Starting /dee2/code/volunteer_pipeline.sh SRR7473346 current disk space = 2825397784576 free memory = 1575301932 SRR7473346_1.fastq is conventional basespace SRR7473346_1.fastq read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 24252002 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 2.4252002E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.065933657423244 10.945667673158956 11.983707332055797 43.004691337362 2 23.770829311328605 16.412809961008577 34.98707859252197 24.829282135140843 3 22.017114298440184 20.181001964291443 23.179187433680735 34.62269630358764 4 26.338407031304058 28.504108650494093 20.50478966643661 24.652694651765245 5 26.035613956481672 31.550618583655453 22.73264050908027 19.681126950782602 6 21.174253280895577 32.896973283554324 24.01628385892111 21.91248957662899 7 17.30184996686047 21.455358613280666 40.82808503809294 20.414706381765928 8 20.759465548452454 21.804958617437027 29.36938979305708 28.066186041053438 9 20.04237423368182 20.77769497132649 32.846257393513326 26.333673401478357 10-14 23.069821617200923 25.9788284695012 25.017688848945337 25.933661064352542 15-19 22.998835312647593 25.21346072790197 25.89513476042102 25.892569199029424 20-24 22.868197850222842 25.474165802889182 25.874127010215485 25.783509336672495 25-29 23.012201268606287 25.477978724107864 25.67140162312477 25.838418384161084 30-34 22.897101441494584 25.39741752490808 25.699896836938375 26.005584196658965 35-39 23.055425404171555 25.35052706170341 25.685519837912818 25.908527696212225 40-44 23.158399938323015 25.362211930248286 25.61935399195383 25.860034139474873 45-49 23.10896215003934 25.258223769522914 25.56739959330144 26.06541448713631 50-54 23.140748393377617 25.262624467717075 25.603368338493325 25.993258800411983 55-59 23.281211170563594 25.29199406304592 25.488380348239314 25.93841441815117 60-64 23.279322724608505 25.093964313980184 25.516011193182013 26.1107017682293 65-69 23.27763609403194 25.21124259148658 25.54897127329705 25.962150041184433 70-74 23.46184863381087 25.21157907214607 25.37204639577298 25.954525898270088 75-79 23.450044570476965 25.14590416690124 25.344089838958894 26.059961423662898 80-84 23.43183007574215 25.10439454176422 25.48753669925194 25.976238683241693 85-89 23.54806064367314 25.1132355577132 25.376424552393345 25.96227924622032 90-94 23.644269183399757 25.002330791524596 25.320313844573427 26.033086180502217 95-99 23.62283426720026 24.977002824646828 25.46690576928068 25.93325713887223 100-104 23.78837205581606 25.15101661052414 25.235082782120532 25.825528551539268 105-109 23.726322727276365 24.98946248187897 25.26726666639341 26.016948124451254 110-114 23.773565016370885 25.0951782871631 25.264753230356483 25.86650346610953 115-119 23.85018214316599 25.119335561628723 25.140528597427934 25.889953697777347 120-124 23.885631187553162 25.079143100248828 25.027021546593897 26.008204165604116 125-129 23.931794269144305 25.055907060061788 25.10660908100245 25.905689589791457 130-134 24.05368367215108 25.17894564256446 24.947146130202725 25.820224555081733 135-139 23.991231943434947 25.13318874896874 24.921719023490446 25.95386028410587 140-144 24.098444966693172 25.196961286071616 24.86351778436816 25.841075962867045 145-149 24.06740415458381 25.317894657668845 24.790677447645447 25.824023740101897 150-151 24.131848016160124 25.03533944485762 24.787706627864996 26.04510591111726 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 310.0 1 301.5 2 277.0 3 235.0 4 196.5 5 166.0 6 163.0 7 169.5 8 142.0 9 129.5 10 141.0 11 145.0 12 133.0 13 108.5 14 105.5 15 143.5 16 180.5 17 183.5 18 228.5 19 354.5 20 464.0 21 678.0 22 1044.0 23 1623.0 24 2641.5 25 4210.0 26 7124.5 27 11878.0 28 18360.0 29 28146.5 30 42132.5 31 61095.0 32 85986.5 33 119602.0 34 162761.0 35 219209.5 36 293603.5 37 386699.5 38 495365.5 39 616014.5 40 750351.0 41 893334.0 42 1020191.5 43 1113626.5 44 1183939.0 45 1227703.5 46 1237908.0 47 1208887.0 48 1149129.5 49 1079884.5 50 1006359.0 51 926235.0 52 853788.5 53 786014.0 54 712930.0 55 647232.0 56 578025.5 57 519760.0 58 478162.0 59 437113.5 60 401205.0 61 369723.5 62 341711.5 63 321088.5 64 311482.0 65 303214.0 66 284378.5 67 263895.5 68 243401.5 69 217399.0 70 190488.0 71 156835.0 72 125685.5 73 103889.0 74 82419.5 75 60661.5 76 40275.5 77 25194.0 78 15469.5 79 9045.0 80 5204.0 81 2970.5 82 1656.5 83 888.0 84 447.5 85 195.0 86 110.0 87 67.5 88 37.0 89 24.5 90 17.0 91 9.0 92 7.5 93 6.0 94 7.0 95 6.5 96 4.0 97 1.5 98 1.