Starting /dee2/code/volunteer_pipeline.sh SRR7473345 current disk space = 1543054528512 free memory = 1599632496 SRR7473345 SRAfilesize 75c1ab7372a5bb07dff6cbe92fb7ba86 SRR7473345.sra SRR7473345.sra file validated SRR7473345 is paired end SRR7473345 is conventional basespace SRR7473345 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473345_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.41975 34.0 33.0 34.0 33.0 34.0 2 33.382 34.0 34.0 34.0 33.0 34.0 3 33.42275 34.0 34.0 34.0 33.0 34.0 4 33.393 34.0 34.0 34.0 33.0 34.0 5 33.3405 34.0 34.0 34.0 33.0 34.0 6 36.96725 38.0 37.0 38.0 36.0 38.0 7 37.33025 38.0 38.0 38.0 36.0 38.0 8 37.41275 38.0 38.0 38.0 37.0 38.0 9 37.47425 38.0 38.0 38.0 37.0 38.0 10-14 37.391749999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.31155 38.0 38.0 38.0 37.0 38.0 20-24 37.4214 38.0 38.0 38.0 37.0 38.0 25-29 37.2845 38.0 38.0 38.0 37.0 38.0 30-34 37.14675 38.0 38.0 38.0 36.6 38.0 35-39 36.968450000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.808499999999995 38.0 38.0 38.0 35.0 38.0 45-49 36.747 38.0 38.0 38.0 35.0 38.0 50-54 36.708650000000006 38.0 38.0 38.0 34.8 38.0 55-59 36.823049999999995 38.0 38.0 38.0 35.0 38.0 60-64 36.715 38.0 38.0 38.0 34.8 38.0 65-69 36.507000000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.390249999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.2799 38.0 38.0 38.0 33.8 38.0 80-84 36.19895 38.0 38.0 38.0 33.8 38.0 85-89 36.0917 38.0 37.8 38.0 33.4 38.0 90-94 35.7802 38.0 37.0 38.0 32.0 38.0 95-99 35.6137 38.0 36.8 38.0 31.2 38.0 100-104 35.4798 38.0 36.0 38.0 31.0 38.0 105-109 35.265550000000005 38.0 36.0 38.0 29.6 38.0 110-114 34.9611 38.0 35.6 38.0 28.6 38.0 115-119 34.74515 38.0 35.0 38.0 27.4 38.0 120-124 34.47025 38.0 35.0 38.0 26.0 38.0 125-129 33.8233 38.0 34.2 38.0 21.8 38.0 130-134 33.42865 38.0 34.0 38.0 21.0 38.0 135-139 33.0719 38.0 34.0 38.0 16.2 38.0 140-144 32.259100000000004 38.0 32.6 38.0 13.8 38.0 145-149 31.41635 37.2 32.6 38.0 8.6 38.0 150-151 26.87225 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 2.0 9 1.0 10 2.0 11 1.0 12 3.0 13 7.0 14 4.0 15 3.0 16 4.0 17 8.0 18 12.0 19 12.0 20 13.0 21 6.0 22 12.0 23 9.0 24 16.0 25 12.0 26 34.0 27 26.0 28 46.0 29 35.0 30 60.0 31 81.0 32 97.0 33 149.0 34 209.0 35 378.0 36 889.0 37 1867.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.36836836836837 14.564564564564563 9.55955955955956 32.507507507507505 2 25.71428571428571 16.99248120300752 31.654135338345863 25.6390977443609 3 21.4 23.0 25.35 30.25 4 25.3 27.650000000000002 22.525000000000002 24.525 5 25.570318375532715 32.33893206317372 22.186011531712207 19.90473802958135 6 22.05 32.2 22.775000000000002 22.975 7 17.125 21.925 38.925 22.025 8 20.5 21.925 28.425 29.15 9 21.349999999999998 21.325 29.675 27.650000000000002 10-14 23.095 24.775 24.665 27.465 15-19 23.535 24.9 25.095 26.47 20-24 22.93 25.369999999999997 24.725 26.974999999999998 25-29 23.39 25.319999999999997 25.374999999999996 25.915 30-34 23.45 24.82 24.81 26.919999999999998 35-39 23.226258380866607 25.007505253677575 24.887421194836385 26.878815170619436 40-44 23.385601923751313 25.890486448574723 24.502780421822553 26.22113120585141 45-49 23.681049154069473 24.466913604965463 25.638202022224448 26.213835218740616 50-54 22.887288728872885 24.602460246024602 25.03750375037504 27.47274727472747 55-59 23.46 24.37 25.14 27.029999999999998 60-64 