24.81 26.25 105-109 23.484696939387877 24.5999199839968 25.170034006801362 26.74534906981396 110-114 23.50852627894184 25.188778316747513 24.418662799419913 26.884032604890734 115-119 23.95 25.080000000000002 24.975 25.995 120-124 23.78 25.21 24.665 26.345000000000002 125-129 23.951285520974288 25.334536159975947 24.998747055580615 25.715431263469153 130-134 24.398243931977596 24.56476762375738 24.70101428066811 26.33597416359691 135-139 24.263038548752835 25.06424792139078 24.494834971025448 26.17787855883094 140-144 24.268243785084202 25.060144346431436 24.42862870890136 26.242983159582998 145-149 24.25630442442241 25.967685105954597 23.863693562188555 25.91231690743444 150-151 24.804835054142533 25.16998237219844 24.175270712666837 25.849911860992194 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 1.0 28 2.5 29 8.5 30 11.0 31 13.5 32 18.5 33 25.5 34 34.5 35 47.0 36 46.5 37 57.0 38 80.0 39 102.5 40 124.0 41 137.0 42 149.0 43 164.5 44 179.0 45 167.5 46 167.0 47 180.0 48 177.0 49 172.5 50 165.5 51 150.5 52 150.0 53 153.5 54 145.5 55 139.0 56 127.0 57 103.0 58 87.5 59 85.0 60 71.5 61 68.0 62 67.5 63 60.0 64 56.5 65 47.0 66 46.5 67 37.5 68 32.5 69 37.0 70 29.0 71 19.0 72 13.0 73 11.5 74 10.5 75 7.0 76 4.0 77 3.0 78 1.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.25 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.055 40-44 0.15 45-49 0.075 50-54 0.005 55-59 0.0 60-64 0.005 65-69 0.015 70-74 0.005 75-79 0.04 80-84 0.03 85-89 0.02 90-94 0.025 95-99 0.16 100-104 0.0 105-109 0.02 110-114 0.015 115-119 0.0 120-124 0.0 125-129 0.23500000000000001 130-134 0.915 135-139 0.775 140-144 0.24 145-149 0.6649999999999999 150-151 0.7250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93563101875317 97.6 2 0.8616320324379118 1.7000000000000002 3 0.10136847440446022 0.3 4 0.10136847440446022 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.0125000000000002 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.6624999999999996 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.45 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.6625 0.0 0.0 0.0 0.0 138-139 6.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473340 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473340_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.259 33.0 33.0 34.0 32.0 34.0 2 32.40075 33.0 33.0 34.0 32.0 34.0 3 32.2285 34.0 33.0 34.0 32.0 34.0 4 32.386 34.0 33.0 34.0 32.0 34.0 5 32.29375 34.0 33.0 34.0 32.0 34.0 6 36.417 38.0 38.0 38.0 35.0 38.0 7 36.588 38.0 38.0 38.0 36.0 38.0 8 36.67475 38.0 38.0 38.0 36.0 38.0 9 36.74025 38.0 38.0 38.0 36.0 38.0 10-14 36.79155000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.5767 38.0 38.0 38.0 36.0 38.0 20-24 36.41325 38.0 38.0 38.0 35.8 38.0 25-29 36.36525 38.0 38.0 38.0 35.6 38.0 30-34 36.4205 38.0 38.0 38.0 36.0 38.0 35-39 36.42005 38.0 38.0 38.0 36.0 38.0 40-44 36.4393 38.0 38.0 38.0 36.0 38.0 45-49 36.3245 38.0 38.0 38.0 35.4 38.0 50-54 36.390950000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.33665 38.0 38.0 38.0 35.0 38.0 60-64 36.31325 38.0 38.0 38.0 35.0 38.0 65-69 35.96015 38.0 38.0 38.0 34.0 38.0 70-74 36.189099999999996 38.0 38.0 38.0 34.4 38.0 75-79 36.167950000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.05515 38.0 38.0 38.0 34.0 38.0 85-89 35.9576 38.0 38.0 38.0 34.0 38.0 90-94 35.842949999999995 38.0 38.0 38.0 33.6 38.0 95-99 35.49365 38.0 38.0 38.0 32.2 38.0 100-104 34.73565 38.0 37.0 38.0 27.2 38.0 105-109 34.73205 38.0 37.0 38.0 27.2 38.0 110-114 34.48095 38.0 36.2 38.0 25.4 38.0 115-119 34.30309999999999 38.0 35.8 38.0 24.8 38.0 120-124 34.116049999999994 38.0 35.4 38.0 23.0 38.0 125-129 34.0277 38.0 35.6 38.0 22.2 38.0 130-134 33.371249999999996 38.0 34.8 38.0 16.2 38.0 135-139 33.176249999999996 38.0 33.4 38.0 14.8 38.0 140-144 32.44585 38.0 32.8 38.0 13.0 38.0 145-149 31.286099999999998 38.0 31.8 38.0 6.4 38.0 150-151 26.18725 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 24.0 4 14.0 5 3.