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17255482660771676 2 0.0 3 0.0 4 0.0 5 0.02960992663615977 6 4.535708021135739E-5 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 2.671944361541781E-4 30-34 0.002029523170911828 35-39 0.12807932310083103 40-44 0.26409943393539226 45-49 0.09139204260332817 50-54 0.001948705100717046 55-59 4.3212927328638686E-4 60-64 0.0027527624317365633 65-69 0.008505689550908004 70-74 0.0070369448262456846 75-79 0.009556324463440173 80-84 0.019418603049760595 85-89 0.010340589614003824 90-94 0.002407223947944586 95-99 0.002248886504297666 100-104 0.002597723684832287 105-109 0.0042693382591672225 110-114 0.003206333233850137 115-119 0.002635658697372695 120-124 0.002533399098350726 125-129 0.002074880251123186 130-134 0.006799438660775304 135-139 0.004761668748006866 140-144 0.0026274119555160847 145-149 0.005731485590344253 150-151 0.009017812220203512 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 2.4252002E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 37.81487751048081 #Duplication Level Percentage of deduplicated Percentage of total 1 63.14006240642035 23.876337259028997 2 16.329177574190272 12.349716996297905 3 6.76373299641363 7.673092043189363 4 3.750426837858313 5.672877259425279 5 2.343124892422708 4.430249039936162 6 1.5471116048808524 3.5102301500167687 7 1.1493744613474433 3.0424418128669903 8 0.7995829724949751 2.4188905731490906 9 0.6200693762674416 2.110306276039819 >10 3.2619438693726703 21.981253276328037 >50 0.20318691904493433 5.250053111979585 >100 0.08690826567602068 5.756387693952948 >500 0.003761920797790975 0.954045284383077 >1k 0.0015249772364493712 0.9504416355788232 >5k 1.092557618582722E-5 0.023677587827125028 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.9792180455865046E-4 1.2370112784915654E-5 4.123370928305218E-6 0.0 4.123370928305218E-6 2 2.1441528827187133E-4 2.0616854641526088E-5 4.123370928305218E-6 8.246741856610436E-6 8.246741856610436E-6 3 2.6389573941153395E-4 2.0616854641526088E-5 4.123370928305218E-6 8.246741856610436E-6 2.0616854641526088E-5 4 4.123370928305218E-4 2.0616854641526088E-5 4.123370928305218E-6 8.246741856610436E-6 2.4740225569831308E-5 5 4.659409148984896E-4 2.0616854641526088E-5 8.246741856610436E-6 8.246741856610436E-6 8.246741856610435E-5 6 5.442849625362888E-4 2.4740225569831308E-5 8.246741856610436E-6 8.246741856610436E-6 8.246741856610435E-5 7 5.937654136759514E-4 2.4740225569831308E-5 8.246741856610436E-6 1.2370112784915654E-5 8.659078949440958E-5 8 6.844795740986662E-4 2.4740225569831308E-5 8.246741856610436E-6 1.6493483713220872E-5 1.1957775692085131E-4 9 7.587002508081601E-4 2.8863596498136524E-5 1.2370112784915654E-5 2.0616854641526088E-5 1.2782449877746176E-4 10-11 8.576611530874853E-4 5.566550753212044E-5 1.2370112784915654E-5 2.2678540105678696E-5 1.6905820806051395E-4 12-13 0.0010102258774347785 9.071416042271478E-5 1.6493483713220872E-5 2.8863596498136527E-5 2.1441528827187133E-4 14-15 0.0011401120616763927 1.2163944238500392E-4 2.0616854641526088E-5 3.2986967426441743E-5 2.5977236848322876E-4 16-17 0.001276183302310465 1.401946115623774E-4 2.8863596498136527E-5 3.2986967426441743E-5 3.1337619055119654E-4 18-19 0.0014266863411936054 1.401946115623774E-4 3.2986967426441743E-5 4.3295394747204784E-5 3.381164161210279E-4 20-21 0.0016266698312164085 1.4431798249068262E-4 4.3295394747204784E-5 5.154213660381522E-5 3.6698001261916443E-4 22-23 0.001797789724741075 1.4431798249068262E-4 5.360382206796783E-5 5.360382206796783E-5 3.834734963323853E-4 24-25 0.001956539505480826 1.4431798249068262E-4 6.185056392457827E-5 5.772719299627305E-5 4.2676889107959006E-4 26-27 0.0021317827699337977 1.5256472434729305E-4 8.659078949440957E-5 6.391224938873088E-5 4.5150911664942135E-4 28-29 0.0023111494053150747 1.608114662039035E-4 9.07141604227148E-5 7.00973057811887E-5 4.700642858267948E-4 30-31 0.002482269298839741 1.608114662039035E-4 9.27758458868674E-5 7.628236217364653E-5 5.174830515023048E-4 32-33 0.002661635934221018 1.608114662039035E-4 9.483753135102001E-5 8.659078949440958E-5 5.772719299627306E-4 34-35 0.0028265707713532266 1.628731516680561E-4 9.483753135102001E-5 9.27758458868674E-5 6.267523811023931E-4 36-37 0.003055417857874166 1.6905820806051395E-4 1.360712406340722E-4 9.689921681517262E-5 