23.724999999999998 24.815 24.905 26.555 65-69 23.362336233623363 24.63746374637464 25.412541254125415 26.587658765876586 70-74 23.56 24.740000000000002 24.83 26.87 75-79 23.43022964927203 25.27642967929154 24.435883324160702 26.85745734727573 80-84 23.214285714285715 25.40516206482593 24.494797919167667 26.885754301720688 85-89 24.06221866559968 24.712413724117237 24.487346203861158 26.738021406421925 90-94 23.582358235823584 24.547454745474546 24.242424242424242 27.627762776277624 95-99 24.264705882352942 24.54981992797119 24.729891956782712 26.45558223289316 100-104 24.125 24.465 24.6 26.810000000000002 105-109 24.402440244024405 24.71747174717472 24.327432743274326 26.552655265526553 110-114 24.284856971394277 25.055011002200438 24.054810962192438 26.605321064212845 115-119 24.125 24.63 24.645 26.6 120-124 24.115000000000002 25.0 23.765 27.12 125-129 24.546910984279563 24.371683188144587 24.22148793431461 26.859917893261237 130-134 24.240895793402604 25.032785231514172 24.140018157974378 26.58630081710885 135-139 24.173168890007553 25.028945381323936 24.188270828089607 26.609614900578908 140-144 24.377063944761332 25.24767337135995 23.55148604022816 26.823776643650554 145-149 23.976490681669766 25.20219018435726 24.02170090922791 26.799618224745064 150-151 24.358006042296072 24.949647532729106 23.930010070493456 26.76233635448137 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.0 27 2.5 28 3.0 29 4.0 30 5.0 31 9.5 32 13.0 33 15.0 34 25.0 35 38.0 36 49.5 37 58.5 38 72.5 39 88.0 40 106.5 41 126.5 42 148.0 43 163.5 44 167.5 45 164.0 46 159.0 47 164.0 48 169.0 49 173.0 50 169.0 51 150.5 52 144.0 53 153.0 54 146.0 55 142.0 56 137.5 57 114.5 58 98.0 59 94.0 60 86.5 61 79.5 62 69.5 63 52.0 64 59.5 65 65.0 66 59.0 67 54.5 68 43.5 69 37.5 70 31.0 71 23.5 72 18.0 73 13.5 74 10.5 75 7.0 76 2.5 77 1.5 78 3.0 79 3.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.25 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06999999999999999 40-44 0.19499999999999998 45-49 0.11 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.065 80-84 0.04 85-89 0.03 90-94 0.01 95-99 0.04 100-104 0.0 105-109 0.01 110-114 0.02 115-119 0.0 120-124 0.0 125-129 0.13 130-134 0.8699999999999999 135-139 0.675 140-144 0.06999999999999999 145-149 0.46499999999999997 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12387561038294 95.45 2 1.4135183757388847 2.75 3 0.3855050115651504 1.125 4 0.02570033410434336 0.1 5 0.0 0.0 6 0.02570033410434336 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02570033410434336 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 17 0.42500000000000004 TruSeq Adapter, Index 6 (100% over 50bp) GGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.0374999999999996 0.0 0.0 0.0 0.0 114-115 3.4 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.25 0.0 0.0 0.0 0.0 120-121 4.612500000000001 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.3875 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.775 0.0 0.0 0.0 0.0 138-139 8.