Starting /dee2/code/volunteer_pipeline.sh SRR7473341 current disk space = 1543087349760 free memory = 1604819712 SRR7473341 SRAfilesize 8ad1db94ddf32dcf4568e2b65fd213bc SRR7473341.sra SRR7473341.sra file validated SRR7473341 is paired end SRR7473341 is conventional basespace SRR7473341 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473341_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96775 34.0 33.0 34.0 33.0 34.0 2 33.21475 34.0 33.0 34.0 33.0 34.0 3 33.34375 34.0 33.0 34.0 32.0 34.0 4 33.41075 34.0 33.0 34.0 33.0 34.0 5 33.20425 34.0 33.0 34.0 33.0 34.0 6 36.916 38.0 37.0 38.0 35.0 38.0 7 37.3235 38.0 38.0 38.0 37.0 38.0 8 37.38275 38.0 38.0 38.0 37.0 38.0 9 37.428 38.0 38.0 38.0 37.0 38.0 10-14 37.46205 38.0 38.0 38.0 37.6 38.0 15-19 37.4016 38.0 38.0 38.0 37.0 38.0 20-24 37.43894999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.27375 38.0 38.0 38.0 37.0 38.0 30-34 37.12625 38.0 38.0 38.0 36.2 38.0 35-39 37.052899999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.82054999999999 38.0 38.0 38.0 35.2 38.0 45-49 36.7776 38.0 38.0 38.0 35.0 38.0 50-54 36.740399999999994 38.0 38.0 38.0 35.0 38.0 55-59 36.85925 38.0 38.0 38.0 35.0 38.0 60-64 36.6467 38.0 38.0 38.0 34.2 38.0 65-69 36.531499999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.3656 38.0 38.0 38.0 33.8 38.0 75-79 36.3414 38.0 38.0 38.0 34.0 38.0 80-84 36.25825 38.0 37.8 38.0 33.6 38.0 85-89 36.042 38.0 37.2 38.0 32.8 38.0 90-94 35.787 38.0 37.0 38.0 31.6 38.0 95-99 35.5018 38.0 36.2 38.0 30.6 38.0 100-104 35.459599999999995 38.0 36.0 38.0 30.8 38.0 105-109 35.05865 38.0 35.6 38.0 28.4 38.0 110-114 34.881750000000004 38.0 35.2 38.0 27.8 38.0 115-119 34.3952 38.0 34.8 38.0 25.0 38.0 120-124 34.05135 38.0 34.4 38.0 23.0 38.0 125-129 33.51345 38.0 34.0 38.0 20.2 38.0 130-134 33.0543 38.0 33.6 38.0 14.8 38.0 135-139 32.354499999999994 37.6 32.6 38.0 14.0 38.0 140-144 31.68195 36.4 31.4 38.0 13.4 38.0 145-149 29.900650000000002 36.0 29.4 38.0 6.4 38.0 150-151 25.182625 33.5 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 2.0 11 0.0 12 2.0 13 7.0 14 1.0 15 4.0 16 4.0 17 4.0 18 7.0 19 4.0 20 7.0 21 16.0 22 11.0 23 15.0 24 16.0 25 30.0 26 28.0 27 42.0 28 51.0 29 66.0 30 75.0 31 93.0 32 102.0 33 148.0 34 240.0 35 418.0 36 925.0 37 1680.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.357630979498865 10.655530245507466 9.643128321943811 42.34371045304986 2 24.54203262233375 14.604767879548305 33.17440401505646 27.67879548306148 3 22.325 18.175 24.099999999999998 35.4 4 27.625 25.924999999999997 19.625 26.825 5 29.22110552763819 28.467336683417084 20.954773869346734 21.35678391959799 6 22.525000000000002 31.724999999999998 23.425 22.325 7 17.724999999999998 21.0 40.275 21.0 8 21.349999999999998 21.475 29.25 27.925 9 20.65 20.75 31.35 27.250000000000004 10-14 23.905 24.585 24.610000000000003 26.900000000000002 15-19 24.0 24.355 25.515 26.13 20-24 24.505 24.315 24.83 26.35 25-29 24.05 23.79 25.305 26.855 30-34 23.79 24.595 24.8 26.815 35-39 24.45967580548329 24.224534720832498 24.894936962177304 26.420852511506904 40-44 24.35370741482966 24.298597194388776 25.0 26.34769539078156 45-49 23.982783644462238 24.383164005805515 24.067864471247685 27.56618787848456 50-54 24.505 24.03 24.8 26.665 