Starting /dee2/code/volunteer_pipeline.sh SRR7473352 current disk space = 1543008645120 free memory = 1602252148 SRR7473352 SRAfilesize 172493afc9c6c8ef649f80de79502c0d SRR7473352.sra SRR7473352.sra file validated SRR7473352 is paired end SRR7473352 is conventional basespace SRR7473352 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473352_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.309 34.0 33.0 34.0 33.0 34.0 2 33.4045 34.0 33.0 34.0 33.0 34.0 3 33.51725 34.0 34.0 34.0 33.0 34.0 4 33.41125 34.0 34.0 34.0 33.0 34.0 5 33.3695 34.0 34.0 34.0 33.0 34.0 6 37.0595 38.0 37.0 38.0 36.0 38.0 7 37.32725 38.0 38.0 38.0 37.0 38.0 8 37.483 38.0 38.0 38.0 37.0 38.0 9 37.517 38.0 38.0 38.0 38.0 38.0 10-14 37.4619 38.0 38.0 38.0 37.4 38.0 15-19 37.3673 38.0 38.0 38.0 37.0 38.0 20-24 37.507000000000005 38.0 38.0 38.0 37.6 38.0 25-29 37.37965 38.0 38.0 38.0 37.4 38.0 30-34 37.095000000000006 38.0 38.0 38.0 36.4 38.0 35-39 37.0567 38.0 38.0 38.0 36.0 38.0 40-44 36.91485 38.0 38.0 38.0 35.8 38.0 45-49 36.92145 38.0 38.0 38.0 35.6 38.0 50-54 36.8524 38.0 38.0 38.0 35.0 38.0 55-59 36.85215 38.0 38.0 38.0 35.2 38.0 60-64 36.86735 38.0 38.0 38.0 35.4 38.0 65-69 36.62135000000001 38.0 38.0 38.0 34.2 38.0 70-74 36.3739 38.0 38.0 38.0 34.0 38.0 75-79 36.57424999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.52935 38.0 38.0 38.0 34.0 38.0 85-89 36.343849999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.05535 38.0 37.0 38.0 33.0 38.0 95-99 35.728249999999996 38.0 37.0 38.0 31.4 38.0 100-104 35.597350000000006 38.0 36.4 38.0 30.8 38.0 105-109 35.32885 38.0 36.0 38.0 29.4 38.0 110-114 35.134550000000004 38.0 35.6 38.0 28.6 38.0 115-119 34.7461 38.0 35.0 38.0 27.2 38.0 120-124 34.41705 38.0 35.0 38.0 25.2 38.0 125-129 34.01445 38.0 34.4 38.0 23.0 38.0 130-134 33.5345 38.0 34.0 38.0 20.6 38.0 135-139 33.095150000000004 38.0 33.6 38.0 18.2 38.0 140-144 32.36235 37.2 32.8 38.0 14.0 38.0 145-149 31.242399999999996 36.0 31.4 38.0 11.0 38.0 150-151 26.514125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 0.0 14 4.0 15 2.0 16 2.0 17 5.0 18 10.0 19 10.0 20 10.0 21 15.0 22 7.0 23 16.0 24 12.0 25 21.0 26 25.0 27 24.0 28 50.0 29 50.0 30 71.0 31 75.0 32 88.0 33 129.0 34 213.0 35 368.0 36 972.0 37 1818.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.3881496359528 10.795882500627668 11.69972382626161 39.11624403715792 2 25.3 15.1 33.324999999999996 26.275 3 21.8 20.525 23.95 33.725 4 26.125 27.1 21.25 25.525 5 25.952858575727184 30.74222668004012 23.269809428284855 20.035105315947842 6 22.625 31.8 23.45 22.125 7 17.45 21.375 40.825 20.349999999999998 8 20.150000000000002 21.349999999999998 29.275000000000002 29.225 9 20.150000000000002 21.125 32.2 26.525 10-14 23.035 25.569999999999997 25.03 26.365 15-19 23.630000000000003 25.005 25.34 26.025 20-24 22.8 25.0 25.72 26.479999999999997 25-29 23.125 25.505 25.480000000000004 25.89 30-34 23.215 25.424999999999997 25.3 26.06 35-39 23.213928357014208 25.27516509905944 25.465279167500498 26.045627376425855 40-44 23.575 25.005 25.014999999999997 26.405 45-49 23.25 24.785 25.929999999999996 26.035000000000004 50-54 23.59 24.915000000000003 25.185000000000002 26.31 55-59 23.799999999999997 25.115 24.84 26.245 60-64 23.77 24.205 25.7 26.325 65-69 23.605 25.019999999999996 25.314999999999998 26.06 70-74 23.845 24.560000000000002 25.06 26.534999999999997 75-79 24.095 24.805 25.135 25.965 80-84 23.455000000000002 25.130000000000003 25.39 26.025 85-89 23.46 24.834999999999997 24.759999999999998 26.945000000000004 90-94 23.895 25.19 24.345 26.57 95-99 24.347173586793396 24.912456228114056 24.947473736868435 25.792896448224113 100-104 24.42 24.740000000000002 24.884999999999998 25.955000000000002 