6.514926066722244E-4 38-39 0.003267771460681885 1.7730494991712438E-4 1.4431798249068262E-4 1.1339270052839349E-4 6.968496868835817E-4 40-41 0.0034821867489537566 1.7730494991712438E-4 1.4431798249068262E-4 1.5462640981144568E-4 7.339600252383288E-4 42-43 0.0037357740610445274 1.7730494991712438E-4 1.4431798249068262E-4 1.7524326445297176E-4 7.422067670949392E-4 44-45 0.004028533396954198 1.7936663538127697E-4 1.4637966795483524E-4 1.9379843363034524E-4 7.48391823487397E-4 46-47 0.004333662845648784 1.814283208454296E-4 1.5050303888314043E-4 1.9792180455865046E-4 7.525151944157022E-4 48-49 0.0046944578018754905 1.876133772378874E-4 1.5462640981144568E-4 2.0823023187941351E-4 7.648853072006179E-4 50-51 0.005143905233060759 1.9379843363034524E-4 1.7524326445297176E-4 2.2060034466432914E-4 7.731320490572284E-4 52-53 0.00582426143623112 1.9379843363034524E-4 2.1853865920017654E-4 2.329704574492448E-4 7.896255327704492E-4 54-55 0.006545851348684534 1.9379843363034524E-4 2.2266203012848176E-4 2.4121719930585524E-4 8.123040728761279E-4 56-57 0.00738083396166634 1.9792180455865046E-4 2.2678540105678697E-4 2.5152562662661827E-4 8.329209275176541E-4 58-59 0.008483835684987985 2.0204517548695568E-4 2.309087719850922E-4 2.6183405394738135E-4 8.452910403025696E-4 60-61 0.009867226631434387 2.1441528827187133E-4 2.3915551384170265E-4 2.721424812681444E-4 8.885864350497744E-4 62-63 0.01155368534111122 2.329704574492448E-4 2.5977236848322876E-4 2.783275376606022E-4 9.339435152611318E-4 64-65 0.01378855238425265 2.8451259405306E-4 3.1543787601534914E-4 2.803892231247548E-4 9.504369989743527E-4 66-67 0.01628525348134146 3.257463033361122E-4 3.298696742644174E-4 2.8451259405306E-4 9.545603699026579E-4 68-69 0.019278820775291045 3.257463033361122E-4 3.339930451927226E-4 2.948210213738231E-4 9.9579407918571E-4 70-71 0.023412500130917027 3.257463033361122E-4 3.3811641612102784E-4 3.0719113415873876E-4 0.0010823848686801196 72-73 0.028737833684823216 3.443014725134857E-4 3.422397870493331E-4 3.21622932407807E-4 0.0011194952070348665 74-75 0.03564035661880615 3.463631579776383E-4 3.5254821437009616E-4 3.3605473065687525E-4 0.0011421737471405454 76-77 0.04419841298050363 3.504865289059435E-4 3.5873327076255395E-4 3.5873327076255395E-4 0.0011607289163179189 78-79 0.05477485941160651 3.504865289059435E-4 3.649183271550118E-4 3.711033835474696E-4 0.0011792840854952923 80-81 0.06878195045505933 3.504865289059435E-4 3.7935012540408E-4 3.731650690116222E-4 0.0012081476819934289 82-83 0.08599496239526946 3.504865289059435E-4 3.896585527248431E-4 3.7935012540408E-4 0.0012370112784915654 84-85 0.10796840607220798 3.504865289059435E-4 3.917202381889957E-4 3.875968672606905E-4 0.0012555664476689389 86-87 0.13599908164282684 3.5460989983424876E-4 3.9584360911730087E-4 4.0821372190221654E-4 0.001313293640665212 88-89 0.16916541570464988 3.5667158529840135E-4 3.999669800456061E-4 4.123370928305218E-4 0.0013772058900539427 90-91 0.20992493733094694 3.5873327076255395E-4 4.0202866550975876E-4 4.123370928305218E-4 0.001408131172016232 92-93 0.2591249992474848 3.6079495622670654E-4 4.0409035097391135E-4 4.123370928305218E-4 0.0014266863411936054 94-95 0.3178747882339775 3.628566416908592E-4 4.1027540736636914E-4 4.1646046375882703E-4 0.001449364881299284 96-97 0.3871432964585769 3.834734963323853E-4 4.123370928305218E-4 4.1646046375882703E-4 0.0015091537597597096 98-99 0.46576360994857247 4.0202866550975876E-4 4.123370928305218E-4 4.1646046375882703E-4 0.0016142997184314927 100-101 0.5556592812420187 4.0821372190221654E-4 4.1646046375882703E-4 4.226455201512848E-4 0.0017194456771032758 102-103 0.6587992199571813 4.123370928305218E-4 4.1646046375882703E-4 4.2676889107959006E-4 0.001750370959065565 104-105 0.7745443036001729 4.123370928305218E-4 4.288305765437427E-4 4.2883057654374265E-4 0.0017771728700995489 106-107 0.9049850812316442 4.2676889107959006E-4 4.576941730418792E-4 4.308922620078953E-4 0.0018184065793826012 108-109 1.0498081766610443 4.2883057654374265E-4 4.576941730418792E-4 4.329539474720479E-4 0.001834900063095822 110-111 1.211054658497884 4.329539474720479E-4 4.618175439701844E-4 4.329539474720479E-4 0.0018802571433071793 112-113 1.3852279081949606 4.350156329362005E-4 4.659409148984896E-4 4.329539474720479E-4 0.0019153057961977737 114-115 1.5746287667302683 4.432623747928109E-4 4.680026003626422E-4 4.329539474720479E-4 