Starting /dee2/code/volunteer_pipeline.sh SRR7473344 current disk space = 1543023431680 free memory = 1602368172 SRR7473344 SRAfilesize 2a8515362a319cc0b7058da9edc867f9 SRR7473344.sra SRR7473344.sra file validated SRR7473344 is paired end SRR7473344 is conventional basespace SRR7473344 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473344_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98775 34.0 33.0 34.0 33.0 34.0 2 33.25 34.0 33.0 34.0 33.0 34.0 3 33.31975 34.0 33.0 34.0 33.0 34.0 4 33.44875 34.0 33.0 34.0 33.0 34.0 5 33.2745 34.0 33.0 34.0 33.0 34.0 6 36.931 38.0 37.0 38.0 35.0 38.0 7 37.32325 38.0 38.0 38.0 37.0 38.0 8 37.4045 38.0 38.0 38.0 37.0 38.0 9 37.464 38.0 38.0 38.0 37.0 38.0 10-14 37.47715 38.0 38.0 38.0 37.6 38.0 15-19 37.421499999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.450199999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.272149999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.1322 38.0 38.0 38.0 36.6 38.0 35-39 37.147099999999995 38.0 38.0 38.0 36.4 38.0 40-44 36.86704999999999 38.0 38.0 38.0 35.4 38.0 45-49 36.88014999999999 38.0 38.0 38.0 35.2 38.0 50-54 36.763149999999996 38.0 38.0 38.0 35.0 38.0 55-59 36.94135 38.0 38.0 38.0 35.2 38.0 60-64 36.7796 38.0 38.0 38.0 34.8 38.0 65-69 36.624249999999996 38.0 38.0 38.0 34.4 38.0 70-74 36.44369999999999 38.0 38.0 38.0 33.8 38.0 75-79 36.531549999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.39045 38.0 38.0 38.0 34.0 38.0 85-89 36.179550000000006 38.0 37.6 38.0 33.2 38.0 90-94 35.885749999999994 38.0 37.0 38.0 32.2 38.0 95-99 35.6292 38.0 36.6 38.0 31.0 38.0 100-104 35.470749999999995 38.0 36.2 38.0 30.4 38.0 105-109 35.3 38.0 35.8 38.0 29.4 38.0 110-114 34.966950000000004 38.0 35.2 38.0 28.0 38.0 115-119 34.50815 38.0 35.0 38.0 26.0 38.0 120-124 34.1237 38.0 34.4 38.0 23.4 38.0 125-129 33.67705 38.0 34.0 38.0 22.2 38.0 130-134 33.2456 38.0 33.8 38.0 17.4 38.0 135-139 32.50425 37.6 32.6 38.0 14.4 38.0 140-144 31.8769 36.6 32.2 38.0 13.6 38.0 145-149 30.300549999999998 36.0 30.4 38.0 6.4 38.0 150-151 25.35575 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 3.0 15 4.0 16 5.0 17 5.0 18 8.0 19 11.0 20 14.0 21 8.0 22 10.0 23 12.0 24 18.0 25 22.0 26 33.0 27 23.0 28 34.0 29 59.0 30 74.0 31 94.0 32 96.0 33 152.0 34 255.0 35 420.0 36 952.0 37 1683.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.7548125633232 13.5258358662614 10.055724417426545 35.66362715298885 2 25.921283529706695 14.790674354474806 31.937829029832038 27.350213085986464 3 22.825 22.175 25.650000000000002 29.349999999999998 4 26.200000000000003 27.900000000000002 21.95 23.95 5 26.649937264742785 32.220828105395235 20.677540777917187 20.451693851944793 6 23.125 32.0 22.375 22.5 7 19.15 21.125 38.05 21.675 8 23.175 21.325 26.025 29.475 9 21.175 20.474999999999998 31.424999999999997 26.924999999999997 10-14 24.45 23.77 24.065 27.715 15-19 23.945 24.884999999999998 24.575 26.595000000000002 20-24 23.955000000000002 24.529999999999998 24.765 26.75 25-29 24.32 24.175 24.490000000000002 27.015 30-34 23.69 24.43 25.019999999999996 26.86 35-39 23.936196809840492 24.08620431021551 25.29126456322816 26.686334316715836 40-44 23.993993993993996 24.11911911911912 24.864864864864867 27.022022022022025 45-49 24.66246624662466 23.692369236923692 24.647464746474647 26.997699769976997 50-54 23.990000000000002 24.255 