Starting /dee2/code/volunteer_pipeline.sh SRR7473342 current disk space = 1543091585024 free memory = 1596596800 SRR7473342 SRAfilesize 312aae7701354c72d5e0ff53ce56d3be SRR7473342.sra SRR7473342.sra file validated SRR7473342 is paired end SRR7473342 is conventional basespace SRR7473342 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473342_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28475 34.0 33.0 34.0 33.0 34.0 2 33.39575 34.0 34.0 34.0 33.0 34.0 3 33.46875 34.0 34.0 34.0 33.0 34.0 4 33.446 34.0 34.0 34.0 33.0 34.0 5 33.467 34.0 34.0 34.0 33.0 34.0 6 37.0995 38.0 37.0 38.0 36.0 38.0 7 37.4195 38.0 38.0 38.0 37.0 38.0 8 37.4955 38.0 38.0 38.0 37.0 38.0 9 37.5215 38.0 38.0 38.0 38.0 38.0 10-14 37.4567 38.0 38.0 38.0 37.6 38.0 15-19 37.3855 38.0 38.0 38.0 37.0 38.0 20-24 37.48015 38.0 38.0 38.0 37.6 38.0 25-29 37.42465 38.0 38.0 38.0 37.0 38.0 30-34 37.17025 38.0 38.0 38.0 36.6 38.0 35-39 37.0912 38.0 38.0 38.0 36.2 38.0 40-44 36.93055 38.0 38.0 38.0 35.6 38.0 45-49 36.94265 38.0 38.0 38.0 35.6 38.0 50-54 36.80929999999999 38.0 38.0 38.0 35.2 38.0 55-59 36.8433 38.0 38.0 38.0 35.2 38.0 60-64 36.8771 38.0 38.0 38.0 35.2 38.0 65-69 36.6328 38.0 38.0 38.0 34.2 38.0 70-74 36.4215 38.0 38.0 38.0 33.8 38.0 75-79 36.51195 38.0 38.0 38.0 34.0 38.0 80-84 36.473200000000006 38.0 38.0 38.0 34.0 38.0 85-89 36.296600000000005 38.0 37.4 38.0 33.8 38.0 90-94 36.0567 38.0 37.0 38.0 33.0 38.0 95-99 35.7019 38.0 36.8 38.0 31.0 38.0 100-104 35.56165 38.0 36.0 38.0 30.8 38.0 105-109 35.37595 38.0 36.0 38.0 29.8 38.0 110-114 35.0241 38.0 35.4 38.0 28.4 38.0 115-119 34.7904 38.0 35.0 38.0 27.6 38.0 120-124 34.4538 38.0 35.0 38.0 26.0 38.0 125-129 34.146499999999996 38.0 34.4 38.0 23.8 38.0 130-134 33.50535000000001 38.0 34.0 38.0 20.2 38.0 135-139 33.07705 38.0 33.6 38.0 16.2 38.0 140-144 32.3434 37.4 32.2 38.0 14.2 38.0 145-149 31.0205 36.0 31.2 38.0 8.8 38.0 150-151 26.11325 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 3.0 16 6.0 17 7.0 18 8.0 19 5.0 20 9.0 21 6.0 22 12.0 23 11.0 24 13.0 25 18.0 26 19.0 27 32.0 28 34.0 29 56.0 30 60.0 31 102.0 32 109.0 33 164.0 34 229.0 35 379.0 36 914.0 37 1799.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.98994974874372 14.120603015075378 8.442211055276381 34.447236180904525 2 23.925 16.675 33.675 25.724999999999998 3 20.3 23.45 26.35 29.9 4 25.474999999999998 28.299999999999997 21.925 24.3 5 24.73710565848773 31.196795192789185 23.184777165748624 20.881321982974463 6 20.8 31.924999999999997 24.224999999999998 23.05 7 17.05 20.5 40.875 21.575 8 21.775 21.7 27.6 28.925 9 20.724999999999998 20.549999999999997 32.074999999999996 26.650000000000002 10-14 22.665 25.319999999999997 25.345000000000002 26.669999999999998 15-19 23.24 24.9 25.895000000000003 25.965 20-24 22.64 25.14 25.929999999999996 26.290000000000003 25-29 23.265 25.585 25.235000000000003 25.915 30-34 23.05 25.81 25.629999999999995 25.509999999999998 35-39 23.176953085925778 24.652395718715614 25.642692807842355 26.527958387516254 40-44 23.01 25.25 25.825 25.915 45-49 23.1 24.965 25.224999999999998 26.71 50-54 23.715 25.195 25.009999999999998 26.08 55-59 23.44 25.455 25.215 25.89 60-64 23.835 24.305 26.029999999999998 25.83 65-69 23.66 24.505 25.5 26.334999999999997 70-74 23.605 24.445 25.95 26.0 75-79 23.385 25.295 24.97 26.35 80-84 23.35 25.185000000000002 24.79 26.674999999999997 85-89 23.294999999999998 25.019999999999996 24.75 26.935 90-94 23.62 25.169999999999998 25.4 25.81 95-99 23.668935148118493 24.90492393915132 25.32025620496397 26.105884707766215 100-104 24.345 24.84 24.84 25.974999999999998 105-109 24.25 24.755 25.305 25.69 