0.0019359226508392996 116-117 1.7808426702257405 4.5769417304187914E-4 4.700642858267948E-4 4.329539474720479E-4 0.0019586011909449785 118-119 1.9992411348143548 4.700642858267948E-4 4.7418765675510006E-4 4.329539474720479E-4 0.0019874647874431146 120-121 2.233990826819163 4.7624934221925265E-4 4.7418765675510006E-4 4.329539474720479E-4 0.0020080816420846408 122-123 2.4838650433889953 4.927428259324736E-4 4.7624934221925265E-4 4.370773184003531E-4 0.002034883553118625 124-125 2.751242969549483 5.051129387173892E-4 4.7831102768340525E-4 4.5357080211357395E-4 0.002057562093224304 126-127 3.032916622718405 5.236681078947627E-4 4.803727131475579E-4 4.659409148984896E-4 0.002071993891473372 128-129 3.3283891366989 5.319148497513731E-4 4.824343986117105E-4 4.659409148984896E-4 0.0021008574879715085 130-131 3.636363711334017 5.401615916079835E-4 4.8655776954001573E-4 4.7418765675510006E-4 0.0021276593990054923 132-133 3.961571914763985 5.545933898570518E-4 5.071746241815417E-4 4.824343986117105E-4 0.0021379678263262554 134-135 4.30487553151282 5.566550753212044E-4 5.319148497513731E-4 5.442849625362888E-4 0.002140029511790408 136-137 4.663957227118817 5.607784462495096E-4 5.442849625362888E-4 5.525317043928992E-4 0.0021544613100394766 138-139 5.037516078054092 5.607784462495096E-4 5.504700189287465E-4 5.813953008910357E-4 0.0021853865920017654 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGGTT 9335 0.0 11.355927 1 GAACGTA 6075 0.0 10.142353 4 CCCGGTT 9830 0.0 10.045451 1 TTTTTTT 80045 0.0 9.959836 1 GTCCGTT 4795 0.0 9.842577 1 AACGTAT 6735 0.0 9.79422 5 GTCCGCT 9410 0.0 9.64505 1 GTCGATT 11445 0.0 9.579552 1 CTCGTTT 11390 0.0 9.562063 1 CGGCAAT 13965 0.0 9.51468 1 GTCCGAT 7040 0.0 9.488538 1 GGCAATT 18885 0.0 9.073589 1 CCCGTTT 6545 0.0 8.87492 1 CGGTTCG 9400 0.0 8.868212 3 CTCGAAT 12125 0.0 8.802777 1 CCCGTAT 5220 0.0 8.763026 1 TTCGCAC 10510 0.0 8.756978 8 TCGTATG 24205 0.0 8.7446785 145 GTCGGAT 7630 0.0 8.659662 1 GTCGAAT 10095 0.0 8.630958 1 >>END_MODULE SRR7473346 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473346_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 24252002 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 2.4252002E7 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.790173633395895 15.223994323798365 14.608113066818015 36.37771897598772 2 29.21947187707653 22.394598041648734 28.83335198886422 19.552578092410517 3 23.123740354408035 25.257712369263274 25.150131910638457 26.468415365690234 4 26.715021067040766 30.926398472613176 19.527196486070622 22.831383974275436 5 27.909476898275653 32.014732894939 19.834486529206792 20.24130367757855 6 22.134900189275427 34.453174718873726 20.500120629864384 22.911804461986467 7 21.5693828112913 16.80554991230352 36.925796579297824 24.69927069710735 8 23.296651281524134 21.720313790279878 24.521738152834732 30.46129677536125 9 23.43735379046212 21.84289486536075 27.25442914671328 27.46532219746384 10-14 25.762613709739124 25.08306214042888 22.94354925881242 26.21077489101958 15-19 25.489344657779505 24.82308477536001 24.227644639756882 25.459925927103605 20-24 25.558201717943323 25.162779601376556 24.102251038772373 25.176767641907748 25-29 25.6379831132012 25.074723911105995 24.050817285286648 25.236475690406152 30-34 25.64628776185814 25.095909419522144 24.178934539810058 25.078868278809658 35-39 25.81456417446545 25.11992903385989 24.012355259616054 25.05315153205861 40-44 26.022339220857337 24.873214194382275 24.080225016941107 25.02422156781928 45-49 25.936879228230364 24.931324583585145 24.208656159484658 24.923140028699834 50-54 26.028490268687687 25.08804132422976 24.13760193353916 24.745866473543398 55-59 26.176500624310723 24.99000104106905 24.132303836861965 24.701194497758262 60-64 26.05399889112437 24.95715615695501 24.30050898451635 24.688335967404274 65-69 26.139220392236716 25.044037275667403 24.28387895246123 24.53286337963465 70-74 26.230461878704276 24.915482636109957 24.24468804600209 24.60936743918368 75-79 26.02669012012486 25.004779161545486 24.403555180060245 24.564975538269405 80-84 26.261539316165706 25.078741315477327 24.291585401469128 24.368133966887836 85-89 26.380522573913346 24.953434790962984 24.2646606439151 24.40138199120857 90-94 26.283821184204704 25.07335775439149 24.32944506859476 24.313375992809046 95-99 26.323748410142713 25.202216432452662 24.260665443343353 24.21336971406128 100-104 