55-59 24.4 24.295 24.77 26.534999999999997 60-64 24.52 23.76 24.85 26.87 65-69 24.455 23.345 25.080000000000002 27.12 70-74 24.775 24.075 24.085 27.065 75-79 24.602460246024602 23.86738673867387 24.157415741574155 27.37273727372737 80-84 23.827148144443335 24.10223066920076 25.127538261478442 26.943082924877466 85-89 25.0500100020004 23.439687937587518 24.019803960792157 27.490498099619927 90-94 25.01751576418777 23.801421279151235 24.361925733159843 26.819137223501148 95-99 24.607749761892826 24.126522632713417 24.08642037194847 27.17930723344529 100-104 24.955 24.19 24.04 26.815 105-109 25.231261563078156 23.726186309315466 24.09120456022801 26.95134756737837 110-114 25.071253562678137 23.971198559928 24.501225061253063 26.45632281614081 115-119 25.805 23.630000000000003 24.099999999999998 26.465 120-124 25.105063037822696 24.099459675805484 23.559135481288774 27.236341805083047 125-129 25.22572231139647 23.776083467094704 24.17736757624398 26.82082664526485 130-134 24.743932589938947 24.219183611685757 24.173772642413844 26.863111155961448 135-139 24.95336056068169 24.030655977411385 24.227297937780467 26.788685524126453 140-144 25.51102204408818 23.992985971943888 23.51202404809619 26.983967935871746 145-149 25.21173623714458 23.92115345835854 24.137931034482758 26.729179270014114 150-151 25.543753161355585 23.76074860900354 23.6848760748609 27.010622154779966 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 3.0 29 5.5 30 7.5 31 12.0 32 13.5 33 17.5 34 24.0 35 33.5 36 49.0 37 54.0 38 66.0 39 91.0 40 102.5 41 114.5 42 123.0 43 132.5 44 154.0 45 159.5 46 157.5 47 161.0 48 157.0 49 146.0 50 149.0 51 157.0 52 142.5 53 139.0 54 147.5 55 133.0 56 118.0 57 109.5 58 103.0 59 101.5 60 92.5 61 87.5 62 91.5 63 80.0 64 73.5 65 64.5 66 53.0 67 56.0 68 47.5 69 42.0 70 51.0 71 51.5 72 35.0 73 23.5 74 21.0 75 19.0 76 12.0 77 4.5 78 3.5 79 2.0 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.375 3 0.0 4 0.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06 40-44 0.2 45-49 0.095 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.03 85-89 0.02 90-94 0.09 95-99 0.255 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.0 120-124 0.06 125-129 0.32 130-134 0.905 135-139 0.835 140-144 0.2 145-149 0.8200000000000001 150-151 1.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.05 #Duplication Level Percentage of deduplicated Percentage of total 1 97.63008758371973 94.75 2 1.8804739824832561 3.65 3 0.38639876352395675 1.125 4 0.07727975270479134 0.3 5 0.0 0.0 6 0.0 0.0 7 0.025759917568263783 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.7874999999999996 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.300000000000001 0.0 0.0 0.0 0.0 126-127 4.637499999999999 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.7625 0.0 0.0 0.0 0.0 138-139 7.