105-109 24.3 24.59 24.92 26.19 110-114 23.849999999999998 24.935 24.86 26.355 115-119 24.725 24.355 25.09 25.83 120-124 24.22 25.0 24.795 25.985000000000003 125-129 23.330000000000002 24.279999999999998 25.72 26.669999999999998 130-134 24.27086993624818 24.029918176798354 25.340093368806787 26.35911851814668 135-139 24.09801563439567 25.641411104429746 24.413710162357187 25.846863098817398 140-144 25.03 24.91 24.404999999999998 25.655 145-149 24.447112979085357 24.492144501150808 25.112578805163615 25.94816371460022 150-151 24.178463094034377 25.075834175935285 25.075834175935285 25.669868554095043 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.5 25 3.0 26 2.5 27 3.0 28 2.5 29 5.0 30 10.0 31 10.5 32 11.5 33 18.5 34 28.0 35 40.0 36 52.5 37 62.0 38 78.0 39 93.5 40 101.5 41 119.0 42 146.0 43 155.0 44 159.0 45 181.5 46 197.0 47 195.0 48 182.0 49 168.0 50 156.5 51 148.0 52 150.0 53 133.0 54 112.5 55 117.0 56 118.0 57 120.5 58 110.0 59 98.0 60 98.5 61 81.5 62 75.0 63 72.0 64 61.5 65 62.5 66 50.0 67 39.0 68 38.5 69 28.5 70 24.0 71 20.0 72 15.5 73 15.0 74 11.5 75 6.0 76 2.0 77 2.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.05 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.395 135-139 0.22 140-144 0.0 145-149 0.06999999999999999 150-151 1.0999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54998728059017 96.85000000000001 2 1.1956245230221318 2.35 3 0.2035105571101501 0.6 4 0.05087763927753752 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.0875 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 6.074999999999999 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACATC 10 0.006914255 144.41249 8 ATTTGGA 10 0.006914255 144.41249 5 GTGACAT 10 0.006914255 144.41249 3 TTGGAAT 10 0.006914255 144.41249 7 >>END_MODULE SRR7473352 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473352_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.736 33.0 33.0 34.0 31.0 34.0 2 32.23575 33.0 33.0 34.0 32.0 34.0 3 32.11925 34.0 33.0 34.0 31.0 34.0 4 32.01225 34.0 33.0 34.0 32.0 34.0 5 32.177 34.0 33.0 34.0 32.0 34.0 6 36.4795 38.0 38.0 38.0 35.0 38.0 7 36.70175 38.0 38.0 38.0 36.0 38.0 8 36.9025 38.0 38.0 38.0 36.0 38.0 9 36.97275 38.0 38.0 38.0 36.0 38.0 10-14 37.097300000000004 38.0 38.0 38.0 36.8 38.0 15-19 36.84205 38.0 38.0 38.0 36.2 38.0 20-24 36.3246 38.0 38.0 38.0 35.2 38.0 25-29 36.58755 38.0 38.0 38.0 36.0 38.0 30-34 36.743700000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.6134 38.0 38.0 38.0 36.0 38.0 40-44 36.74935 38.0 38.0 38.0 36.0 38.0 45-49 36.567949999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.56595 38.0 38.0 38.0 35.6 38.0 55-59 36.653 38.0 38.0 38.0 36.0 38.0 60-64 36.43865 38.0 38.0 38.0 35.0 38.0 65-69 35.9842 38.0 38.0 38.0 33.6 38.0 70-74 36.251850000000005 38.0 38.0 38.0 34.0 38.0 75-79 36.2924 38.0 38.0 38.0 34.0 38.0 80-84 36.18155 38.0 38.0 38.0 34.0 38.0 85-89 36.052 38.0 38.0 38.0 33.8 38.0 90-94 35.789849999999994 38.0 38.0 38.0 32.8 38.0 95-99 35.26604999999999 38.0 37.6 38.0 30.4 38.0 100-104 34.6832 38.0 36.8 38.0 27.2 38.0 105-109 34.63484999999999 38.0 36.2 38.0 26.8 38.0 110-114 34.288650000000004 38.0 35.8 38.0 24.4 38.0 115-119 33.81215 38.0 35.0 38.0 20.2 38.0 120-124 33.827 38.0 35.0 38.0 22.2 38.0 125-129 33.53405 38.0 34.8 38.0 18.4 38.0 130-134 32.662 38.0 33.8 38.0 13.6 38.0 135-139 32.45115 38.0 33.4 38.0 13.2 38.0 140-144 31.7154 38.0 31.8 38.0 10.8 38.0 145-149 30.39905 37.6 30.4 38.0 2.0 38.0 150-151 24.774124999999998 33.0 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 10.0 4 26.0 5 2.0 6 2.