Starting /dee2/code/volunteer_pipeline.sh SRR7473347 current disk space = 1542907494400 free memory = 1596502432 SRR7473347 SRAfilesize b0e92e24182059e749f2a5fd456b2f03 SRR7473347.sra SRR7473347.sra file validated SRR7473347 is paired end SRR7473347 is conventional basespace SRR7473347 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473347_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.49 34.0 34.0 34.0 33.0 34.0 2 33.53875 34.0 34.0 34.0 33.0 34.0 3 33.5745 34.0 34.0 34.0 33.0 34.0 4 33.5805 34.0 34.0 34.0 33.0 34.0 5 33.5825 34.0 34.0 34.0 33.0 34.0 6 37.23275 38.0 38.0 38.0 36.0 38.0 7 37.522 38.0 38.0 38.0 37.0 38.0 8 37.544 38.0 38.0 38.0 38.0 38.0 9 37.6375 38.0 38.0 38.0 38.0 38.0 10-14 37.5802 38.0 38.0 38.0 38.0 38.0 15-19 37.5914 38.0 38.0 38.0 38.0 38.0 20-24 37.5964 38.0 38.0 38.0 38.0 38.0 25-29 37.502250000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.42555 38.0 38.0 38.0 37.8 38.0 35-39 37.3279 38.0 38.0 38.0 37.0 38.0 40-44 37.21415 38.0 38.0 38.0 36.6 38.0 45-49 37.1234 38.0 38.0 38.0 36.2 38.0 50-54 37.2319 38.0 38.0 38.0 37.0 38.0 55-59 37.266 38.0 38.0 38.0 36.6 38.0 60-64 37.157650000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.95145 38.0 38.0 38.0 35.8 38.0 70-74 36.898 38.0 38.0 38.0 35.6 38.0 75-79 36.9083 38.0 38.0 38.0 35.6 38.0 80-84 36.7581 38.0 38.0 38.0 35.0 38.0 85-89 36.70215 38.0 38.0 38.0 35.0 38.0 90-94 36.41065 38.0 38.0 38.0 34.0 38.0 95-99 36.14435 38.0 38.0 38.0 33.8 38.0 100-104 36.0317 38.0 38.0 38.0 33.4 38.0 105-109 35.7899 38.0 37.2 38.0 33.0 38.0 110-114 35.60000000000001 38.0 36.8 38.0 31.8 38.0 115-119 35.43495 38.0 36.4 38.0 30.6 38.0 120-124 35.16525 38.0 36.0 38.0 29.2 38.0 125-129 34.633849999999995 38.0 35.2 38.0 26.8 38.0 130-134 34.197199999999995 38.0 34.2 38.0 24.8 38.0 135-139 33.553599999999996 38.0 33.2 38.0 21.6 38.0 140-144 33.0821 38.0 33.0 38.0 18.0 38.0 145-149 31.894550000000002 38.0 32.2 38.0 8.6 38.0 150-151 26.6955 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 3.0 13 0.0 14 2.0 15 3.0 16 4.0 17 6.0 18 8.0 19 11.0 20 10.0 21 10.0 22 13.0 23 7.0 24 11.0 25 15.0 26 14.0 27 23.0 28 34.0 29 35.0 30 51.0 31 72.0 32 82.0 33 89.0 34 139.0 35 310.0 36 757.0 37 2290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.60075093867334 12.816020025031289 10.187734668335418 36.395494367959955 2 25.15 15.975 31.225 27.650000000000002 3 22.075 20.4 25.124999999999996 32.4 4 25.124999999999996 28.299999999999997 21.75 24.825 5 26.55 30.275000000000002 21.975 21.2 6 21.25 33.6 23.35 21.8 7 16.650000000000002 20.925 41.449999999999996 20.974999999999998 8 19.325 23.3 28.349999999999998 29.025000000000002 9 19.975 21.8 31.324999999999996 26.900000000000002 10-14 21.695 26.724999999999998 25.230000000000004 26.35 15-19 22.515 25.785000000000004 26.105 25.595000000000002 20-24 22.605 26.255 25.485000000000003 25.655 25-29 22.314999999999998 25.635 25.755 26.295 30-34 22.64 25.285000000000004 25.2 26.875 35-39 22.02 25.755 25.669999999999998 26.555 40-44 22.95303356174661 26.484269494323016 24.798679537838243 25.764017406092133 45-49 22.4261213060653 25.211260563028155 25.34126706335317 27.02135106755338 50-54 22.814999999999998 25.540000000000003 24.965 26.68 55-59 22.715 25.869999999999997 25.314999999999998 26.1 60-64 22.720000000000002 25.074999999999996 26.200000000000003 26.005 65-69 22.900000000000002 25.55 25.174999999999997 