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCAA 10 0.006882143 144.6375 4 AAAAAAA 160 4.0548472E-4 9.039844 65-69 >>END_MODULE SRR7473345 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473345_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.042 33.0 33.0 34.0 31.0 34.0 2 32.24675 33.0 33.0 34.0 32.0 34.0 3 32.084 34.0 33.0 34.0 31.0 34.0 4 32.178 34.0 33.0 34.0 31.0 34.0 5 32.08625 34.0 33.0 34.0 32.0 34.0 6 36.09125 38.0 38.0 38.0 34.0 38.0 7 36.232 38.0 38.0 38.0 35.0 38.0 8 36.4665 38.0 38.0 38.0 35.0 38.0 9 36.54675 38.0 38.0 38.0 35.0 38.0 10-14 36.61085 38.0 38.0 38.0 35.8 38.0 15-19 36.276149999999994 38.0 38.0 38.0 35.2 38.0 20-24 36.01174999999999 38.0 38.0 38.0 34.4 38.0 25-29 36.054700000000004 38.0 38.0 38.0 34.6 38.0 30-34 36.06155 38.0 38.0 38.0 34.4 38.0 35-39 36.00435 38.0 38.0 38.0 34.6 38.0 40-44 36.032849999999996 38.0 38.0 38.0 34.4 38.0 45-49 35.942750000000004 38.0 38.0 38.0 34.2 38.0 50-54 35.98465 38.0 38.0 38.0 34.0 38.0 55-59 35.94665 38.0 38.0 38.0 34.0 38.0 60-64 35.8376 38.0 38.0 38.0 33.8 38.0 65-69 35.4408 38.0 38.0 38.0 32.6 38.0 70-74 35.5264 38.0 38.0 38.0 32.8 38.0 75-79 35.6044 38.0 38.0 38.0 33.6 38.0 80-84 35.388400000000004 38.0 38.0 38.0 32.6 38.0 85-89 35.22185 38.0 38.0 38.0 30.6 38.0 90-94 35.15925 38.0 38.0 38.0 30.8 38.0 95-99 34.7646 38.0 37.4 38.0 28.0 38.0 100-104 34.046299999999995 38.0 36.4 38.0 21.6 38.0 105-109 33.914049999999996 38.0 36.0 38.0 20.2 38.0 110-114 33.7631 38.0 35.6 38.0 17.4 38.0 115-119 33.381800000000005 38.0 35.0 38.0 14.8 38.0 120-124 33.331149999999994 38.0 35.0 38.0 14.6 38.0 125-129 33.065400000000004 38.0 34.8 38.0 14.2 38.0 130-134 32.38334999999999 38.0 34.0 38.0 13.2 38.0 135-139 32.1112 38.0 33.2 38.0 13.0 38.0 140-144 31.456650000000003 38.0 31.6 38.0 6.4 38.0 145-149 30.267450000000004 38.0 30.4 38.0 2.0 38.0 150-151 25.45275 34.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 48.0 4 13.0 5 4.0 6 3.0 7 2.0 8 4.0 9 2.0 10 4.0 11 5.0 12 4.0 13 2.0 14 13.0 15 11.0 16 9.0 17 19.0 18 13.0 19 7.0 20 10.0 21 15.0 22 24.0 23 23.0 24 23.0 25 33.0 26 17.0 27 32.0 28 31.0 29 36.0 30 58.0 31 59.0 32 106.0 33 117.0 34 143.0 35 276.0 36 646.0 37 2150.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.44616950878086 17.10358869941461 11.224230083990836 28.22601170781369 2 31.068702290076335 22.010178117048344 26.208651399491096 20.712468193384222 3 23.70579190158893 25.499743721168635 26.883649410558686 23.910814966683752 4 27.649301143583227 31.435832274459973 18.57687420584498 22.337992376111817 5 28.907649015093373 33.38449731389102 18.188795088257866 19.51905858275774 6 25.968399592252805 32.415902140672785 18.654434250764528 22.961264016309887 7 24.866649733299468 17.4498348996698 34.11226822453645 23.571247142494283 8 25.692695214105793 21.536523929471034 23.047858942065492 29.72292191435768 9 24.956107348883872 22.297466766992727 25.382493102583396 27.363932781540008 10-14 26.31922150882825 24.583667736757626 22.67255216693419 26.424558587479936 15-19 27.02086709886548 24.027552674230147 23.33367098865478 25.61790923824959 20-24 27.354168787539447 24.63605823068309 23.032678407818384 24.977094573959075 25-29 26.51880424300868 25.15860528853474 23.34162310308075 24.980967365375832 30-34 27.50647898775344 24.36607551196707 23.436150210884698 24.691295289394784 35-39 26.671078755790866 25.13872626380899 22.95474214732984 25.235452833070305 40-44 27.097494166582127 24.586588211423354 23.389469412600185 24.92644820939434 45-49 26.8180658331207 24.393978055626437 24.06736412350089 24.720591987751977 50-54 26.97204890173997 23.994318470045148 23.776188302135644 25.257444326079238 55-59 26.895572348734593 24.527057868844146 24.187249581579348 24.390120200841913 60-64 27.201138037900723 24.869176446679873 