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 8.0 13 3.0 14 6.0 15 4.0 16 8.0 17 15.0 18 19.0 19 9.0 20 19.0 21 21.0 22 18.0 23 36.0 24 30.0 25 24.0 26 27.0 27 32.0 28 40.0 29 34.0 30 68.0 31 56.0 32 93.0 33 114.0 34 173.0 35 287.0 36 676.0 37 2132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.00051894135963 14.893617021276595 13.077322262584328 35.02854177477945 2 30.483747120552856 21.115945738418223 27.00281545943179 21.397491681597135 3 22.45055227331107 25.455946570768045 25.918314924222962 26.175186231697918 4 28.049408131755015 30.262480699948537 19.248584662892434 22.439526505404015 5 28.16431322207959 32.52888318356868 19.024390243902438 20.282413350449293 6 22.549517521584562 35.44946673438293 19.984763839512443 22.01625190452006 7 23.651033787191125 17.851739788199698 34.190620272314675 24.306606152294503 8 23.71185592796398 23.261630815407706 22.886443221610804 30.14007003501751 9 23.849999999999998 21.95 26.924999999999997 27.275 10-14 26.0 25.585 22.42 25.995 15-19 25.837560902104578 24.67225877743734 23.98915063539103 25.501029685067056 20-24 26.18550399837009 25.31452146895533 23.689706107064637 24.810268425609944 25-29 25.828617623282135 25.459781729991914 23.868229587712207 24.843371059013744 30-34 26.204015902571587 24.945901061848925 23.773338030295406 25.076745005284085 35-39 26.580038426534536 25.32611993123673 23.62220649206189 24.47163515016685 40-44 26.902637120224604 25.127845181991376 23.488418730572548 24.48109896721147 45-49 26.535676305261557 25.350686180179267 23.66941813946422 24.44421937509495 50-54 26.431052711070834 24.981120676634948 24.402154760106733 24.185671852187486 55-59 26.519669255825605 25.63267351540967 23.267351540967177 24.580305687797544 60-64 25.685672588193853 24.97106335866338 24.009863620351265 25.333400432791503 65-69 26.47058823529412 25.099055166107892 23.900233668596975 24.530122930001017 70-74 26.165072974333164 24.841469552088576 23.96577755410166 25.027679919476597 75-79 26.540949897186415 24.509754751993583 23.97311800993029 24.976177340889713 80-84 27.070798235058163 24.854592860008022 23.405535499398315 24.6690734055355 85-89 26.069960910093215 25.2631051418262 23.995188934549464 24.671745013531122 90-94 26.462873284907186 24.621670702179177 24.465294592413237 24.450161420500404 95-99 26.806967359656742 24.983398886448384 23.920927619144916 24.28870613474996 100-104 26.12078738534474 25.079872204472842 24.29145625064413 24.50788415953829 105-109 26.56900539707016 25.16576715497301 23.567206373682858 24.698021074273964 110-114 26.986661173198744 25.03991347788021 23.922336097234382 24.051089251686665 115-119 26.64706185832946 25.398545116854976 23.298766960738792 24.65562606407677 120-124 26.64644491285795 25.78787722996247 23.777697804740118 23.787980052439465 125-129 26.8730395433743 25.381806962513497 23.504910783154216 24.240242710957986 130-134 26.688318383338487 25.987215176822353 23.894215898546243 23.430250541292917 135-139 27.42938717242786 25.639849087386562 24.156214948506168 22.774548791679415 140-144 27.75265484477415 25.283268126619586 23.76403638026523 23.200040648341037 145-149 27.581799591002042 25.725971370143146 23.517382413087933 23.17484662576687 150-151 27.857978930940302 25.516972298088174 23.76121732344908 22.863831447522433 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 2.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.5 16 2.5 17 2.5 18 2.0 19 2.0 20 2.5 21 2.5 22 2.5 23 3.0 24 3.5 25 2.5 26 2.5 27 5.0 28 5.5 29 5.5 30 11.5 31 16.5 32 13.5 33 15.0 34 17.0 35 21.0 36 32.5 37 42.0 38 55.0 39 71.5 40 88.5 41 114.5 42 147.5 43 163.0 44 175.0 45 167.0 46 161.5 47 164.5 48 159.0 49 173.0 50 161.5 51 132.0 52 128.0 53 126.5 54 120.5 55 114.0 56 111.0 57 129.0 58 131.5 59 112.0 60 98.0 61 95.5 62 95.0 63 89.5 64 91.0 65 81.5 66 58.5 67 46.5 68 45.5 69 49.5 70 40.5 71 23.5 72 18.5 73 13.5 74 5.5 75 6.0 76 6.0 77 3.0 78 1.