26.375 70-74 23.200000000000003 25.619999999999997 25.224999999999998 25.955000000000002 75-79 23.28 25.745 24.735 26.240000000000002 80-84 23.31 25.064999999999998 25.729999999999997 25.895000000000003 85-89 23.47 24.91 25.424999999999997 26.195 90-94 22.749099639855945 25.100040016006403 25.395158063225292 26.755702280912363 95-99 23.340846481342346 25.018782870022537 25.31930879038317 26.321061858251944 100-104 23.18 25.765 24.83 26.224999999999998 105-109 22.965 25.474999999999998 24.81 26.75 110-114 23.345 25.785000000000004 25.124999999999996 25.745 115-119 23.56 25.44 24.565 26.435 120-124 23.325000000000003 25.36 24.240000000000002 27.075 125-129 23.734082021457937 24.857114208362578 25.182994084026873 26.225809686152612 130-134 23.449212657845752 25.491774412637724 24.606328922875687 26.45268400664084 135-139 23.12955974842767 25.37358490566038 25.197484276729558 26.299371069182392 140-144 23.944369131897375 25.535974293317267 23.65316061655872 26.86649595822664 145-149 23.981490795694597 25.208731515944073 24.564933105321394 26.244844583039935 150-151 23.79874213836478 24.71698113207547 24.440251572327043 27.044025157232703 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 2.5 29 4.0 30 9.0 31 14.0 32 16.0 33 26.0 34 31.5 35 36.0 36 45.5 37 51.5 38 72.0 39 98.0 40 108.0 41 130.0 42 172.0 43 197.0 44 200.5 45 191.5 46 197.0 47 194.0 48 177.5 49 173.0 50 176.5 51 163.5 52 144.0 53 152.0 54 148.5 55 127.0 56 101.0 57 93.0 58 95.5 59 84.0 60 77.5 61 70.0 62 54.0 63 41.5 64 43.0 65 41.5 66 40.5 67 38.5 68 28.0 69 25.0 70 23.0 71 18.0 72 14.0 73 11.0 74 9.0 75 7.0 76 5.5 77 5.5 78 4.0 79 2.0 80 1.5 81 1.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.034999999999999996 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.04 95-99 0.17500000000000002 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.27 130-134 0.615 135-139 0.625 140-144 0.415 145-149 0.59 150-151 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2559630674532 95.775 2 1.4106181072069761 2.75 3 0.17953321364452424 0.525 4 0.05129520389843549 0.2 5 0.0 0.0 6 0.025647601949217745 0.15 7 0.0 0.0 8 0.07694280584765324 0.6 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATGCTATCTCGTATGC 8 0.2 TruSeq Adapter, Index 9 (97% over 36bp) CCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTG 8 0.2 No Hit CGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0125 0.0 0.0 82-83 0.21250000000000002 0.0 0.025 0.0 0.0 84-85 0.25 0.0 0.025 0.0 0.0 86-87 0.30000000000000004 0.0 0.025 0.0 0.0 88-89 0.35 0.0 0.025 0.0 0.0 90-91 0.4125 0.0 0.025 0.0 0.0 92-93 0.5 0.0 0.025 0.0 0.0 94-95 0.5874999999999999 0.0 0.025 0.0 0.0 96-97 0.675 0.0 0.025 0.0 0.0 98-99 0.8 0.0 0.025 0.0 0.0 100-101 0.975 0.0 0.025 0.0 0.0 102-103 1.1749999999999998 0.0 0.025 0.0 0.0 104-105 1.4874999999999998 0.0 0.025 0.0 0.0 106-107 1.8125 0.0 0.025 0.0 0.0 108-109 2.025 0.0 0.025 0.0 0.0 110-111 2.3125 0.0 0.025 0.0 0.0 112-113 2.5625 0.0 0.025 0.0 0.0 114-115 2.7750000000000004 0.0 0.025 0.0 0.0 116-117 3.0999999999999996 0.0 0.025 0.0 0.0 118-119 3.4749999999999996 0.0 0.025 0.0 0.0 120-121 3.775 0.0 0.025 0.0 0.0 122-123 4.075 0.0 0.025 0.0 0.0 124-125 4.5 0.0 0.025 0.0 0.0 126-127 4.887499999999999 0.0 0.025 0.0 0.0 128-129 5.475 0.0 0.025 0.0 0.0 130-131 5.949999999999999 0.0 0.025 0.0 0.0 132-133 6.5375 0.0 0.025 0.0 0.0 134-135 7.1375 0.0 0.025 0.0 0.0 136-137 