23.456790123456788 24.472895391962606 65-69 26.715912588488766 24.756335282651072 24.222837796245 24.304914332615162 70-74 27.581838451403666 24.809972636059594 23.43164082294517 24.176548089591567 75-79 26.857345707185964 25.24975911557381 23.378467467924338 24.51442770931589 80-84 27.147038046220608 25.315369865778585 23.342415985467756 24.19517610253305 85-89 27.3980875691998 24.47911424257675 23.397081026673376 24.725717161550076 90-94 26.813386502448132 24.69839987885518 24.04724647922871 24.440967139467972 95-99 27.040972718912844 24.501890262593236 23.444364973945028 25.012772044548893 100-104 28.094619183779567 24.928515726540162 23.904341044970106 23.072524044710164 105-109 26.71676600155481 25.55066079295154 23.472402176729723 24.260171028763928 110-114 26.969964206048658 25.408517922913315 23.769258702080197 23.852259168957826 115-119 27.586385000774754 24.735292598522804 23.2632611951862 24.415061205516245 120-124 28.035935563816604 25.10326311441553 23.471705906650143 23.38909541511772 125-129 27.995451256073604 25.29721906337227 23.395017057789723 23.312312622764395 130-134 27.86520343720882 25.473651516720157 23.43410290920385 23.22704213686717 135-139 28.141629144494473 25.52189930413426 23.57245190339746 22.7640196479738 140-144 27.996110940538326 26.3176747518166 23.29853648551837 22.3876778221267 145-149 28.508658568105457 25.370896872576893 23.613336779529597 22.507107779788058 150-151 28.788076872793827 25.951104719571184 24.27768335730161 20.983135050333377 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 5.5 2 3.0 3 4.5 4 5.0 5 3.5 6 2.5 7 1.5 8 1.0 9 1.5 10 1.5 11 0.5 12 1.5 13 4.5 14 4.5 15 2.5 16 1.5 17 2.0 18 3.0 19 3.5 20 2.0 21 1.0 22 2.0 23 1.5 24 1.5 25 1.0 26 1.0 27 2.0 28 4.5 29 6.5 30 6.0 31 5.5 32 8.5 33 12.0 34 15.5 35 25.0 36 26.5 37 44.0 38 66.0 39 64.5 40 66.0 41 90.5 42 117.5 43 131.5 44 144.0 45 150.5 46 158.5 47 162.5 48 159.0 49 163.0 50 162.5 51 157.5 52 157.0 53 145.0 54 143.5 55 142.0 56 127.5 57 121.5 58 118.5 59 120.0 60 117.5 61 101.5 62 92.0 63 80.5 64 67.0 65 65.0 66 61.0 67 57.0 68 57.0 69 50.0 70 37.5 71 32.5 72 26.5 73 17.0 74 12.5 75 11.0 76 10.0 77 6.5 78 2.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 1.7500000000000002 3 2.45 4 1.625 5 2.275 6 1.9 7 1.575 8 0.75 9 0.325 10-14 0.32 15-19 1.28 20-24 1.77 25-29 1.485 30-34 1.6049999999999998 35-39 1.7850000000000001 40-44 1.43 45-49 2.025 50-54 1.435 55-59 1.415 60-64 1.585 65-69 2.53 70-74 1.3299999999999998 75-79 1.405 80-84 0.91 85-89 0.65 90-94 0.9450000000000001 95-99 2.13 100-104 3.8249999999999997 105-109 3.5249999999999995 110-114 3.615 115-119 3.195 120-124 3.16 125-129 3.27 130-134 3.4099999999999997 135-139 2.2800000000000002 140-144 2.29 145-149 3.2750000000000004 150-151 4.387499999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.01136363636364 94.875 2 1.5754132231404958 3.05 3 0.15495867768595042 0.44999999999999996 4 0.05165289256198347 0.2 5 0.10330578512396695 0.5 6 0.05165289256198347 0.3 7 0.025826446280991736 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025826446280991736 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 18 0.44999999999999996 Illumina Single End PCR Primer 1 (100% over 50bp) GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 7 0.17500000000000002 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGC 6 0.15 