110-114 24.709999999999997 25.135 24.349999999999998 25.805 115-119 24.205 24.695 24.575 26.525 120-124 24.015 25.064999999999998 24.545 26.375 125-129 23.685000000000002 24.85 25.355 26.11 130-134 24.259463801586502 24.761522241188874 24.751481072396828 26.22753288482779 135-139 24.70293306593131 25.234394585109047 24.221609425921283 25.841062923038354 140-144 24.075 25.085 24.18 26.66 145-149 24.292653613100306 25.309229305423408 24.292653613100306 26.105463468375984 150-151 25.343242221942308 24.474115127849856 24.814208338581686 25.36843431162615 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 0.5 26 2.0 27 4.5 28 4.5 29 7.5 30 9.0 31 9.5 32 16.0 33 22.0 34 29.0 35 34.5 36 43.0 37 69.0 38 90.0 39 99.5 40 117.5 41 134.0 42 157.0 43 165.5 44 172.0 45 187.0 46 192.0 47 202.5 48 198.0 49 167.5 50 143.5 51 140.5 52 135.5 53 114.5 54 110.0 55 117.5 56 106.5 57 103.0 58 98.0 59 91.0 60 93.0 61 83.5 62 76.0 63 64.5 64 55.5 65 58.5 66 47.5 67 39.5 68 38.5 69 35.0 70 25.0 71 18.5 72 20.0 73 16.0 74 11.0 75 8.0 76 5.0 77 2.5 78 1.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.08 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.41000000000000003 135-139 0.27499999999999997 140-144 0.0 145-149 0.155 150-151 0.7625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.4 0.0 0.0 0.0 0.0 124-125 2.5374999999999996 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.25 0.0 0.0 0.0 0.0 132-133 3.5 0.0 0.0 0.0 0.0 134-135 3.65 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACGG 15 1.1462439E-4 144.83751 7 TTCCCTC 10 0.0068537686 144.8375 3 CCTCACG 10 0.0068537686 144.8375 6 TTGTGCA 10 0.0068537686 144.8375 7 CACGGTA 10 0.0068537686 144.8375 9 >>END_MODULE SRR7473342 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473342_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83725 33.0 33.0 34.0 32.0 34.0 2 32.35825 33.0 33.0 34.0 32.0 34.0 3 32.28925 34.0 33.0 34.0 32.0 34.0 4 32.171 34.0 33.0 34.0 32.0 34.0 5 32.2555 34.0 33.0 34.0 32.0 34.0 6 36.579 38.0 38.0 38.0 35.0 38.0 7 36.672 38.0 38.0 38.0 36.0 38.0 8 36.86125 38.0 38.0 38.0 36.0 38.0 9 37.01775 38.0 38.0 38.0 36.0 38.0 10-14 36.96585 38.0 38.0 38.0 36.4 38.0 15-19 36.790150000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.39085 38.0 38.0 38.0 35.6 38.0 25-29 36.55805 38.0 38.0 38.0 35.8 38.0 30-34 36.681599999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.6091 38.0 38.0 38.0 36.0 38.0 40-44 36.693650000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.62035 38.0 38.0 38.0 36.0 38.0 50-54 36.54155000000001 38.0 38.0 38.0 35.2 38.0 55-59 36.53580000000001 38.0 38.0 38.0 35.4 38.0 60-64 36.3819 38.0 38.0 38.0 34.8 38.0 65-69 36.070350000000005 38.0 38.0 38.0 33.8 38.0 70-74 36.20035 38.0 38.0 38.0 34.0 38.0 75-79 36.1883 38.0 38.0 38.0 34.0 38.0 80-84 36.14660000000001 38.0 38.0 38.0 34.0 38.0 85-89 35.95095 38.0 38.0 38.0 33.6 38.0 90-94 35.6099 38.0 37.8 38.0 31.8 38.0 95-99 35.2327 38.0 37.6 38.0 30.2 38.0 100-104 34.7638 38.0 36.8 38.0 27.8 38.0 105-109 34.63435 38.0 36.2 38.0 27.2 38.0 110-114 34.369749999999996 38.0 36.0 38.0 24.8 38.0 115-119 33.893299999999996 38.0 35.2 38.0 21.8 38.0 120-124 33.85915 38.0 35.0 38.0 21.8 38.0 125-129 33.60765 38.0 35.0 38.0 18.6 38.0 130-134 32.8351 38.0 33.8 38.0 14.2 38.0 135-139 32.42065 38.0 33.4 38.0 13.4 38.0 140-144 31.841249999999995 38.0 32.0 38.0 12.6 38.0 145-149 30.723000000000003 38.0 31.0 38.0 2.0 38.0 150-151 25.102375000000002 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 14.0 4 25.0 5 0.0 6 0.0 7 2.0 8 4.0 9 0.0 10 2.0 11 3.0 12 4.0 13 7.0 14 3.0 15 3.0 16 12.0 17 8.0 18 8.0 19 18.0 20 18.0 