7.4875 0.0 0.025 0.0 0.0 138-139 7.975 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGTTC 10 0.0068343505 144.975 2 TCGGTCC 10 0.0068343505 144.975 7 GGTTCGG 10 0.0068343505 144.975 4 TTCGGTC 10 0.0068343505 144.975 6 GTCGGTT 10 0.0068343505 144.975 1 GTTCGGT 10 0.0068343505 144.975 5 >>END_MODULE SRR7473347 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473347_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38325 33.0 33.0 34.0 32.0 34.0 2 32.5705 34.0 33.0 34.0 32.0 34.0 3 32.65775 34.0 33.0 34.0 32.0 34.0 4 32.5785 34.0 33.0 34.0 32.0 34.0 5 32.6815 34.0 33.0 34.0 32.0 34.0 6 36.61125 38.0 38.0 38.0 36.0 38.0 7 36.6145 38.0 38.0 38.0 36.0 38.0 8 36.74375 38.0 38.0 38.0 36.0 38.0 9 36.84925 38.0 38.0 38.0 36.0 38.0 10-14 36.8206 38.0 38.0 38.0 37.0 38.0 15-19 36.71055 38.0 38.0 38.0 36.6 38.0 20-24 36.4466 38.0 38.0 38.0 36.2 38.0 25-29 36.53915 38.0 38.0 38.0 36.2 38.0 30-34 36.6079 38.0 38.0 38.0 36.8 38.0 35-39 36.5359 38.0 38.0 38.0 36.4 38.0 40-44 36.595400000000005 38.0 38.0 38.0 36.8 38.0 45-49 36.40465 38.0 38.0 38.0 36.0 38.0 50-54 36.52255 38.0 38.0 38.0 36.6 38.0 55-59 36.5341 38.0 38.0 38.0 36.4 38.0 60-64 36.366699999999994 38.0 38.0 38.0 35.6 38.0 65-69 36.06995 38.0 38.0 38.0 35.2 38.0 70-74 36.2285 38.0 38.0 38.0 35.0 38.0 75-79 36.2077 38.0 38.0 38.0 35.2 38.0 80-84 36.1479 38.0 38.0 38.0 34.8 38.0 85-89 36.0647 38.0 38.0 38.0 34.6 38.0 90-94 35.8871 38.0 38.0 38.0 34.0 38.0 95-99 35.531150000000004 38.0 38.0 38.0 33.0 38.0 100-104 34.936099999999996 38.0 38.0 38.0 29.2 38.0 105-109 34.92165 38.0 37.8 38.0 29.4 38.0 110-114 34.65425 38.0 36.8 38.0 27.6 38.0 115-119 34.443 38.0 36.0 38.0 26.0 38.0 120-124 34.2723 38.0 36.0 38.0 24.8 38.0 125-129 33.981399999999994 38.0 35.6 38.0 23.2 38.0 130-134 33.56115 38.0 34.4 38.0 19.2 38.0 135-139 33.0024 38.0 33.0 38.0 13.4 38.0 140-144 32.31095 38.0 33.0 38.0 12.0 38.0 145-149 31.1539 38.0 31.8 38.0 2.0 38.0 150-151 25.168125 33.0 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 26.0 4 8.0 5 5.0 6 3.0 7 3.0 8 1.0 9 0.0 10 1.0 11 2.0 12 2.0 13 2.0 14 6.0 15 4.0 16 7.0 17 14.0 18 11.0 19 10.0 20 9.0 21 15.0 22 15.0 23 13.0 24 26.0 25 32.0 26 18.0 27 16.0 28 31.0 29 26.0 30 42.0 31 52.0 32 79.0 33 92.0 34 127.0 35 232.0 36 645.0 37 2388.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.850417615793475 19.21032649962035 12.17413313085295 27.765122753733234 2 31.773336706299016 22.46395142929421 25.92967366557045 19.833038198836327 3 24.34892541087231 25.587863463969658 26.750948166877368 23.31226295828066 4 27.463365336028296 31.80899444163719 19.706922688226378 21.020717534108137 5 28.448711470439612 32.61748357756443 18.873168266801414 20.060636685194545 6 24.961948249619482 34.24657534246575 20.37037037037037 20.421106037544394 7 22.430379746835445 19.39240506329114 35.063291139240505 23.11392405063291 8 24.27600100730295 23.39461092923697 23.520523797532107 28.80886426592798 9 25.232938806346006 21.203727020901535 25.686225132208513 27.877109040543946 10-14 26.772327044025158 25.725786163522013 22.359748427672958 25.142138364779875 15-19 26.709520676216027 24.56850736447841 24.234448549881055 24.487523409424508 20-24 26.282083862770012 25.982210927573064 24.284625158831002 23.45108005082592 25-29 26.344631621676477 25.776334483458495 23.457479196265478 24.421554698599554 30-34 26.322731192614015 25.292953888297063 24.23781261096738 