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCTG 10 0.006585701 146.75949 4 >>END_MODULE SRR7473341 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473341_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9135 33.0 33.0 34.0 31.0 34.0 2 32.17925 33.0 33.0 34.0 32.0 34.0 3 32.071 34.0 33.0 34.0 31.0 34.0 4 32.12175 34.0 33.0 34.0 32.0 34.0 5 32.07725 34.0 33.0 34.0 32.0 34.0 6 36.06375 38.0 38.0 38.0 34.0 38.0 7 36.35 38.0 38.0 38.0 35.0 38.0 8 36.51325 38.0 38.0 38.0 35.0 38.0 9 36.60675 38.0 38.0 38.0 35.0 38.0 10-14 36.7138 38.0 38.0 38.0 36.0 38.0 15-19 36.52575 38.0 38.0 38.0 36.0 38.0 20-24 36.036500000000004 38.0 38.0 38.0 34.2 38.0 25-29 36.265499999999996 38.0 38.0 38.0 34.8 38.0 30-34 36.30045 38.0 38.0 38.0 35.0 38.0 35-39 36.2883 38.0 38.0 38.0 35.2 38.0 40-44 36.28455 38.0 38.0 38.0 35.0 38.0 45-49 36.19855 38.0 38.0 38.0 34.8 38.0 50-54 36.16905 38.0 38.0 38.0 34.4 38.0 55-59 36.071600000000004 38.0 38.0 38.0 34.2 38.0 60-64 35.991699999999994 38.0 38.0 38.0 34.0 38.0 65-69 35.58970000000001 38.0 38.0 38.0 33.0 38.0 70-74 35.717 38.0 38.0 38.0 32.8 38.0 75-79 35.7122 38.0 38.0 38.0 33.0 38.0 80-84 35.6608 38.0 38.0 38.0 33.0 38.0 85-89 35.501549999999995 38.0 38.0 38.0 31.8 38.0 90-94 35.297399999999996 38.0 37.8 38.0 30.8 38.0 95-99 34.794850000000004 38.0 36.8 38.0 28.2 38.0 100-104 34.097750000000005 38.0 36.0 38.0 22.4 38.0 105-109 34.1521 38.0 36.0 38.0 22.8 38.0 110-114 33.72935 38.0 35.0 38.0 16.2 38.0 115-119 33.29795 38.0 34.8 38.0 14.8 38.0 120-124 33.1893 38.0 34.6 38.0 14.6 38.0 125-129 32.85379999999999 38.0 34.2 38.0 14.0 38.0 130-134 32.29899999999999 38.0 33.0 38.0 13.0 38.0 135-139 31.6411 38.0 31.2 38.0 13.0 38.0 140-144 30.885150000000003 38.0 30.0 38.0 6.4 38.0 145-149 29.54035 37.2 28.6 38.0 2.0 38.0 150-151 23.255625000000002 30.5 2.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 21.0 4 20.0 5 0.0 6 2.0 7 3.0 8 2.0 9 2.0 10 5.0 11 4.0 12 4.0 13 10.0 14 10.0 15 9.0 16 9.0 17 10.0 18 11.0 19 10.0 20 18.0 21 20.0 22 18.0 23 21.0 24 37.0 25 23.0 26 28.0 27 32.0 28 40.0 29 41.0 30 68.0 31 91.0 32 104.0 33 128.0 34 165.0 35 308.0 36 741.0 37 1948.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.77452491011813 16.640986132511557 12.403697996918336 34.18079096045198 2 30.678917815211843 22.588055130168453 26.85043389484431 19.882593159775396 3 24.32016418676244 24.06362237044638 25.679835813237556 25.93637762955362 4 27.87847842736788 29.99744702578504 18.228235894817463 23.895838652029614 5 29.33778234086242 31.981519507186857 17.47946611909651 21.201232032854207 6 22.759856630824373 35.4326676907322 19.150025601638504 22.657450076804917 7 23.46524606798579 18.41704718417047 34.04363267376966 24.074074074074073 8 25.58667676003028 21.751198586929092 21.62503154176129 31.037093111279333 9 24.17940365823102 21.899273365071412 25.68278626910549 28.238536707592083 10-14 26.565950612326844 24.47801646255772 22.033728167034734 26.922304758080706 15-19 26.746951373779282 24.201791226028437 23.260638567019175 25.790618833173102 20-24 26.777045326792376 25.366651336297203 22.438550769073533 25.41775256783689 25-29 26.308567943896737 24.036995629637158 23.34586848256937 26.308567943896737 30-34 26.96446700507614 24.532994923857867 23.0253807106599 25.477157360406093 35-39 27.477271572959523 24.272436385799175 22.586215653410534 25.664076387830768 40-44 27.51572327044025 24.67031852302698 22.03286670724285 25.781091499289914 45-49 27.632584441387742 24.331346477151154 22.161088185847472 25.874980895613632 50-54 27.206851119894598 24.25255903516773 23.11746224789703 25.42312759704064 55-59 27.618371692182908 24.064686200953055 22.91392071377877 