24.485 27.27 55-59 24.855 24.325 23.91 26.91 60-64 24.29 24.015 24.625 27.07 65-69 24.91 23.89 24.41 26.790000000000003 70-74 24.84 24.32 24.065 26.775 75-79 24.66 24.169999999999998 24.025 27.145000000000003 80-84 24.55 24.545 24.135 26.77 85-89 24.62 23.74 24.63 27.01 90-94 24.589753852311386 23.514108465079048 24.419651791074646 27.476485891534917 95-99 25.289372150122762 23.92644184997745 23.79616174775768 26.988024252142107 100-104 24.68 23.775 23.69 27.855 105-109 24.84 23.669999999999998 24.03 27.46 110-114 24.68 24.08 23.94 27.3 115-119 25.435000000000002 23.645 24.21 26.71 120-124 24.686108748937023 24.095843129408234 23.675654044319945 27.5423940773348 125-129 25.30325814536341 23.29824561403509 24.250626566416038 27.147869674185465 130-134 25.549616780960065 23.870512303348125 23.845300524405 26.73457039128681 135-139 25.33628898181269 24.066703612272658 23.326112146707644 27.270895259207013 140-144 25.74376439947911 23.890614043874585 23.519983972753682 26.845637583892618 145-149 25.31486146095718 23.64735516372796 23.803526448362717 27.23425692695214 150-151 26.538607354985466 22.97485151017313 23.58144824971566 26.905092885125743 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.5 27 3.5 28 3.5 29 4.0 30 7.5 31 12.5 32 15.0 33 16.5 34 26.5 35 30.5 36 30.5 37 46.0 38 67.0 39 97.0 40 104.5 41 119.5 42 145.0 43 157.0 44 166.5 45 166.0 46 164.5 47 153.5 48 145.0 49 135.5 50 133.0 51 131.5 52 130.5 53 134.5 54 122.0 55 118.0 56 112.0 57 104.5 58 109.5 59 108.0 60 101.5 61 96.0 62 85.5 63 71.0 64 73.5 65 76.0 66 72.0 67 73.0 68 71.0 69 57.5 70 44.5 71 35.5 72 27.5 73 25.0 74 22.0 75 17.5 76 11.0 77 3.5 78 2.5 79 3.5 80 2.5 81 1.5 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.27499999999999997 3 0.0 4 0.0 5 0.375 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.1 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.06 95-99 0.215 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.045 125-129 0.25 130-134 0.84 135-139 0.755 140-144 0.16999999999999998 145-149 0.75 150-151 1.0875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36901121304791 96.5 2 1.4271151885830784 2.8000000000000003 3 0.127420998980632 0.375 4 0.05096839959225281 0.2 5 0.025484199796126403 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.0875 0.0 0.0 0.0 0.025 86-87 0.16249999999999998 0.0 0.0 0.0 0.025 88-89 0.2 0.0 0.0 0.0 0.025 90-91 0.21250000000000002 0.0 0.0 0.0 0.025 92-93 0.30000000000000004 0.0 0.0 0.0 0.025 94-95 0.35 0.0 0.0 0.0 0.025 96-97 0.3875 0.0 0.0 0.0 0.025 98-99 0.4625 0.0 0.0 0.0 0.025 100-101 0.5375 0.0 0.0 0.0 0.025 102-103 0.675 0.0 0.0 0.0 0.025 104-105 0.8625 0.0 0.0 0.0 0.025 106-107 1.2125 0.0 0.0 0.0 0.025 108-109 1.4125 0.0 0.0 0.0 0.025 110-111 1.5499999999999998 0.0 0.0 0.0 0.025 112-113 1.8125 0.0 0.0 0.0 0.025 114-115 2.0125 0.0 0.0 0.0 0.025 116-117 2.1625 0.0 0.0 0.0 0.025 118-119 2.4 0.0 0.0 0.0 0.025 120-121 2.6875 0.0 0.0 0.0 0.025 122-123 2.95 0.0 0.0 0.0 0.025 124-125 3.4125 0.0 0.0 0.0 0.025 126-127 3.725 0.0 0.0 0.0 0.025 128-129 4.1875 0.0 0.0 0.0 0.025 130-131 4.5375 0.0 0.0 0.0 0.025 132-133 5.0125 0.0 0.0 0.0 0.025 134-135 5.4625 0.0 0.0 0.0 0.025 136-137 5.8375 0.0 0.0 0.0 0.025 138-139 6.3625 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473344 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473344_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9205 