24.146502308121544 35-39 26.69545339090678 25.730251460502924 23.75920751841504 23.81508763017526 40-44 27.389407467532468 25.142045454545453 23.949878246753247 23.51866883116883 45-49 26.96245733788396 25.40369823238755 23.992664663032958 23.641179766695533 50-54 26.563134388956556 25.48721071863581 24.15245635403979 23.797198538367844 55-59 26.632502917448882 25.27271804759247 24.54208737125171 23.552691663706938 60-64 26.547413355015753 25.099095436528103 24.199613781888406 24.153877426567743 65-69 26.560261919377943 25.19950890116636 24.52936361776141 23.71086556169429 70-74 26.85415503325042 25.595207878572516 24.067211533580384 23.48342555459668 75-79 26.625355546525803 25.040633888663145 24.720642015440877 23.613368549370175 80-84 26.390087848474074 25.694409180927234 24.292895952876655 23.622607017722032 85-89 26.578747146842506 25.599797108800402 24.488967791022066 23.332487953335026 90-94 26.761493522987045 25.41529083058166 24.4754889509779 23.347726695453392 95-99 27.260175905093064 25.33749232971978 24.764778073225607 22.637553691961546 100-104 26.64805335815108 25.758750840184064 23.96463471382038 23.628561087844478 105-109 26.625386996904027 25.706914344685245 24.58204334365325 23.08565531475748 110-114 26.959619952494062 25.725498295982653 24.868325932045853 22.446555819477435 115-119 27.030365414307774 25.66649511065363 24.19454451878538 23.108594956253217 120-124 27.248391248391247 26.177606177606176 24.010296010296013 22.563706563706564 125-129 27.329384496523307 25.72753026010816 24.357455575585888 22.58562966778264 130-134 27.974226804123713 25.195876288659797 23.989690721649485 22.84020618556701 135-139 27.405621665982764 25.969429626590067 24.39474764054165 22.230201066885517 140-144 27.68836494105587 26.063557150179395 23.741670937980523 22.506406970784212 145-149 27.678893876076977 26.445854614868697 23.93850281174225 21.936748697312076 150-151 27.82676348547718 25.95954356846473 24.75363070539419 21.4600622406639 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 15.0 1 10.5 2 3.5 3 3.0 4 5.0 5 5.0 6 6.0 7 4.5 8 1.5 9 2.5 10 2.0 11 0.5 12 0.5 13 0.0 14 1.5 15 2.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 1.5 26 2.5 27 4.5 28 3.5 29 3.0 30 4.5 31 8.0 32 11.5 33 14.5 34 21.0 35 25.0 36 31.0 37 46.5 38 61.0 39 70.5 40 89.5 41 119.0 42 139.0 43 155.0 44 164.0 45 173.5 46 184.0 47 194.5 48 190.5 49 182.0 50 175.0 51 145.0 52 146.5 53 168.5 54 155.5 55 132.0 56 116.5 57 113.0 58 100.5 59 90.0 60 86.5 61 76.0 62 75.5 63 67.0 64 59.5 65 59.5 66 46.5 67 38.0 68 35.0 69 33.5 70 31.0 71 19.0 72 16.5 73 15.0 74 12.5 75 8.0 76 5.5 77 4.5 78 1.5 79 1.0 80 1.5 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 1.175 3 1.125 4 1.05 5 1.05 6 1.4500000000000002 7 1.25 8 0.7250000000000001 9 0.7250000000000001 10-14 0.625 15-19 1.2149999999999999 20-24 1.625 25-29 1.46 30-34 1.435 35-39 1.575 40-44 1.44 45-49 1.8450000000000002 50-54 1.48 55-59 1.455 60-64 1.6099999999999999 65-69 2.26 70-74 1.505 75-79 1.5599999999999998 80-84 1.5350000000000001 85-89 1.425 90-94 1.575 95-99 2.22 100-104 3.295 105-109 3.1 110-114 3.17 115-119 2.85 120-124 2.875 125-129 2.9250000000000003 130-134 3.0 135-139 2.52 140-144 2.45 145-149 3.085 150-151 3.5999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36358987471236 96.175 2 1.3295832267962158 2.6 3 0.17898235745333674 0.525 4 0.0767067246228586 