21 24.0 22 25.0 23 21.0 24 29.0 25 19.0 26 25.0 27 34.0 28 41.0 29 55.0 30 55.0 31 50.0 32 93.0 33 104.0 34 180.0 35 295.0 36 625.0 37 2186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.7975791913469 18.74839041977852 9.708987895956735 29.745042492917843 2 30.544252288911494 22.202441505595118 27.77212614445575 19.48118006103764 3 23.415132924335378 24.565439672801638 27.6840490797546 24.335378323108383 4 26.16487455197133 31.797235023041477 20.046082949308754 21.991807475678442 5 27.070552147239262 32.94989775051125 18.634969325153374 21.344580777096116 6 22.806573957016436 33.24905183312263 21.39064475347661 22.553729456384325 7 22.933467741935484 16.65826612903226 35.181451612903224 25.226814516129032 8 24.23711855927964 22.086043021510758 23.58679339669835 30.09004502251126 9 23.875 22.275 25.6 28.249999999999996 10-14 26.284999999999997 24.515 23.365 25.835 15-19 25.29231695689266 24.755357053244342 24.218397149596026 25.733928840266973 20-24 25.335025380710658 25.482233502538072 23.82741116751269 25.35532994923858 25-29 25.92928834417713 25.26352953043829 23.851313864931658 24.955868260452917 30-34 26.142936176633302 25.323140371171355 23.980284665291958 24.553638786903385 35-39 26.097487132909475 24.90665051972954 24.053890402664244 24.94197194469674 40-44 26.560697989269418 24.800681943539086 23.888081030938174 24.750539036253322 45-49 26.283118849356548 24.299772899318697 24.965934897804694 24.451173353520062 50-54 26.26837125025166 25.0 24.36078115562714 24.3708475941212 55-59 26.874498797113073 24.68925421010425 23.671812349639136 24.764434643143545 60-64 25.441642760078516 25.56746690824903 24.198500176153807 24.79239015551865 65-69 26.154313487241797 25.106318347509117 23.982381530984203 24.756986634264884 70-74 26.330884572808692 25.002515849854078 23.950890610848344 24.71570896648888 75-79 26.21437173825773 24.322561220393414 24.282416700120432 25.18065034122842 80-84 26.468670044649578 24.84322480309035 24.18602317764511 24.50208197461496 85-89 26.34508348794063 24.805696234267664 24.28922428922429 24.55999598856742 90-94 26.211242752709857 24.49710108394253 24.446685152508195 24.844971010839426 95-99 25.992779783393498 24.48772054710937 24.411450653378754 25.108049016118372 100-104 26.753846153846155 24.861538461538462 24.45128205128205 23.933333333333334 105-109 27.029241562964103 25.067854765196905 24.52501664362165 23.37788702821734 110-114 26.628038149933342 25.766588042252074 23.715516357296686 23.889857450517894 115-119 26.33632862644416 25.5609756097561 24.005134788189988 24.097560975609756 120-124 26.442726202058473 25.193302268421323 23.954119514568077 24.409852014952122 125-129 27.35699288165105 25.17539816664106 23.823423977057406 23.644184974650486 130-134 27.324507389162562 25.220648604269293 23.788998357963877 23.665845648604268 135-139 27.19053182303043 25.255244577640067 24.22410727891502 23.330116320414486 140-144 26.858039692183073 25.860672336978535 23.531794248683678 23.749493722154718 145-149 26.788990825688074 26.049949031600406 23.649337410805302 23.511722731906218 150-151 28.121368624919302 26.236281471917366 22.930923176242736 22.711426726920596 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 1.0 9 1.0 10 2.0 11 2.0 12 1.5 13 2.5 14 3.5 15 4.0 16 1.5 17 0.5 18 1.0 19 1.0 20 2.5 21 3.0 22 2.0 23 2.5 24 2.0 25 0.5 26 1.5 27 3.0 28 4.5 29 8.0 30 10.0 31 9.5 32 10.5 33 12.5 34 19.5 35 30.0 36 38.5 37 49.0 38 71.0 39 89.0 40 105.0 41 131.0 42 142.5 43 144.0 44 153.5 45 166.0 46 156.0 47 151.5 48 176.0 49 174.0 50 152.5 51 136.0 52 128.5 53 136.0 54 134.5 55 122.0 56 111.0 57 108.0 58 105.5 59 95.5 60 82.0 61 85.5 62 90.5 63 81.5 64 80.5 65 75.0 66 59.5 67 55.5 68 63.0 69 60.0 70 44.0 71 32.5 72 22.5 73 14.0 74 12.0 75 8.0 76 5.0 77 3.0 78 2.0 79 1.