26.487223869288 25.114951565371186 24.24584822645211 24.1519763388887 105-109 26.27289937876886 25.21211319885505 24.330011075937186 24.1849763464389 110-114 26.467966794607218 25.351493289257792 24.135303797770696 24.045236118364297 115-119 26.57493930997858 25.356005936882774 24.10514774813779 23.963907005000852 120-124 26.51670608010161 25.437225169808876 24.17195980282797 23.874108947261547 125-129 26.674287793863854 25.483589684698966 24.10961540382443 23.73250711761275 130-134 26.834469225329293 25.41727173755136 24.18335708692176 23.564901950197584 135-139 26.76299315343958 25.58866876960215 24.273218077880408 23.37511999907786 140-144 26.958472042296645 25.73263952140566 24.114111462845106 23.194776973452594 145-149 27.02098872862803 25.719831982870332 24.098594175511685 23.16058511298995 150-151 27.126396125612196 25.62253072520949 23.95602370367344 23.295049445504876 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 27580.0 1 21618.0 2 9584.0 3 2599.5 4 1514.0 5 1288.5 6 1094.5 7 926.0 8 879.5 9 828.0 10 775.0 11 770.5 12 752.5 13 676.5 14 671.5 15 742.0 16 743.5 17 727.0 18 809.0 19 907.5 20 1081.0 21 1433.0 22 1896.0 23 2498.0 24 3411.0 25 5160.0 26 7721.0 27 11514.5 28 17077.5 29 24452.0 30 35262.5 31 49414.5 32 66797.5 33 90282.5 34 125309.5 35 172804.5 36 234542.0 37 316220.0 38 414063.5 39 527336.0 40 653501.5 41 774711.5 42 891876.5 43 993720.0 44 1065263.0 45 1108988.0 46 1121234.0 47 1106941.0 48 1059222.5 49 995532.5 50 923254.0 51 845478.0 52 789368.5 53 751434.5 54 711870.5 55 659803.0 56 596984.0 57 553340.5 58 557976.0 59 553695.5 60 513200.0 61 489132.0 62 495797.5 63 479635.0 64 435722.0 65 407972.5 66 391179.0 67 375333.0 68 353578.0 69 316434.0 70 270226.5 71 223438.5 72 179664.5 73 141269.5 74 103516.0 75 71087.0 76 48406.5 77 30810.0 78 17859.5 79 9908.0 80 5292.0 81 3055.5 82 1845.0 83 1071.5 84 619.5 85 411.5 86 299.5 87 218.0 88 157.0 89 134.5 90 109.5 91 73.0 92 61.5 93 57.5 94 45.5 95 41.5 96 38.0 97 29.0 98 24.5 99 23.5 100 34.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.14764966620075323 2 0.24327063802815127 3 0.28905242544512405 4 0.30394604123816255 5 0.29728267381802126 6 0.23981112981930316 7 0.24286242430624902 8 0.23866483270123434 9 0.23616194654775302 10-14 0.24663118533471998 15-19 0.2527271769151264 20-24 0.2352292400437704 25-29 0.23311065206080717 30-34 0.22787809435278783 35-39 0.23514264925427597 40-44 0.24114050460658878 45-49 0.22763728949057485 50-54 0.2675828576956245 55-59 0.25351968880754666 60-64 0.2679341688987161 65-69 0.28999255401677765 70-74 0.3012749215508064 75-79 0.29699981057233954 80-84 0.29820053618666204 85-89 0.287305765519894 90-94 0.29438971677472237 95-99 0.289108503289749 100-104 0.28644727969262085 105-109 0.27982597065594833 110-114 0.2866583962841501 115-119 0.2764893389007637 120-124 0.2735460767321395 125-129 0.2666946835976675 130-134 0.26132275595227145 135-139 0.266917345627796 140-144 0.27755069457770953 145-149 0.27112730734559565 150-151 0.2810304073041063 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 2.4252002E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 39.482341335132894 #Duplication Level Percentage of deduplicated Percentage of total 1 64.22565534264255 25.357792467108148 2 16.233337026088073 12.818603069445208 3 6.926154199091047 8.203823526848304 4 3.7051130749086467 5.85146156435228 5 2.2037231444564815 4.350407469878159 6 1.4271944205364604 3.380938635793064 7 0.9773115934374844 2.7010584946016967 8 0.7288869190165053 2.3022529705058425 9 0.5249839557241878 1.865483616183361 >10 2.791583501285228 19.47695001322697 >50 0.16465886425325996 4.451071152822047 >100 0.08382963976703 6.014368485097233 >500 0.005537588231992931 1.4935654838848407 >1k 0.001852397805341373 1.208546996834952 >5k 1.5735243131018628E-4 0.3819242625970107 >10k+ 2.0980324173902077E-5 0.14175179082087633 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.855516917737348E-4 8.246741856610436E-6 1.2370112784915654E-5 0.0 0.0 2 1.9792180455865046E-4 8.246741856610436E-6 2.8863596498136524E-5 0.0 0.0 3 2.2266203012848176E-4 8.246741856610436E-6 2.8863596498136524E-5 0.0 0.0 4 3.463631579776383E-4 8.246741856610436E-6 2.8863596498136524E-5 0.0 1.2370112784915654E-5 5 3.875968672606905E-4 1.2370112784915654E-5 3.711033835474696E-5 0.0 1.2370112784915654E-5 6 4.5357080211357395E-4 1.2370112784915654E-5 