33.0 33.0 34.0 31.0 34.0 2 32.176 33.0 33.0 34.0 31.0 34.0 3 32.09825 34.0 33.0 34.0 31.0 34.0 4 32.05475 34.0 33.0 34.0 31.0 34.0 5 32.00975 34.0 33.0 34.0 31.0 34.0 6 36.00725 38.0 38.0 38.0 34.0 38.0 7 36.29975 38.0 38.0 38.0 34.0 38.0 8 36.47375 38.0 38.0 38.0 35.0 38.0 9 36.49675 38.0 38.0 38.0 35.0 38.0 10-14 36.61409999999999 38.0 38.0 38.0 35.6 38.0 15-19 36.3731 38.0 38.0 38.0 34.6 38.0 20-24 35.93945000000001 38.0 38.0 38.0 34.0 38.0 25-29 36.16645 38.0 38.0 38.0 34.6 38.0 30-34 36.21225 38.0 38.0 38.0 35.0 38.0 35-39 36.21220000000001 38.0 38.0 38.0 34.8 38.0 40-44 36.139799999999994 38.0 38.0 38.0 34.8 38.0 45-49 36.0361 38.0 38.0 38.0 34.2 38.0 50-54 36.069 38.0 38.0 38.0 34.0 38.0 55-59 36.01665 38.0 38.0 38.0 34.0 38.0 60-64 35.896100000000004 38.0 38.0 38.0 33.8 38.0 65-69 35.54105 38.0 38.0 38.0 32.0 38.0 70-74 35.5929 38.0 38.0 38.0 32.0 38.0 75-79 35.56165 38.0 38.0 38.0 31.4 38.0 80-84 35.55955 38.0 38.0 38.0 32.4 38.0 85-89 35.386 38.0 38.0 38.0 31.0 38.0 90-94 35.13315 38.0 37.4 38.0 29.6 38.0 95-99 34.6303 38.0 36.8 38.0 26.8 38.0 100-104 33.84315 38.0 35.4 38.0 19.0 38.0 105-109 33.894349999999996 38.0 35.6 38.0 21.4 38.0 110-114 33.5289 38.0 35.0 38.0 16.2 38.0 115-119 33.02175 38.0 34.2 38.0 14.6 38.0 120-124 32.9396 38.0 34.0 38.0 14.2 38.0 125-129 32.69155 38.0 34.0 38.0 13.8 38.0 130-134 31.990250000000003 38.0 32.6 38.0 13.0 38.0 135-139 31.458050000000004 38.0 31.0 38.0 13.0 38.0 140-144 30.7143 38.0 30.2 38.0 4.2 38.0 145-149 29.35775 36.4 28.0 38.0 2.0 38.0 150-151 23.533125 31.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 17.0 4 31.0 5 4.0 6 2.0 7 1.0 8 2.0 9 3.0 10 2.0 11 3.0 12 9.0 13 6.0 14 11.0 15 14.0 16 15.0 17 12.0 18 11.0 19 10.0 20 19.0 21 15.0 22 16.0 23 32.0 24 46.0 25 17.0 26 30.0 27 29.0 28 42.0 29 56.0 30 60.0 31 92.0 32 96.0 33 128.0 34 199.0 35 308.0 36 701.0 37 1931.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1628145865434 18.361581920903955 12.198253723677452 30.277349768875194 2 32.95048494129658 20.571720265441552 24.757529351710055 21.72026544155181 3 24.974358974358974 24.512820512820515 25.82051282051282 24.69230769230769 4 27.068437180796735 30.694586312563843 18.38610827374872 23.850868232890704 5 29.22761098280729 30.664613805491403 18.116499871696178 21.99127534000513 6 24.193548387096776 32.61648745519714 19.35483870967742 23.835125448028673 7 24.011156186612574 15.973630831643002 35.19269776876268 24.822515212981745 8 26.16469403173004 21.75774364140015 20.851170989675143 31.22639133719466 9 24.586880320480724 21.832749123685527 25.58838257386079 27.99198798197296 10-14 26.85519454472523 24.177697553148818 22.021660649819495 26.945447252306458 15-19 27.154192146358717 23.692323242532975 22.671450952645678 26.48203365846263 20-24 26.716738197424895 24.575924790517064 22.312487226650315 26.394849785407725 25-29 27.256565246101488 24.22410727891502 21.86214253060395 26.65718494437954 30-34 26.981792361921187 25.140741492113406 22.036821017396154 25.840645128569257 35-39 27.159616068254532 24.102381798791324 22.685490833375653 26.05251129957849 40-44 27.653107745301657 23.70194012461375 22.58750823159921 26.05744389848539 45-49 27.424612876935615 23.818255908720456 23.130603096984515 25.626528117359413 50-54 27.592489498456402 23.80181183258262 22.804797813654538 