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 1.7000000000000002 3 2.1999999999999997 4 2.35 5 2.1999999999999997 6 1.125 7 0.8 8 0.05 9 0.0 10-14 0.0 15-19 0.365 20-24 1.5 25-29 0.865 30-34 0.585 35-39 0.91 40-44 0.28500000000000003 45-49 0.9249999999999999 50-54 0.66 55-59 0.24 60-64 0.655 65-69 1.24 70-74 0.63 75-79 0.36 80-84 0.335 85-89 0.28500000000000003 90-94 0.8250000000000001 95-99 1.6650000000000003 100-104 2.5 105-109 2.365 110-114 2.4899999999999998 115-119 2.625 120-124 2.355 125-129 2.365 130-134 2.56 135-139 1.5650000000000002 140-144 1.24 145-149 1.9 150-151 3.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7059122050241 97.25 2 1.1164679015478305 2.1999999999999997 3 0.1522456229383405 0.44999999999999996 4 0.025374270489723422 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.275 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.5250000000000004 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 3.0 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.975 0.0 0.0 0.0 0.0 138-139 4.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCGG 10 0.006390424 148.19481 4 >>END_MODULE Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103491 spots for SRR7473342.sra Written 1103491 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra Read 1103476 spots for SRR7473342.sra Written 1103476 spots for SRR7473342.sra SRR ids: ['SRR7473342.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hwi1uwfk SRR7473342.sra spots: 22069535 blocks: [[1, 1103476], [1103477, 2206952], [2206953, 3310428], [3310429, 4413904], [4413905, 5517380], [5517381, 6620856], [6620857, 7724332], [7724333, 8827808], [8827809, 9931284], [9931285, 11034760], [11034761, 12138236], [12138237, 13241712], [13241713, 14345188], [14345189, 15448664], [15448665, 16552140], [16552141, 17655616], [17655617, 18759092], [18759093, 19862568], [19862569, 20966044], [20966045, 22069535]] SRR7473342 file size 7456940 SRR7473342 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473342 SRR7473342_1.fastq SRR7473342_2.fastq Input file: SRR7473342_1.fastq Paired file: SRR7473342_2.fastq trimmed: SRR7473342-trimmed-pair1.fastq, SRR7473342-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:13:40 2024 >> started Sat Dec 7 14:14:06 2024 >> done (26.310s) 22069535 read pairs processed; of these: 33222 ( 0.15%) short read pairs filtered out after trimming by size control 42345 ( 0.19%) empty read pairs filtered out after trimming by size control 21993968 (99.66%) read pairs available; of these: 12566420 (57.14%) trimmed read pairs available after processing 9427548 (42.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 26 0.00% 20 28 0.00% 21 35 0.00% 22 29 0.00% 23 21 0.00% 24 17 0.00% 25 34 0.00% 26 38 0.00% 27 31 0.00% 28 44 0.00% 29 34 0.00% 30 47 0.00% 31 38 0.00% 32 36 0.00% 33 46 0.00% 34 47 0.00% 35 44 0.00% 36 44 0.00% 37 53 0.00% 38 57 0.00% 39 61 0.00% 40 68 0.00% 41 60 0.00% 42 73 0.00% 43 85 0.00% 44 75 0.00% 45 97 0.00% 46 103 0.00% 47 110 0.00% 48 137 0.00% 49 155 0.00% 50 154 0.00% 51 186 0.00% 52 176 0.00% 53 187 0.00% 54 213 0.00% 55 235 0.00% 56 252 0.00% 57 244 0.00% 58 316 0.00% 59 392 0.00% 60 396 0.00% 61 445 0.00% 62 490 0.00% 63 508 0.00% 64 569 0.00% 65 694 0.00% 66 714 0.00% 67 813 0.00% 68 1086 0.00% 69 1714 0.01% 70 1555 0.01% 71 1291 0.01% 72 1353 0.01% 73 1477 0.01% 74 1626 0.01% 75 1739 0.01% 76 1879 0.01% 77 2153 0.01% 78 2284 0.01% 79 2573 0.01% 80 2818 0.01% 81 3258 