25.403021393085268 60-64 26.902546896446545 23.582939352346095 23.405012454882822 26.109501296324538 65-69 27.125754630103344 24.37838944029469 22.77703878031311 25.71881714928886 70-74 27.67911508017049 23.46762735944794 23.224071443068805 25.62918611731277 75-79 26.752431118314423 24.174432739059966 23.237439222042138 25.835696920583466 80-84 27.716264725213613 23.873805551342333 22.93847009454472 25.47145962889934 85-89 27.606557377049178 23.94451450189155 23.162673392181592 25.286254728877676 90-94 27.506087662337663 24.284699675324674 22.63088474025974 25.57832792207792 95-99 27.702009844134533 24.394995898277276 22.75943396226415 25.143560295324036 100-104 27.954368680321494 24.065335753176043 22.670469276639878 25.309826289862585 105-109 27.499870674046868 24.546065904505713 22.895866742537894 25.05819667890952 110-114 27.82806600113795 25.174571975378885 22.510732943671442 24.48662907981172 115-119 27.119958634953463 24.260599793174766 23.381592554291625 25.237849017580142 120-124 27.913097326865515 24.842605015997524 22.917741769016413 24.32655588812055 125-129 28.118699271054126 24.556687173654552 23.114304916507265 24.210308638784056 130-134 28.191351965697166 24.115307124037816 23.159580513509326 24.533760396755696 135-139 28.63068414584187 24.72347398607128 22.79803359278984 23.84780827529701 140-144 28.711348135993024 25.14742833700836 22.49628224193631 23.644941285062306 145-149 28.61331138771731 24.765970579158523 22.69828206974591 23.922435963378252 150-151 28.058493275884583 25.094659877268573 22.77059668364016 24.076250163206687 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.0 2 3.5 3 7.0 4 7.5 5 7.0 6 3.5 7 1.5 8 1.0 9 2.0 10 2.0 11 0.5 12 2.0 13 2.0 14 0.5 15 0.0 16 1.5 17 2.0 18 1.5 19 2.0 20 1.0 21 1.0 22 2.0 23 2.0 24 2.0 25 2.0 26 2.0 27 3.0 28 4.0 29 3.0 30 4.5 31 10.0 32 11.0 33 11.0 34 13.5 35 20.0 36 30.5 37 44.5 38 52.5 39 60.0 40 80.5 41 103.5 42 109.0 43 116.0 44 120.5 45 129.5 46 143.5 47 148.0 48 149.0 49 151.0 50 154.0 51 127.0 52 118.5 53 139.5 54 146.0 55 142.5 56 126.0 57 117.5 58 119.5 59 113.0 60 108.5 61 115.0 62 118.0 63 104.0 64 89.0 65 70.5 66 64.5 67 67.5 68 70.5 69 68.0 70 56.0 71 51.5 72 39.5 73 26.0 74 21.0 75 15.5 76 8.5 77 7.5 78 6.5 79 2.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 2.0500000000000003 3 2.55 4 2.075 5 2.6 6 2.35 7 1.4500000000000002 8 0.9249999999999999 9 0.22499999999999998 10-14 0.38 15-19 1.185 20-24 2.155 25-29 1.6099999999999999 30-34 1.5 35-39 1.555 40-44 1.4200000000000002 45-49 1.855 50-54 1.3299999999999998 55-59 1.37 60-64 1.645 65-69 2.27 70-74 1.46 75-79 1.28 80-84 1.105 85-89 0.8750000000000001 90-94 1.44 95-99 2.48 100-104 3.5749999999999997 105-109 3.345 110-114 3.335 115-119 3.3000000000000003 120-124 3.11 125-129 3.2849999999999997 130-134 3.215 135-139 2.36 140-144 2.495 145-149 2.79 150-151 4.