25.80090085530644 55-59 27.233115468409586 23.91447535086386 22.774484470790902 26.07792470993565 60-64 27.021395537937693 23.524927580423846 23.60624078873812 25.847436092900338 65-69 26.940195426408142 23.42047372998414 22.98050851793114 26.658822325676574 70-74 27.23078483066315 23.098762928412086 23.519570066923546 26.150882174001218 75-79 27.28100343920696 23.229819947400365 23.255108233866075 26.234068379526605 80-84 27.385578039057375 23.419286471211585 22.894484533481354 26.300650956249683 85-89 27.619191461511356 23.33484367920254 22.896843377133365 26.149121482152747 90-94 27.437664707074806 23.935738901277112 22.947496452463003 25.67909993918508 95-99 27.258734800677235 23.790467395208044 23.22610435585655 25.72469344825817 100-104 27.75469934572645 23.80309481773808 22.76975802263994 25.67244781389552 105-109 27.354725001295943 24.15634233580426 22.684153232077133 25.80477943082266 110-114 28.237791932059448 23.820620371808815 22.981720263062503 24.959867433069235 115-119 27.58602846054334 24.413971539456664 22.566623544631305 25.433376455368695 120-124 27.518199184263516 23.491145645103 23.527285869172392 25.463369301461096 125-129 28.402795754594873 24.162567952368626 22.7025627750453 24.7320735179912 130-134 27.50879370991103 24.67928822677426 23.18435754189944 24.62756052141527 135-139 28.42067517032939 24.855284053071053 22.488602018339225 24.235438758260337 140-144 28.934686763047267 24.495027171126832 22.83912642263919 23.73115964318671 145-149 28.50308641975309 25.185185185185183 22.43827160493827 23.873456790123456 150-151 28.110297961317304 24.490329325666494 22.38630423418714 25.013068478829066 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.5 2 3.0 3 5.5 4 6.0 5 4.5 6 4.5 7 2.0 8 0.0 9 1.0 10 1.5 11 0.5 12 1.0 13 3.5 14 3.0 15 1.5 16 1.0 17 0.5 18 1.0 19 2.0 20 3.0 21 1.5 22 1.0 23 1.5 24 1.5 25 3.0 26 4.0 27 4.5 28 6.0 29 4.0 30 5.0 31 8.5 32 8.0 33 13.5 34 20.0 35 22.5 36 29.5 37 38.5 38 53.0 39 62.0 40 76.5 41 95.0 42 97.5 43 111.5 44 127.0 45 139.5 46 149.5 47 141.5 48 141.5 49 138.5 50 121.5 51 118.0 52 118.5 53 126.0 54 130.0 55 126.0 56 120.0 57 114.5 58 123.5 59 129.5 60 120.0 61 118.0 62 114.5 63 100.5 64 100.0 65 100.0 66 94.5 67 82.5 68 70.0 69 60.5 70 60.0 71 59.5 72 40.5 73 25.0 74 24.0 75 19.0 76 13.0 77 8.5 78 4.0 79 3.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 2.0500000000000003 3 2.5 4 2.1 5 2.5749999999999997 6 2.35 7 1.4000000000000001 8 0.7250000000000001 9 0.15 10-14 0.27999999999999997 15-19 1.065 20-24 2.1399999999999997 25-29 1.5650000000000002 30-34 1.415 35-39 1.545 40-44 1.295 45-49 1.8399999999999999 50-54 1.205 55-59 1.315 60-64 1.6150000000000002 65-69 2.265 70-74 1.38 75-79 1.1400000000000001 80-84 0.915 85-89 0.685 90-94 1.34 95-99 2.545 100-104 3.71 105-109 3.5450000000000004 110-114 3.4450000000000003 115-119 3.375 120-124 3.1550000000000002 125-129 3.4250000000000003 130-134 3.34 135-139 2.395 140-144 2.4699999999999998 145-149 2.8000000000000003 150-151 4.