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.051137816415239075 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.425 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.362500000000001 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.324999999999999 0.0 0.0 0.0 0.0 130-131 5.762499999999999 0.0 0.0 0.0 0.0 132-133 6.3375 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.1375 0.0 0.0 0.0 0.0 138-139 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGGGG 10 0.006753599 145.48051 145 >>END_MODULE Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851546 spots for SRR7473347.sra Written 851546 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra Read 851532 spots for SRR7473347.sra Written 851532 spots for SRR7473347.sra SRR ids: ['SRR7473347.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uh78v9wm SRR7473347.sra spots: 17030654 blocks: [[1, 851532], [851533, 1703064], [1703065, 2554596], [2554597, 3406128], [3406129, 4257660], [4257661, 5109192], [5109193, 5960724], [5960725, 6812256], [6812257, 7663788], [7663789, 8515320], [8515321, 9366852], [9366853, 10218384], [10218385, 11069916], [11069917, 11921448], [11921449, 12772980], [12772981, 13624512], [13624513, 14476044], [14476045, 15327576], [15327577, 16179108], [16179109, 17030654]] SRR7473347 file size 5749429 SRR7473347 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473347 SRR7473347_1.fastq SRR7473347_2.fastq Input file: SRR7473347_1.fastq Paired file: SRR7473347_2.fastq trimmed: SRR7473347-trimmed-pair1.fastq, SRR7473347-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:27:00 2024 >> started Sat Dec 7 14:27:19 2024 >> done (19.234s) 17030654 read pairs processed; of these: 36413 ( 0.21%) short read pairs filtered out after trimming by size control 53886 ( 0.32%) empty read pairs filtered out after trimming by size control 16940355 (99.47%) read pairs available; of these: 9912770 (58.52%) trimmed read pairs available after processing 7027585 (41.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 27 0.00% 21 26 0.00% 22 25 0.00% 23 31 0.00% 24 30 0.00% 25 26 0.00% 26 31 0.00% 27 35 0.00% 28 37 0.00% 29 33 0.00% 30 32 0.00% 31 39 0.00% 32 33 0.00% 33 40 0.00% 34 36 0.00% 35 44 0.00% 36 58 0.00% 37 39 0.00% 38 58 0.00% 39 66 0.00% 40 74 0.00% 41 85 0.00% 42 71 0.00% 43 86 0.00% 44 100 0.00% 45 105 0.00% 46 118 0.00% 47 123 0.00% 48 146 0.00% 49 178 0.00% 50 183 0.00% 51 194 0.00% 52 214 0.00% 53 241 0.00% 54 243 0.00% 55 266 0.00% 56 288 0.00% 57 297 0.00% 58 346 0.00% 59 389 0.00% 60 405 0.00% 61 527 0.00% 62 561 0.00% 63 613 0.00% 64 728 0.00% 65 768 0.00% 66 944 0.01% 67 1050 0.01% 68 1419 0.01% 69 3792 0.02% 70 4798 0.03% 71 2794 0.02% 72 2229 0.01% 73 2215 0.01% 74 2206 0.01% 75 2280 0.01% 76 2474 0.01% 77 2718 0.02% 78 2846 0.02% 79 3239 0.02% 80 3783 0.02% 81 4111 0.02% 82 4696 0.03% 83 5356 0.03% 84 6995 0.04% 85 7557 0.04% 86 8119 0.05% 87 8489 0.05% 88 9506 0.06% 89 9612 0.06% 90 10442 0.06% 91 11227 0.07% 92 11751 0.07% 93 12978 0.08% 94 14103 0.08% 95 15365 0.09% 96 16047 0.09% 97 16322 0.10% 98 16696 0.10% 99 17732 0.10% 100 19183 0.11% 101 19357 0.11% 102 20463 0.12% 103 21781 0.13% 104 23023 0.14% 105 25327 0.15% 106 25816 0.15% 107 26123 0.15% 108 27384 0.16% 109 29406 0.17% 110 30339 0.18% 111 29841 0.18% 112 30992 0.18% 113 34450 0.20% 114 34629 0.20% 115 36413 0.21% 116 38303 0.23% 117 38765 0.23% 