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 97.86467712889117 95.1 2 1.6979675842552098 3.3000000000000003 3 0.2829945973758683 0.8250000000000001 4 0.07718034473887317 0.3 5 0.02572678157962439 0.125 6 0.02572678157962439 0.15 7 0.0 0.0 8 0.02572678157962439 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit GCCCGCTCGCCGGAAGACCAAGGGTTCCTGTCCAACGTTAATCGGGGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.7125000000000004 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.725 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.324999999999999 0.0 0.0 0.0 0.0 126-127 4.675000000000001 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.8625 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACTTC 10 0.006635205 146.3924 1 >>END_MODULE Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089154 spots for SRR7473341.sra Written 1089154 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra Read 1089152 spots for SRR7473341.sra Written 1089152 spots for SRR7473341.sra SRR ids: ['SRR7473341.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3wm12ua0 SRR7473341.sra spots: 21783042 blocks: [[1, 1089152], [1089153, 2178304], [2178305, 3267456], [3267457, 4356608], [4356609, 5445760], [5445761, 6534912], [6534913, 7624064], [7624065, 8713216], [8713217, 9802368], [9802369, 10891520], [10891521, 11980672], [11980673, 13069824], [13069825, 14158976], [14158977, 15248128], [15248129, 16337280], [16337281, 17426432], [17426433, 18515584], [18515585, 19604736], [19604737, 20693888], [20693889, 21783042]] SRR7473341 file size 7359857 SRR7473341 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473341 SRR7473341_1.fastq SRR7473341_2.fastq Input file: SRR7473341_1.fastq Paired file: SRR7473341_2.fastq trimmed: SRR7473341-trimmed-pair1.fastq, SRR7473341-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:12:46 2024 >> started Sat Dec 7 14:13:22 2024 >> done (35.902s) 21783042 read pairs processed; of these: 38342 ( 0.18%) short read pairs filtered out after trimming by size control 74966 ( 0.34%) empty read pairs filtered out after trimming by size control 21669734 (99.48%) read pairs available; of these: 12926626 (59.65%) trimmed read pairs available after processing 8743108 (40.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 13 0.00% 21 16 0.00% 22 22 0.00% 23 13 0.00% 24 13 0.00% 25 25 0.00% 26 24 0.00% 27 22 0.00% 28 32 0.00% 29 35 0.00% 30 25 0.00% 31 42 0.00% 32 34 0.00% 33 33 0.00% 34 31 0.00% 35 64 0.00% 36 63 0.00% 37 52 0.00% 38 63 0.00% 39 56 0.00% 40 90 0.00% 41 72 0.00% 42 102 0.00% 43 108 0.00% 44 104 0.00% 45 112 0.00% 46 134 0.00% 47 147 0.00% 48 133 0.00% 49 190 0.00% 50 201 0.00% 51 220 0.00% 52 275 0.00% 53 242 0.00% 54 295 0.00% 55 305 0.00% 56 327 0.00% 57 385 0.00% 58 421 0.00% 59 483 0.00% 60 514 0.00% 61 618 0.00% 62 660 0.00% 63 720 0.00% 64 762 0.00% 65 938 0.00% 66 1034 0.00% 67 1374 0.01% 68 1630 0.01% 69 2984 0.01% 70 2865 0.01% 71 1970 0.01% 72 1961 0.01% 73 2108 0.01% 74 2174 0.01% 75 2489 0.01% 76 2654 0.01% 77 2951 0.01% 78 3323 0.02% 79 3893 0.02% 80 4130 0.02% 81 4649 0.02% 82 5207 0.02% 83 6046 0.03% 84 8075 0.04% 85 8623 0.04% 86 9503 0.04% 87 9968 0.05% 88 11211 0.05% 89 11472 0.05% 90 12149 0.06% 91 12905 0.06% 92 13667 0.06% 93 15671 0.07% 94 16486 0.08% 95 18048 0.08% 96 18697 0.09% 97 20086 0.09% 98 20877 0.10% 99 22599 0.10% 100 23677 0.11% 101 23829 0.11% 102 25265 0.12% 103 26922 0.12% 104 28764 0.13% 105 31097 0.14% 106 32642 0.15% 107 33682 0.16% 108 35632 0.16% 109 38301 0.18% 110 40574 0.19% 111 39444 0.18% 112 41861 0.19% 113 45485 0.21% 114 45499 0.21% 115 49175 0.23% 116 52065 0.24% 117 