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2559630674532 95.775 2 1.3336753013593228 2.6 3 0.17953321364452424 0.525 4 0.12823800974608873 0.5 5 0.025647601949217745 0.125 6 0.05129520389843549 0.3 7 0.025647601949217745 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 7 0.17500000000000002 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit CGGGAACTCAAAGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG 6 0.15 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.725 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236433 spots for SRR7473344.sra Written 1236433 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra Read 1236417 spots for SRR7473344.sra Written 1236417 spots for SRR7473344.sra SRR ids: ['SRR7473344.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_225u9jl9 SRR7473344.sra spots: 24728356 blocks: [[1, 1236417], [1236418, 2472834], [2472835, 3709251], [3709252, 4945668], [4945669, 6182085], [6182086, 7418502], [7418503, 8654919], [8654920, 9891336], [9891337, 11127753], [11127754, 12364170], [12364171, 13600587], [13600588, 14837004], [14837005, 16073421], [16073422, 17309838], [17309839, 18546255], [18546256, 19782672], [19782673, 21019089], [21019090, 22255506], [22255507, 23491923], [23491924, 24728356]] SRR7473344 file size 8357928 SRR7473344 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473344 SRR7473344_1.fastq SRR7473344_2.fastq Input file: SRR7473344_1.fastq Paired file: SRR7473344_2.fastq trimmed: SRR7473344-trimmed-pair1.fastq, SRR7473344-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:18:21 2024 >> started Sat Dec 7 14:18:51 2024 >> done (29.884s) 24728356 read pairs processed; of these: 50251 ( 0.20%) short read pairs filtered out after trimming by size control 105391 ( 0.43%) empty read pairs filtered out after trimming by size control 24572714 (99.37%) read pairs available; of these: 14738313 (59.98%) trimmed read pairs available after processing 9834401 (40.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 20 0.00% 20 23 0.00% 21 23 0.00% 22 30 0.00% 23 29 0.00% 24 27 0.00% 25 39 0.00% 26 27 0.00% 27 45 0.00% 28 26 0.00% 29 51 0.00% 30 50 0.00% 31 64 0.00% 32 52 0.00% 33 65 0.00% 34 67 0.00% 35 63 0.00% 36 66 0.00% 37 83 0.00% 38 79 0.00% 39 79 0.00% 40 116 0.00% 41 115 0.00% 42 122 0.00% 43 153 0.00% 44 148 0.00% 45 155 0.00% 46 170 0.00% 47 210 0.00% 48 231 0.00% 49 278 0.00% 50 314 0.00% 51 297 0.00% 52 366 0.00% 53 367 0.00% 54 422 0.00% 55 439 0.00% 56 455 0.00% 57 518 0.00% 58 569 0.00% 59 614 0.00% 60 732 0.00% 61 879 0.00% 62 940 0.00% 63 1067 0.00% 64 1107 0.00% 65 1403 0.01% 66 1458 0.01% 67 1983 0.01% 68 2438 0.01% 69 4191 0.02% 70 3638 0.01% 71 2541 0.01% 72 2721 0.01% 73 3054 0.01% 74 3123 0.01% 75 3560 0.01% 76 3676 0.01% 77 3888 0.02% 78 4241 0.02% 79 5022 0.02% 80 5572 0.02% 81 6265 0.03% 82 7240 0.03% 83 8250 0.03% 84 10869 0.04% 85 11896 0.05% 86 11970 0.05% 87 12583 0.05% 88 13396 0.05% 89 14258 0.06% 90 15259 0.06% 91 16623 0.07% 92 17529 0.07% 93 19286 0.08% 94 21053 0.09% 95 22808 0.09% 96 23124 0.09% 97 23760 0.10% 98 24383 0.10% 99 25410 0.10% 100 27438 0.11% 101 28233 0.11% 102 30207 0.12% 103 32366 0.13% 104 34898 0.14% 105 37814 0.15% 106 38398 0.16% 107 38532 0.16% 108 40657 0.17% 109 43605 0.18% 110 44954 0.18% 111 44943 0.18% 112 47332 0.19% 113 52118 0.21% 114 53298 0.22% 115 56759 0.23% 116 57536 0.23% 117 58532 0.24% 118 59822 0.24% 119 60745 0.25% 120 63897 0.26% 121 65684 0.27% 122 69491 0.28% 123 72510 0.30% 124 78421 0.32% 125 79820 0.32% 126 82321 0.34% 127 85550 0.35% 128 87110 0.35% 129 90551 0.37% 130 94100 0.38% 131 97944 0.40% 132 103344 0.42% 133 109453 0.45% 134 116599 0.47% 135 124321 0.51% 136 132571 0.54% 137 