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit CAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTA 5 0.125 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.4749999999999996 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 3.9000000000000004 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.5 0.0 0.0 0.0 0.0 124-125 4.875 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.575 0.0 0.0 0.0 0.0 130-131 5.925 0.0 0.0 0.0 0.0 132-133 6.4 0.0 0.0 0.0 0.0 134-135 6.862500000000001 0.0 0.0 0.0 0.0 136-137 7.35 0.0 0.0 0.0 0.0 138-139 7.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTTCA 10 0.0069631604 144.02563 4 CTCTGCT 10 0.007518016 140.425 8 TCTGCTT 10 0.007518016 140.425 9 TTGTGCT 10 0.007518016 140.425 8 TGTGCTT 10 0.007518016 140.425 9 >>END_MODULE Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164862 spots for SRR7473345.sra Written 1164862 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra Read 1164854 spots for SRR7473345.sra Written 1164854 spots for SRR7473345.sra SRR ids: ['SRR7473345.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_65t7vkfy SRR7473345.sra spots: 23297088 blocks: [[1, 1164854], [1164855, 2329708], [2329709, 3494562], [3494563, 4659416], [4659417, 5824270], [5824271, 6989124], [6989125, 8153978], [8153979, 9318832], [9318833, 10483686], [10483687, 11648540], [11648541, 12813394], [12813395, 13978248], [13978249, 15143102], [15143103, 16307956], [16307957, 17472810], [17472811, 18637664], [18637665, 19802518], [19802519, 20967372], [20967373, 22132226], [22132227, 23297088]] SRR7473345 file size 7872918 SRR7473345 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473345 SRR7473345_1.fastq SRR7473345_2.fastq Input file: SRR7473345_1.fastq Paired file: SRR7473345_2.fastq trimmed: SRR7473345-trimmed-pair1.fastq, SRR7473345-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:20:46 2024 >> started Sat Dec 7 14:21:13 2024 >> done (26.888s) 23297088 read pairs processed; of these: 61042 ( 0.26%) short read pairs filtered out after trimming by size control 158492 ( 0.68%) empty read pairs filtered out after trimming by size control 23077554 (99.06%) read pairs available; of these: 13314145 (57.69%) trimmed read pairs available after processing 9763409 (42.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 41 0.00% 20 36 0.00% 21 28 0.00% 22 31 0.00% 23 32 0.00% 24 43 0.00% 25 36 0.00% 26 32 0.00% 27 47 0.00% 28 40 0.00% 29 52 0.00% 30 58 0.00% 31 64 0.00% 32 54 0.00% 33 64 0.00% 34 61 0.00% 35 55 0.00% 36 66 0.00% 37 87 0.00% 38 93 0.00% 39 119 0.00% 40 141 0.00% 41 159 0.00% 42 135 0.00% 43 157 0.00% 44 159 0.00% 45 199 0.00% 46 221 0.00% 47 281 0.00% 48 281 0.00% 49 331 0.00% 50 449 0.00% 51 503 0.00% 52 540 0.00% 53 566 0.00% 54 564 0.00% 55 592 0.00% 56 669 0.00% 57 773 0.00% 58 774 0.00% 59 899 0.00% 60 1020 0.00% 61 1258 0.01% 62 1339 0.01% 63 1611 0.01% 64 1691 0.01% 65 2075 0.01% 66 2649 0.01% 67 4164 0.02% 68 6238 0.03% 69 11462 0.05% 70 14526 0.06% 71 8615 0.04% 72 6451 0.03% 73 5622 0.02% 74 5584 0.02% 75 5579 0.02% 76 5841 0.03% 77 6269 0.03% 78 6612 0.03% 79 7355 0.03% 80 8224 0.04% 81 9271 0.04% 82 10723 0.05% 83 12645 0.05% 84 15723 0.07% 85 16679 0.07% 86 16958 0.07% 87 17501 0.08% 88 18501 0.08% 89 18912 0.08% 90 20633 0.09% 91 22192 0.10% 92 23875 0.10% 93 27043 0.12% 94 28322 0.12% 95 30131 0.13% 96 30066 0.13% 97 29582 0.13% 98 28997 0.13% 99 30488 0.13% 