0.01% 82 3776 0.02% 83 4353 0.02% 84 5885 0.03% 85 6415 0.03% 86 6835 0.03% 87 7052 0.03% 88 7610 0.03% 89 7901 0.04% 90 8327 0.04% 91 9390 0.04% 92 9884 0.04% 93 10987 0.05% 94 11832 0.05% 95 12655 0.06% 96 13105 0.06% 97 13549 0.06% 98 14054 0.06% 99 15011 0.07% 100 16441 0.07% 101 17088 0.08% 102 18232 0.08% 103 19558 0.09% 104 21087 0.10% 105 22668 0.10% 106 24211 0.11% 107 24353 0.11% 108 25378 0.12% 109 27469 0.12% 110 28614 0.13% 111 29778 0.14% 112 31099 0.14% 113 33867 0.15% 114 35295 0.16% 115 37871 0.17% 116 39112 0.18% 117 40372 0.18% 118 41552 0.19% 119 42891 0.20% 120 45170 0.21% 121 47172 0.21% 122 49785 0.23% 123 52560 0.24% 124 56770 0.26% 125 58631 0.27% 126 61201 0.28% 127 63257 0.29% 128 65261 0.30% 129 68569 0.31% 130 72108 0.33% 131 74430 0.34% 132 79629 0.36% 133 84031 0.38% 134 90646 0.41% 135 96612 0.44% 136 103225 0.47% 137 110971 0.50% 138 118889 0.54% 139 128640 0.58% 140 137809 0.63% 141 154034 0.70% 142 173775 0.79% 143 200847 0.91% 144 237432 1.08% 145 291215 1.32% 146 369567 1.68% 147 505635 2.30% 148 789220 3.59% 149 1480077 6.73% 150 5918106 26.91% 151 9427548 42.86% 21993968 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=35 prefix-density=0.70 prefix-fanout=2.0 sequence=GGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=13.64 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.8 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=3.0 sequence=CTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=108.69 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGA SRR7473342 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:14:56 Started mapping on | Dec 07 14:14:57 Finished on | Dec 07 14:19:28 Mapping speed, Million of reads per hour | 292.17 Number of input reads | 21993968 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20479401 Uniquely mapped reads % | 93.11% Average mapped length | 293.95 Number of splices: Total | 22210790 Number of splices: Annotated (sjdb) | 20896377 Number of splices: GT/AG | 21931463 Number of splices: GC/AG | 249033 Number of splices: AT/AC | 11108 Number of splices: Non-canonical | 19186 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181720 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 24028 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.26% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1350752 1350752 1350752 N_multimapping 181720 181720 181720 N_noFeature 768094 19742761 1022760 N_ambiguous 567594 3151 87319 UnstrandedReadsAssigned:19143713 PositiveStrandReadsAssigned:733489 NegativeStrandReadsAssigned:19369322 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473342 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473342-trimmed-pair1.fastq SRR7473342-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,993,968 reads, 19,441,110 reads pseudoaligned [quant] estimated average fragment length: 280.175 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR7473342.ke.tsv 35125 SRR7473342.se.tsv 88098 total ==> SRR7473342.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 657.97 0 0 PNS24247 1044 764.825 42.1596 3.79108 PNS24249 1928 1648.83 19.0685 0.795374 PNS24246 1044 764.825 42.1596 3.79108 PNS24248 1044 764.825 42.1596 3.79108 PNS24244 1471 1191.83 96.4527 5.56584 PNS24243 293 87.1328 0 0 KQK14069 1603 1323.83 195.041 10.1327 KQK14071 474 222.063 0 0 ==> SRR7473342.se.tsv <== BRADI_1g14170v3 199 BRADI_1g53295v3 524 BRADI_1g59795v3 617 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 1569 BRADI_1g74790v3 187 BRADI_1g09890v3 9 BRADI_1g77505v3 164 BRADI_1g48960v3 0 SRR7473342 completed mapping pipeline successfully