118 39984 0.24% 119 40848 0.24% 120 43299 0.26% 121 44173 0.26% 122 46286 0.27% 123 47564 0.28% 124 51833 0.31% 125 52271 0.31% 126 54086 0.32% 127 56423 0.33% 128 57483 0.34% 129 59822 0.35% 130 62490 0.37% 131 64862 0.38% 132 67656 0.40% 133 72256 0.43% 134 76773 0.45% 135 80936 0.48% 136 86329 0.51% 137 91514 0.54% 138 97353 0.57% 139 104304 0.62% 140 111332 0.66% 141 122155 0.72% 142 135952 0.80% 143 153516 0.91% 144 174501 1.03% 145 209217 1.24% 146 262883 1.55% 147 358982 2.12% 148 551744 3.26% 149 1076228 6.35% 150 4592104 27.11% 151 7027585 41.48% 16940355 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.34 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=45.14 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.9 sequence=ACACATACACACCGCGTCTATGCGCTTTCATCAAAACGAGCGTACACAGACCGTACGTACACATACAAACGGCAGACATACAAACACGACACTCTCCAGTACACGTGGCGTCACCTGGGACATCTTATTTTGTTCATCTTATTATGGAGTATTCAACAGCAGCTGAAGGCCGGCCGGCCGGAGCTTGCTAGCTAGCTACCAGCTCAGTGCTGGCCAGGCAGCTTCTCCTTGATCTT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=26 prefix-density=0.67 prefix-fanout=2.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=162.59 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=1.4 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCC SRR7473347 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:28:31 Started mapping on | Dec 07 14:28:31 Finished on | Dec 07 14:32:23 Mapping speed, Million of reads per hour | 262.87 Number of input reads | 16940355 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15205632 Uniquely mapped reads % | 89.76% Average mapped length | 292.71 Number of splices: Total | 15130297 Number of splices: Annotated (sjdb) | 14284667 Number of splices: GT/AG | 14925272 Number of splices: GC/AG | 186262 Number of splices: AT/AC | 6253 Number of splices: Non-canonical | 12510 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 162678 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 33400 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.45% % of reads unmapped: other | 1.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1586130 1586130 1586130 N_multimapping 162678 162678 162678 N_noFeature 411472 14626949 612859 N_ambiguous 420292 1927 43642 UnstrandedReadsAssigned:14373868 PositiveStrandReadsAssigned:576756 NegativeStrandReadsAssigned:14549131 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473347 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473347-trimmed-pair1.fastq SRR7473347-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,940,355 reads, 14,640,578 reads pseudoaligned [quant] estimated average fragment length: 257.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52973 SRR7473347.ke.tsv 35125 SRR7473347.se.tsv 88098 total ==> SRR7473347.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.763 49.8359 6.5299 PNS24247 1044 787.177 23.9944 2.71494 PNS24249 1928 1671.18 30.0058 1.59921 PNS24246 1044 787.177 23.9944 2.71494 PNS24248 1044 787.177 23.9944 2.71494 PNS24244 1471 1214.18 137.175 10.0627 PNS24243 293 93.7425 0 0 KQK14069 1603 1346.18 892.643 59.0606 KQK14071 474 235.872 9.36905 3.53787 ==> SRR7473347.se.tsv <== BRADI_1g14170v3 936 BRADI_1g53295v3 47 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 494 BRADI_1g74790v3 309 BRADI_1g09890v3 4 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR7473347 completed mapping pipeline successfully