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 2.0 12 7.0 13 3.0 14 6.0 15 8.0 16 4.0 17 5.0 18 8.0 19 17.0 20 14.0 21 7.0 22 13.0 23 15.0 24 28.0 25 28.0 26 28.0 27 35.0 28 28.0 29 36.0 30 46.0 31 60.0 32 67.0 33 103.0 34 164.0 35 257.0 36 612.0 37 2322.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.70701932858596 17.09053916581892 12.741607324516785 34.46083418107833 2 32.05291274484864 22.004578987534977 26.558127702874586 19.384380564741797 3 22.370104939851547 24.57128231379575 26.59329408753519 26.465318658817505 4 27.434077079107507 29.43711967545639 20.2079107505071 22.920892494929006 5 27.381864623243935 32.23499361430396 19.846743295019156 20.53639846743295 6 22.796739684156904 33.85124808965869 20.86092715231788 22.491085073866532 7 21.388748099341104 18.677141409021793 35.453623922959956 24.480486568677144 8 23.366136765076963 21.12036336109008 23.593237446379007 31.92026242745395 9 24.566255971838068 22.504400301734975 25.119436761377923 27.80990696504903 10-14 26.43649320018066 25.392683294023183 22.54729763637276 25.623525869423396 15-19 25.739614994934147 25.131712259371835 23.682877406281662 25.445795339412356 20-24 26.60261298357989 25.153779675664683 23.43043058309186 24.813176757663566 25-29 26.450728537340712 24.96319236431944 23.66350205615068 24.922577042189165 30-34 26.215515927450085 25.377229080932786 23.20276380633034 25.2044911852868 35-39 26.301328041520378 25.044522464763645 23.818246578130562 24.835902915585407 40-44 26.8598396427484 24.52552522074495 23.50045671369126 25.114178422815385 45-49 26.004788344964595 24.884111863888748 24.216799959248128 24.89429983189853 50-54 26.76598763555285 24.657950744907268 23.882639100030403 24.693422519509475 55-59 26.57739906674782 25.441265976871573 23.463177115033478 24.51815784134713 60-64 26.931276012587556 24.459445741549082 24.09400060907522 24.515277636788145 65-69 25.97881160755412 24.868212293361992 24.264291928962585 24.888684170121294 70-74 26.506207246009627 24.575627058525463 23.997973144160124 24.920192551304787 75-79 26.748491149769233 24.59299082010448 24.511842572399452 24.146675457726836 80-84 26.558868115209698 24.820616472966144 24.20919656392117 24.411318847902983 85-89 26.353972492316995 24.98362637916268 24.061665575091943 24.600735553428386 90-94 26.186744856175114 24.963348667913653 24.705525504271776 24.14438097163945 95-99 26.587443260060184 25.235885143061154 23.593614525424595 24.58305707145407 100-104 26.932629618131017 24.712822104936354 24.360964503777293 23.993583773155336 105-109 26.635393576988502 25.69720088664364 23.681633073869786 23.98577246249807 110-114 27.200000000000003 25.321290322580648 23.81935483870968 23.659354838709678 115-119 27.073158192380852 25.577091152125853 23.721145442393706 23.628605213099586 120-124 27.01048951048951 25.431921020156313 24.233854380913204 23.32373508844097 125-129 26.78598981638636 25.633904232885875 24.260659363266985 23.31944658746078 130-134 27.20997321244591 24.732124459097466 24.47455182361426 23.583350504842365 135-139 27.244408129915225 25.48769277908283 24.49188029823307 22.77601879276887 140-144 27.287130736992744 25.758969641214353 23.949708678319535 23.004190943473372 145-149 28.037238967184447 24.966567225594076 24.395638308815965 22.600555498405512 150-151 27.625243981782692 25.634352635003253 24.502277163305138 22.238126219908914 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 5.0 2 4.0 3 6.5 4 8.0 5 3.5 6 1.5 7 2.0 8 0.5 9 0.5 10 2.0 11 2.5 12 1.5 13 0.5 14 1.5 15 2.5 16 1.0 17 1.5 18 2.0 19 1.0 20 2.0 21 3.0 22 2.0 23 0.5 24 0.0 25 1.0 26 4.5 27 5.0 28 4.5 29 5.0 30 7.0 31 9.5 32 9.5 33 12.5 34 18.0 35 23.5 36 35.0 37 56.0 38 68.5 39 76.0 40 96.5 41 114.5 42 128.0 43 142.0 44 145.5 45 147.0 46 148.5 47 157.0 48 181.5 49 179.0 50 148.5 51 137.5 52 150.0 53 153.0 54 140.0 55 140.0 56 133.5 57 111.0 58 107.5 59 101.5 60 89.5 61 89.5 62 88.0 63 80.5 64 68.5 65 66.0 66 63.0 67 46.0 68 51.5 69 53.0 70 41.0 71 32.5 72 24.0 73 21.0 74 13.0 75 7.5 76 4.5 77 3.