52308 0.24% 118 54494 0.25% 119 56270 0.26% 120 59180 0.27% 121 60929 0.28% 122 65069 0.30% 123 67492 0.31% 124 70308 0.32% 125 72305 0.33% 126 74652 0.34% 127 77760 0.36% 128 81002 0.37% 129 83890 0.39% 130 89046 0.41% 131 91857 0.42% 132 96483 0.45% 133 101349 0.47% 134 107463 0.50% 135 113527 0.52% 136 119250 0.55% 137 128821 0.59% 138 135891 0.63% 139 145644 0.67% 140 156020 0.72% 141 173600 0.80% 142 190241 0.88% 143 213779 0.99% 144 249193 1.15% 145 295009 1.36% 146 369935 1.71% 147 495028 2.28% 148 745151 3.44% 149 1437459 6.63% 150 5689568 26.26% 151 8743108 40.35% 21669734 reads passed initial QC criterion=sequence-density sequence-density=1.27 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=13 prefix-density=1.31 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=11.23 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=2.9 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGCC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=10 prefix-density=0.98 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=67.48 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=6.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473341 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:14:23 Started mapping on | Dec 07 14:14:23 Finished on | Dec 07 14:20:06 Mapping speed, Million of reads per hour | 227.44 Number of input reads | 21669734 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19449240 Uniquely mapped reads % | 89.75% Average mapped length | 292.50 Number of splices: Total | 20189687 Number of splices: Annotated (sjdb) | 19039236 Number of splices: GT/AG | 19944505 Number of splices: GC/AG | 218303 Number of splices: AT/AC | 8171 Number of splices: Non-canonical | 18708 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 154364 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 19913 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.57% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2085176 2085176 2085176 N_multimapping 154364 154364 154364 N_noFeature 560204 18823425 790324 N_ambiguous 462845 2425 67817 UnstrandedReadsAssigned:18426191 PositiveStrandReadsAssigned:623390 NegativeStrandReadsAssigned:18591099 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473341 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473341-trimmed-pair1.fastq SRR7473341-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,669,734 reads, 18,639,105 reads pseudoaligned [quant] estimated average fragment length: 261.259 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR7473341.ke.tsv 35125 SRR7473341.se.tsv 88098 total ==> SRR7473341.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.341 0 0 PNS24247 1044 783.741 25.5532 2.20091 PNS24249 1928 1667.74 40.0024 1.61915 PNS24246 1044 783.741 25.5532 2.20091 PNS24248 1044 783.741 25.5532 2.20091 PNS24244 1471 1210.74 50.3379 2.80655 PNS24243 293 94.1662 0 0 KQK14069 1603 1342.74 273.964 13.773 KQK14071 474 234.302 35.4631 10.2171 ==> SRR7473341.se.tsv <== BRADI_1g14170v3 550 BRADI_1g53295v3 42 BRADI_1g59795v3 151 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1805 BRADI_1g74790v3 320 BRADI_1g09890v3 6 BRADI_1g77505v3 277 BRADI_1g48960v3 0 SRR7473341 completed mapping pipeline successfully