4.53570802113574E-5 0.0 1.2370112784915654E-5 7 4.8655776954001573E-4 1.2370112784915654E-5 4.9480451139662615E-5 0.0 1.6493483713220872E-5 8 5.525317043928992E-4 1.2370112784915654E-5 5.772719299627305E-5 0.0 1.6493483713220872E-5 9 6.102588973891722E-4 1.2370112784915654E-5 7.00973057811887E-5 0.0 1.6493483713220872E-5 10-11 7.092197996684975E-4 1.2370112784915654E-5 7.422067670949392E-5 0.0 2.4740225569831308E-5 12-13 8.349826129818065E-4 1.6493483713220872E-5 8.659078949440957E-5 0.0 2.6801911033983916E-5 14-15 9.380668861894371E-4 2.2678540105678696E-5 9.689921681517262E-5 0.0 3.711033835474696E-5 16-17 0.0010473362157895254 2.8863596498136524E-5 1.1133101506424088E-4 0.0 4.9480451139662615E-5 18-19 0.001171037343638682 2.8863596498136524E-5 1.1957775692085131E-4 0.0 5.566550753212044E-5 20-21 0.0013462806080916537 3.2986967426441743E-5 1.2782449877746176E-4 6.185056392457827E-6 5.978887846042566E-5 22-23 0.001513277130688015 3.711033835474696E-5 1.4844135341898784E-4 1.2370112784915654E-5 6.391224938873088E-5 24-25 0.0016658418550353081 3.711033835474696E-5 1.6699652259636133E-4 1.6493483713220872E-5 6.80356203170361E-5 26-27 0.001828715006703364 4.3295394747204784E-5 2.0204517548695568E-4 1.6493483713220872E-5 7.00973057811887E-5 28-29 0.0019833414165148096 4.9480451139662615E-5 2.1647697373602395E-4 1.6493483713220872E-5 8.452910403025697E-5 30-31 0.0021379678263262554 5.566550753212044E-5 2.5358731209077087E-4 1.6493483713220872E-5 1.0308427320763045E-4 32-33 0.0022946559216018535 5.772719299627305E-5 2.762658521964496E-4 1.855516917737348E-5 1.0720764413593566E-4 34-35 0.0024389739040925366 6.391224938873088E-5 2.8451259405306006E-4 2.0616854641526088E-5 1.1957775692085131E-4 36-37 0.00264720413597195 6.597393485288349E-5 2.927593359096705E-4 2.0616854641526088E-5 1.2163944238500392E-4 38-39 0.0028389408841381428 7.00973057811887E-5 3.0719113415873876E-4 2.0616854641526088E-5 1.2370112784915654E-4 40-41 0.0030595412288024716 7.00973057811887E-5 3.3193135972857006E-4 2.0616854641526088E-5 1.2370112784915654E-4 42-43 0.0033090051699649374 7.422067670949392E-5 3.6079495622670654E-4 2.0616854641526088E-5 1.2988618424161438E-4 44-45 0.0036017645058746077 7.422067670949392E-5 3.8347349633238525E-4 2.0616854641526088E-5 1.381329260982248E-4 46-47 0.003888338785391821 7.834404763779914E-5 3.979052945814535E-4 2.2678540105678696E-5 1.4225629702653E-4 48-49 0.0042347019433694585 7.834404763779914E-5 4.205838346871322E-4 2.8863596498136527E-5 1.4844135341898784E-4 50-51 0.004675902632698117 8.040573310195174E-5 4.4532406025696357E-4 3.711033835474696E-5 1.5874978073975087E-4 52-53 0.005337703666691104 8.452910403025697E-5 4.6387922943433703E-4 3.711033835474696E-5 1.855516917737348E-4 54-55 0.006034553353574687 9.483753135102001E-5 5.00989567789084E-4 3.711033835474696E-5 1.8967506270204003E-4 56-57 0.006881906079341409 1.0102258774347784E-4 5.339765352155257E-4 3.711033835474696E-5 2.123536028077187E-4 58-59 0.007976661060806443 1.0514595867178305E-4 5.401615916079836E-4 3.711033835474696E-5 2.350321429133974E-4 60-61 0.009343558523539623 1.0720764413593566E-4 5.463466480004414E-4 3.711033835474696E-5 2.4121719930585524E-4 62-63 0.011003215322182474 1.154543859925461E-4 5.504700189287465E-4 3.917202381889957E-5 2.4327888477000787E-4 64-65 0.013190663599648392 1.1957775692085131E-4 5.649018171778148E-4 4.53570802113574E-5 2.474022556983131E-4 66-67 0.015666747842095676 1.2370112784915654E-4 5.793336154268831E-4 4.9480451139662615E-5 2.474022556983131E-4 68-69 0.018674746934294332 1.2782449877746176E-4 5.937654136759514E-4 4.9480451139662615E-5 2.6595742487568654E-4 70-71 0.022826981459097687 1.360712406340722E-4 6.1644395378163E-4 4.9480451139662615E-5 2.927593359096705E-4 72-73 0.028129636472898196 1.401946115623774E-4 6.267523811023931E-4 4.9480451139662615E-5 3.0719113415873876E-4 74-75 0.03503215940688113 1.628731516680561E-4 6.659244049212927E-4 4.9480451139662615E-5 3.1749956147950173E-4 76-77 0.043575783970329546 1.649348371322087E-4 6.886029450269714E-4 5.154213660381522E-5 3.4636315797763827E-4 78-79 0.05414192197411166 1.649348371322087E-4 7.00973057811887E-4 5.360382206796783E-5 3.649183271550118E-4 80-81 0.06820467852509661 1.6905820806051395E-4 7.154048560609553E-4 5.360382206796783E-5 3.979052945814535E-4 82-83 0.08537645675602368 1.7936663538127697E-4 7.545768798798548E-4 5.360382206796783E-5 