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 1.725 3 2.325 4 1.4000000000000001 5 2.125 6 1.8499999999999999 7 1.35 8 0.9249999999999999 9 0.575 10-14 0.365 15-19 1.3 20-24 1.645 25-29 1.5150000000000001 30-34 1.585 35-39 1.735 40-44 1.47 45-49 1.8450000000000002 50-54 1.3299999999999998 55-59 1.4200000000000002 60-64 1.49 65-69 2.305 70-74 1.325 75-79 1.415 80-84 1.05 85-89 0.755 90-94 1.095 95-99 1.965 100-104 3.37 105-109 3.005 110-114 3.125 115-119 2.7449999999999997 120-124 2.76 125-129 2.785 130-134 2.94 135-139 2.09 140-144 2.17 145-149 2.79 150-151 3.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62525458248473 96.85000000000001 2 1.0692464358452138 2.1 3 0.22912423625254583 0.675 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02545824847250509 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.6624999999999996 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.3 0.0 0.0 0.0 0.0 136-137 5.7 0.0 0.0 0.0 0.0 138-139 6.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187132 spots for SRR7473340.sra Written 1187132 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra Read 1187120 spots for SRR7473340.sra Written 1187120 spots for SRR7473340.sra SRR ids: ['SRR7473340.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ddw2e6q8 SRR7473340.sra spots: 23742412 blocks: [[1, 1187120], [1187121, 2374240], [2374241, 3561360], [3561361, 4748480], [4748481, 5935600], [5935601, 7122720], [7122721, 8309840], [8309841, 9496960], [9496961, 10684080], [10684081, 11871200], [11871201, 13058320], [13058321, 14245440], [14245441, 15432560], [15432561, 16619680], [16619681, 17806800], [17806801, 18993920], [18993921, 20181040], [20181041, 21368160], [21368161, 22555280], [22555281, 23742412]] SRR7473340 file size 8023824 SRR7473340 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473340 SRR7473340_1.fastq SRR7473340_2.fastq Input file: SRR7473340_1.fastq Paired file: SRR7473340_2.fastq trimmed: SRR7473340-trimmed-pair1.fastq, SRR7473340-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:08:25 2024 >> started Sat Dec 7 14:09:10 2024 >> done (45.123s) 23742412 read pairs processed; of these: 45332 ( 0.19%) short read pairs filtered out after trimming by size control 69941 ( 0.29%) empty read pairs filtered out after trimming by size control 23627139 (99.51%) read pairs available; of these: 12948529 (54.80%) trimmed read pairs available after processing 10678610 (45.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 20 0.00% 20 30 0.00% 21 21 0.00% 22 34 0.00% 23 28 0.00% 24 30 0.00% 25 39 0.00% 26 37 0.00% 27 75 0.00% 28 42 0.00% 29 57 0.00% 30 54 0.00% 31 70 0.00% 32 47 0.00% 33 49 0.00% 34 59 0.00% 35 62 0.00% 36 63 0.00% 37 45 0.00% 38 74 0.00% 39 85 0.00% 40 82 0.00% 41 87 0.00% 42 100 0.00% 43 99 0.00% 44 90 0.00% 45 127 0.00% 46 147 0.00% 47 166 0.00% 48 154 0.00% 49 199 0.00% 50 209 0.00% 51 250 0.00% 52 259 0.00% 53 239 0.00% 54 304 0.00% 55 287 0.00% 56 359 0.00% 57 394 0.00% 58 377 0.00% 59 487 0.00% 60 555 0.00% 61 571 0.00% 62 668 0.00% 63 719 0.00% 64 811 0.00% 65 999 0.00% 66 1055 0.00% 67 1221 0.01% 68 1472 0.01% 69 2727 0.01% 70 3080 0.01% 71 2110 0.01% 72 2014 0.01% 73 2205 0.01% 74 2250 0.01% 75 2621 0.01% 76 2802 0.01% 77 3007 0.01% 78 3571 0.02% 