140273 0.57% 138 148862 0.61% 139 158428 0.64% 140 169906 0.69% 141 189626 0.77% 142 210298 0.86% 143 240088 0.98% 144 279574 1.14% 145 335964 1.37% 146 426784 1.74% 147 577134 2.35% 148 866949 3.53% 149 1670297 6.80% 150 6511983 26.50% 151 9834401 40.02% 24572714 reads passed initial QC criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=21 prefix-density=0.95 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=90.69 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=8.3 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=26 prefix-density=1.19 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=30.35 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=1.0 sequence=TAAGCGTACACGGTGGATGCCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGATAAGCGTCGGTAAGGTGATATGAACCGTTATAACCGGCGATTTCCGAATGGGGAAACCCAGTGTGTTTCGACACACTATCATTAACTGAATCCATAGGTTAATGAGGCGAACCGGGGGAACTGAAACATCTAAGTACCCCGAGGAAAAGAAATCAACCGAGATTCCCCCAGTAGCGGCGAGCGAACGGGGAGCAGCCCAGAGCCTGAATCAGTGTGTGTGTTAGTGGAAGCGTCTGGAAAGGCGCGCGATACAGGGTGACAGCCCCGTACACAAAAATGCACATGCTGTGAGCTCGATGAGTAGGGCGGGACACGTGGTATCCTGTCTGAATATGGGGGGACCATCCTCCAAGGCTAAATACTCCTGACTGACCGATAGTGAACCAGTACCGTGAGGGAAAGGCGAAAAGAACCCCGGCGAGGGGAGTGAAAAAGAACCTGAAACCGTGTA SRR7473344 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:19:49 Started mapping on | Dec 07 14:19:50 Finished on | Dec 07 14:24:59 Mapping speed, Million of reads per hour | 286.28 Number of input reads | 24572714 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 22555489 Uniquely mapped reads % | 91.79% Average mapped length | 292.20 Number of splices: Total | 22251943 Number of splices: Annotated (sjdb) | 20963003 Number of splices: GT/AG | 21967135 Number of splices: GC/AG | 250119 Number of splices: AT/AC | 10707 Number of splices: Non-canonical | 23982 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 185653 % of reads mapped to multiple loci | 0.76% Number of reads mapped to too many loci | 18649 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.66% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1857182 1857182 1857182 N_multimapping 185653 185653 185653 N_noFeature 655359 21786607 925101 N_ambiguous 608009 3528 109439 UnstrandedReadsAssigned:21292121 PositiveStrandReadsAssigned:765354 NegativeStrandReadsAssigned:21520949 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473344 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473344-trimmed-pair1.fastq SRR7473344-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,572,714 reads, 21,560,351 reads pseudoaligned [quant] estimated average fragment length: 269.221 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR7473344.ke.tsv 35125 SRR7473344.se.tsv 88098 total ==> SRR7473344.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.561 53.1767 4.35063 PNS24247 1044 775.779 35.3958 2.49566 PNS24249 1928 1659.78 107.298 3.536 PNS24246 1044 775.779 35.3958 2.49566 PNS24248 1044 775.779 35.3958 2.49566 PNS24244 1471 1202.78 52.3381 2.38015 PNS24243 293 91.9208 0 0 KQK14069 1603 1334.78 3639.14 149.129 KQK14071 474 229.719 44.934 10.6992 ==> SRR7473344.se.tsv <== BRADI_1g14170v3 3948 BRADI_1g53295v3 495 BRADI_1g59795v3 1277 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 1930 BRADI_1g74790v3 147 BRADI_1g09890v3 6 BRADI_1g77505v3 283 BRADI_1g48960v3 0 SRR7473344 completed mapping pipeline successfully