4.2676889107959006E-4 84-85 0.10730041998182253 1.9792180455865046E-4 7.834404763779914E-4 5.360382206796783E-5 4.6387922943433703E-4 86-87 0.13513317374788275 2.0204517548695568E-4 8.019956455553648E-4 5.772719299627305E-5 4.741876567551E-4 88-89 0.16812220285978866 2.102919173435661E-4 8.184891292685858E-4 5.772719299627305E-5 4.989278823249314E-4 90-91 0.20866318582688553 2.123536028077187E-4 8.514760966950275E-4 5.772719299627305E-5 5.154213660381522E-4 92-93 0.25777459526846486 2.1441528827187133E-4 9.17450031547911E-4 5.772719299627305E-5 5.236681078947627E-4 94-95 0.3163965597561801 2.1441528827187133E-4 9.298201443328267E-4 5.772719299627305E-5 5.236681078947627E-4 96-97 0.3853970488704397 2.1853865920017654E-4 9.339435152611318E-4 5.772719299627305E-5 5.277914788230679E-4 98-99 0.46377408347566523 2.350321429133974E-4 9.360052007252844E-4 5.772719299627305E-5 5.401615916079836E-4 100-101 0.5531295931775034 2.350321429133974E-4 9.442519425818949E-4 5.772719299627305E-5 5.545933898570517E-4 102-103 0.6559540940166506 2.350321429133974E-4 9.442519425818949E-4 5.772719299627305E-5 5.690251881061201E-4 104-105 0.7714888857422987 2.494639411624657E-4 9.916707082574048E-4 5.772719299627305E-5 5.731485590344253E-4 106-107 0.901550313248366 2.597723684832287E-4 0.001006102506506473 5.772719299627305E-5 5.958270991401041E-4 108-109 1.0457466562966637 2.597723684832287E-4 0.001022595990219694 6.185056392457827E-5 6.123205828533248E-4 110-111 1.2061808340606273 2.6801911033983914E-4 0.001022595990219694 6.185056392457827E-5 6.267523811023931E-4 112-113 1.379477867435439 2.6801911033983914E-4 0.0010267193611479992 6.597393485288349E-5 6.267523811023931E-4 114-115 1.5678829318915608 2.6801911033983914E-4 0.00104321284486122 7.422067670949392E-5 6.267523811023931E-4 116-117 1.7728412689393642 2.762658521964496E-4 0.001076199812287662 7.422067670949392E-5 6.391224938873088E-4 118-119 1.990017154047736 2.803892231247548E-4 0.0010803231832159671 7.422067670949392E-5 6.411841793514614E-4 120-121 2.2232453221799995 2.824509085889074E-4 0.001086508239608425 7.422067670949392E-5 6.556159776005296E-4 122-123 2.4719546864625856 2.8451259405306006E-4 0.0010988783523933406 7.834404763779914E-5 6.927263159552765E-4 124-125 2.7379822086440537 2.948210213738231E-4 0.0011091867797141037 7.834404763779914E-5 7.050964287401922E-4 126-127 3.0181776333351777 3.1131450508704395E-4 0.001117433521570714 7.834404763779914E-5 7.092197996684975E-4 128-129 3.3118255556798983 3.3193135972857E-4 0.0011421737471405454 9.483753135102001E-5 7.092197996684975E-4 130-131 3.617870392720568 3.3399304519272265E-4 0.0011730990291028347 9.483753135102001E-5 7.27774968845871E-4 132-133 3.9412189558618707 3.3399304519272265E-4 0.001181345770959445 9.483753135102001E-5 7.339600252383288E-4 134-135 4.282467072202946 3.401781015851805E-4 0.0012040243110651237 9.483753135102001E-5 7.422067670949392E-4 136-137 4.63816141859134 3.5254821437009616E-4 0.001222579480242497 9.483753135102001E-5 7.48391823487397E-4 138-139 5.008310241768907 3.5873327076255395E-4 0.0012349495930274127 9.483753135102001E-5 7.607619362723127E-4 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACGCT 9660 0.0 14.704588 9 TTGAACG 11080 0.0 14.587361 7 TGAACGC 13050 0.0 11.828938 8 AGTAGTC 7475 0.0 10.956677 7 ATTGAAC 19590 0.0 10.432894 6 GTTGGCT 26260 0.0 10.355304 1 TTAGCTA 15085 0.0 9.752755 8 CTCACAC 16040 0.0 9.715065 7 GATTGAA 24785 0.0 9.714297 5 CTCAGAT 29640 0.0 9.419087 1 GTAGTCA 9370 0.0 9.358849 8 GTTAGCT 14175 0.0 9.357066 7 ACATGCG 8915 0.0 9.023847 6 TAGTCAT 10665 0.0 8.83398 9 TCACACT 15915 0.0 8.561066 8 CAGGCGT 11475 0.0 8.463033 9 ACAGGCG 11690 0.0 8.245439 8 TGTTAGC 15665 0.0 8.18904 6 TCTCGGG 10805 0.0 8.054432 145 CATGCGT 9015 0.0 8.039812 7 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473346 SRR7473346_1.fastq SRR7473346_2.fastq Input file: SRR7473346_1.fastq Paired file: SRR7473346_2.fastq trimmed: SRR7473346-trimmed-pair1.fastq, SRR7473346-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 11:08:50 2025 >> started Thu Apr 10 11:09:16 2025 >> done (25.997s) 24252002 read pairs processed; of these: 313 ( 0.00%) short read pairs filtered out after trimming by size control 6245 ( 0.03%) empty read pairs filtered out after trimming by size control 24245444 (99.97%) read pairs available; of these: 1954266 ( 8.06%) trimmed read pairs available after processing 22291178 (91.