79 3911 0.02% 80 4478 0.02% 81 4902 0.02% 82 5572 0.02% 83 6158 0.03% 84 8166 0.03% 85 9219 0.04% 86 10233 0.04% 87 11142 0.05% 88 12153 0.05% 89 12568 0.05% 90 13529 0.06% 91 13824 0.06% 92 14211 0.06% 93 16073 0.07% 94 16730 0.07% 95 18617 0.08% 96 19477 0.08% 97 20224 0.09% 98 21521 0.09% 99 22856 0.10% 100 24447 0.10% 101 24601 0.10% 102 26465 0.11% 103 27931 0.12% 104 29527 0.12% 105 31869 0.13% 106 33167 0.14% 107 34426 0.15% 108 36409 0.15% 109 38622 0.16% 110 40812 0.17% 111 40190 0.17% 112 42495 0.18% 113 45805 0.19% 114 46400 0.20% 115 49287 0.21% 116 51537 0.22% 117 51866 0.22% 118 54062 0.23% 119 56139 0.24% 120 58956 0.25% 121 59789 0.25% 122 63413 0.27% 123 65319 0.28% 124 69572 0.29% 125 70132 0.30% 126 72546 0.31% 127 75561 0.32% 128 77808 0.33% 129 80736 0.34% 130 85171 0.36% 131 88207 0.37% 132 92554 0.39% 133 97383 0.41% 134 102349 0.43% 135 108158 0.46% 136 113626 0.48% 137 121872 0.52% 138 129521 0.55% 139 138462 0.59% 140 148352 0.63% 141 162072 0.69% 142 176799 0.75% 143 200338 0.85% 144 229133 0.97% 145 272359 1.15% 146 338065 1.43% 147 452225 1.91% 148 690435 2.92% 149 1350584 5.72% 150 6065492 25.67% 151 10678610 45.20% 23627139 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=13 prefix-density=0.60 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=39.72 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.8 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=13 prefix-density=0.69 prefix-fanout=2.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=31.76 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.8 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7473340 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:10:02 Started mapping on | Dec 07 14:10:03 Finished on | Dec 07 14:18:01 Mapping speed, Million of reads per hour | 177.94 Number of input reads | 23627139 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 20670647 Uniquely mapped reads % | 87.49% Average mapped length | 293.17 Number of splices: Total | 20020410 Number of splices: Annotated (sjdb) | 18801257 Number of splices: GT/AG | 19777626 Number of splices: GC/AG | 213619 Number of splices: AT/AC | 11344 Number of splices: Non-canonical | 17821 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203960 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 43132 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.24% % of reads unmapped: other | 1.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2774008 2774008 2774008 N_multimapping 203960 203960 203960 N_noFeature 515070 20032688 746319 N_ambiguous 462810 2792 56662 UnstrandedReadsAssigned:19692767 PositiveStrandReadsAssigned:635167 NegativeStrandReadsAssigned:19867666 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7473340 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473340-trimmed-pair1.fastq SRR7473340-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,627,139 reads, 19,999,974 reads pseudoaligned [quant] estimated average fragment length: 265.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR7473340.ke.tsv 35125 SRR7473340.se.tsv 88098 total ==> SRR7473340.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.599 0 0 PNS24247 1044 779.988 39.0827 3.21215 PNS24249 1928 1663.99 45.1945 1.74114 PNS24246 1044 779.988 39.0827 3.21215 PNS24248 1044 779.988 39.0827 3.21215 PNS24244 1471 1206.99 111.557 5.92507 PNS24243 293 92.1618 0 0 KQK14069 1603 1338.99 3781.49 181.044 KQK14071 474 231.44 25.8995 7.17386 ==> SRR7473340.se.tsv <== BRADI_1g14170v3 3972 BRADI_1g53295v3 16 BRADI_1g59795v3 397 BRADI_1g07683v3 0 BRADI_1g00485v3 101 BRADI_1g20270v3 5381 BRADI_1g74790v3 97 BRADI_1g09890v3 15 BRADI_1g77505v3 342 BRADI_1g48960v3 0 SRR7473340 completed mapping pipeline successfully