100 32715 0.14% 101 33001 0.14% 102 35473 0.15% 103 38355 0.17% 104 40368 0.17% 105 43642 0.19% 106 43424 0.19% 107 42767 0.19% 108 44011 0.19% 109 46745 0.20% 110 47992 0.21% 111 46807 0.20% 112 49446 0.21% 113 55855 0.24% 114 55840 0.24% 115 59151 0.26% 116 60747 0.26% 117 59398 0.26% 118 60757 0.26% 119 61040 0.26% 120 63553 0.28% 121 64661 0.28% 122 68085 0.30% 123 72455 0.31% 124 77375 0.34% 125 79036 0.34% 126 80799 0.35% 127 82446 0.36% 128 83726 0.36% 129 85889 0.37% 130 87740 0.38% 131 91268 0.40% 132 96592 0.42% 133 102275 0.44% 134 108300 0.47% 135 115864 0.50% 136 121760 0.53% 137 128817 0.56% 138 134953 0.58% 139 142234 0.62% 140 150134 0.65% 141 164956 0.71% 142 179602 0.78% 143 204392 0.89% 144 236362 1.02% 145 282103 1.22% 146 351172 1.52% 147 468829 2.03% 148 709260 3.07% 149 1368398 5.93% 150 5821596 25.23% 151 9763409 42.31% 23077554 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=21 prefix-density=1.08 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=137.87 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=16.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=24 prefix-density=0.88 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=22.94 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCAATTGAGGGCATCAA SRR7473345 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:22:02 Started mapping on | Dec 07 14:22:02 Finished on | Dec 07 14:28:19 Mapping speed, Million of reads per hour | 220.37 Number of input reads | 23077554 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 20617356 Uniquely mapped reads % | 89.34% Average mapped length | 291.34 Number of splices: Total | 21807461 Number of splices: Annotated (sjdb) | 20531223 Number of splices: GT/AG | 21537894 Number of splices: GC/AG | 238569 Number of splices: AT/AC | 8171 Number of splices: Non-canonical | 22827 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 171873 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 40236 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.41% % of reads unmapped: other | 1.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2317216 2317216 2317216 N_multimapping 171873 171873 171873 N_noFeature 647296 19913316 957907 N_ambiguous 445614 2639 52492 UnstrandedReadsAssigned:19524446 PositiveStrandReadsAssigned:701401 NegativeStrandReadsAssigned:19606957 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473345 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473345-trimmed-pair1.fastq SRR7473345-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,077,554 reads, 19,685,460 reads pseudoaligned [quant] estimated average fragment length: 266.103 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR7473345.ke.tsv 35125 SRR7473345.se.tsv 88098 total ==> SRR7473345.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.703 0 0 PNS24247 1044 778.897 71.0345 5.77872 PNS24249 1928 1662.9 54.3652 2.07156 PNS24246 1044 778.897 71.0345 5.77872 PNS24248 1044 778.897 71.0345 5.77872 PNS24244 1471 1205.9 184.531 9.69622 PNS24243 293 94.8024 0 0 KQK14069 1603 1337.9 22914.1 1085.23 KQK14071 474 232.288 510.482 139.25 ==> SRR7473345.se.tsv <== BRADI_1g14170v3 26589 BRADI_1g53295v3 12 BRADI_1g59795v3 152 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 1519 BRADI_1g74790v3 683 BRADI_1g09890v3 3 BRADI_1g77505v3 127 BRADI_1g48960v3 0 SRR7473345 completed mapping pipeline successfully