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 31 0.00% 20 24 0.00% 21 23 0.00% 22 20 0.00% 23 23 0.00% 24 18 0.00% 25 25 0.00% 26 22 0.00% 27 20 0.00% 28 24 0.00% 29 20 0.00% 30 18 0.00% 31 23 0.00% 32 23 0.00% 33 18 0.00% 34 22 0.00% 35 32 0.00% 36 28 0.00% 37 25 0.00% 38 23 0.00% 39 33 0.00% 40 25 0.00% 41 35 0.00% 42 38 0.00% 43 44 0.00% 44 31 0.00% 45 41 0.00% 46 38 0.00% 47 44 0.00% 48 50 0.00% 49 51 0.00% 50 68 0.00% 51 88 0.00% 52 87 0.00% 53 85 0.00% 54 97 0.00% 55 101 0.00% 56 117 0.00% 57 145 0.00% 58 133 0.00% 59 184 0.00% 60 184 0.00% 61 197 0.00% 62 255 0.00% 63 270 0.00% 64 294 0.00% 65 311 0.00% 66 319 0.00% 67 365 0.00% 68 434 0.00% 69 503 0.00% 70 603 0.00% 71 665 0.00% 72 700 0.00% 73 882 0.00% 74 958 0.00% 75 1069 0.00% 76 1137 0.00% 77 1290 0.01% 78 1508 0.01% 79 1789 0.01% 80 1881 0.01% 81 2148 0.01% 82 2364 0.01% 83 2702 0.01% 84 3124 0.01% 85 3465 0.01% 86 3832 0.02% 87 4017 0.02% 88 4599 0.02% 89 5058 0.02% 90 5480 0.02% 91 6212 0.03% 92 6523 0.03% 93 7314 0.03% 94 7990 0.03% 95 8651 0.04% 96 9109 0.04% 97 9826 0.04% 98 10348 0.04% 99 11058 0.05% 100 12128 0.05% 101 12880 0.05% 102 13456 0.06% 103 14372 0.06% 104 15411 0.06% 105 16258 0.07% 106 17045 0.07% 107 18090 0.07% 108 18840 0.08% 109 20129 0.08% 110 21107 0.09% 111 21361 0.09% 112 22772 0.09% 113 23597 0.10% 114 24288 0.10% 115 25923 0.11% 116 26661 0.11% 117 27047 0.11% 118 28259 0.12% 119 29362 0.12% 120 30184 0.12% 121 31192 0.13% 122 32499 0.13% 123 33339 0.14% 124 34544 0.14% 125 35218 0.15% 126 35998 0.15% 127 37275 0.15% 128 37730 0.16% 129 38559 0.16% 130 40081 0.17% 131 40823 0.17% 132 41932 0.17% 133 43252 0.18% 134 44555 0.18% 135 44989 0.19% 136 46437 0.19% 137 46555 0.19% 138 47506 0.20% 139 48899 0.20% 140 49097 0.20% 141 50962 0.21% 142 51878 0.21% 143 53096 0.22% 144 54407 0.22% 145 55446 0.23% 146 56019 0.23% 147 56324 0.23% 148 59272 0.24% 149 62078 0.26% 150 73683 0.30% 151 22291178 91.94% 24245444 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=29 prefix-density=0.26 prefix-fanout=2.2 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=190.10 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=18.7 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=266.66 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=19.1 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7473346 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 11:10:01 Started mapping on | Apr 10 11:10:01 Finished on | Apr 10 11:13:38 Mapping speed, Million of reads per hour | 402.23 Number of input reads | 24245444 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22823717 Uniquely mapped reads % | 94.14% Average mapped length | 297.56 Number of splices: Total | 24768522 Number of splices: Annotated (sjdb) | 23175102 Number of splices: GT/AG | 24461451 Number of splices: GC/AG | 268789 Number of splices: AT/AC | 16642 Number of splices: Non-canonical | 21640 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 273172 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 46461 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1148555 1148555 1148555 N_multimapping 273172 273172 273172 N_noFeature 829953 22217302 1061087 N_ambiguous 441512 3705 66551 UnstrandedReadsAssigned:21552252 PositiveStrandReadsAssigned:602710 NegativeStrandReadsAssigned:21696079 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7473346 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473346-trimmed-pair1.fastq SRR7473346-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,245,444 reads, 22,009,932 reads pseudoaligned [quant] estimated average fragment length: 288.494 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR7473346.ke.tsv 35125 SRR7473346.se.tsv 88098 total ==> SRR7473346.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 649.602 0 0 PNS24247 1044 756.506 52.513 4.58926 PNS24249 1928 1640.51 82.8019 3.33696 PNS24246 1044 756.506 52.513 4.58926 PNS24248 1044 756.506 52.513 4.58926 PNS24244 1471 1183.51 125.659 7.0196 PNS24243 293 87.1632 0 0 KQK14069 1603 1315.51 3811.76 191.567 KQK14071 474 218.459 38.4907 11.6486 ==> SRR7473346.se.tsv <== BRADI_1g14170v3 4102 BRADI_1g53295v3 45 BRADI_1g59795v3 587 BRADI_1g07683v3 0 BRADI_1g00485v3 163 BRADI_1g20270v3 6982 BRADI_1g74790v3 43 BRADI_1g09890v3 7 BRADI_1g77505v3 297 BRADI_1g48960v3 0 SRR7473346 completed mapping pipeline successfully