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 2.325 3 2.675 4 2.85 5 2.625 6 1.55 7 0.8500000000000001 8 0.05 9 0.0 10-14 0.0 15-19 0.455 20-24 1.8350000000000002 25-29 1.04 30-34 0.645 35-39 1.11 40-44 0.27 45-49 1.265 50-54 0.685 55-59 0.22499999999999998 60-64 0.645 65-69 1.5699999999999998 70-74 0.65 75-79 0.305 80-84 0.27999999999999997 85-89 0.22999999999999998 90-94 0.88 95-99 2.1149999999999998 100-104 2.97 105-109 2.725 110-114 2.915 115-119 3.085 120-124 2.7449999999999997 125-129 2.765 130-134 3.01 135-139 1.9300000000000002 140-144 1.595 145-149 2.1999999999999997 150-151 3.8875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54961832061069 96.825 2 1.2213740458015268 2.4 3 0.1272264631043257 0.375 4 0.10178117048346055 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.2249999999999996 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3625 0.0 0.0 0.0 0.0 130-131 4.762499999999999 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.737500000000001 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219562 spots for SRR7473352.sra Written 1219562 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra Read 1219560 spots for SRR7473352.sra Written 1219560 spots for SRR7473352.sra SRR ids: ['SRR7473352.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4sg8r3tm SRR7473352.sra spots: 24391202 blocks: [[1, 1219560], [1219561, 2439120], [2439121, 3658680], [3658681, 4878240], [4878241, 6097800], [6097801, 7317360], [7317361, 8536920], [8536921, 9756480], [9756481, 10976040], [10976041, 12195600], [12195601, 13415160], [13415161, 14634720], [14634721, 15854280], [15854281, 17073840], [17073841, 18293400], [18293401, 19512960], [19512961, 20732520], [20732521, 21952080], [21952081, 23171640], [23171641, 24391202]] SRR7473352 file size 8243677 SRR7473352 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473352 SRR7473352_1.fastq SRR7473352_2.fastq Input file: SRR7473352_1.fastq Paired file: SRR7473352_2.fastq trimmed: SRR7473352-trimmed-pair1.fastq, SRR7473352-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:38:36 2024 >> started Sat Dec 7 14:39:05 2024 >> done (29.368s) 24391202 read pairs processed; of these: 32567 ( 0.13%) short read pairs filtered out after trimming by size control 52765 ( 0.22%) empty read pairs filtered out after trimming by size control 24305870 (99.65%) read pairs available; of these: 14197815 (58.41%) trimmed read pairs available after processing 10108055 (41.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 12 0.00% 20 11 0.00% 21 27 0.00% 22 18 0.00% 23 21 0.00% 24 28 0.00% 25 28 0.00% 26 21 0.00% 27 31 0.00% 28 22 0.00% 29 28 0.00% 30 39 0.00% 31 29 0.00% 32 41 0.00% 33 43 0.00% 34 43 0.00% 35 55 0.00% 36 56 0.00% 37 60 0.00% 38 66 0.00% 39 69 0.00% 40 70 0.00% 41 80 0.00% 42 75 0.00% 43 91 0.00% 44 110 0.00% 45 104 0.00% 46 137 0.00% 47 127 0.00% 48 140 0.00% 49 178 0.00% 50 230 0.00% 51 243 0.00% 52 246 0.00% 53 298 0.00% 54 302 0.00% 55 337 0.00% 56 382 0.00% 57 408 0.00% 58 436 0.00% 59 508 0.00% 60 575 0.00% 61 645 0.00% 62 733 0.00% 63 849 0.00% 64 946 0.00% 65 1065 0.00% 66 1317 0.01% 67 1684 0.01% 68 1983 0.01% 69 4558 0.02% 70 4572 0.02% 71 2768 0.01% 72 2548 0.01% 73 2782 0.01% 74 2922 0.01% 75 3197 0.01% 76 3534 0.01% 77 3960 0.02% 78 4291 0.02% 79 4890 0.02% 80 5348 0.02% 81 6002 0.02% 82 6772 0.03% 83 7714 0.03% 84 9394 0.04% 85 10420 0.04% 86 11386 0.05% 87 12174 0.05% 88 13174 0.05% 89 13649 0.06% 90 14668 0.06% 91 15517 0.06% 92 16548 0.07% 93 18031 0.07% 94 19156 0.08% 95 20771 0.09% 96 21261 0.09% 97 22719 0.09% 98 23696 0.10% 99 25124 0.10% 100 26632 0.11% 101 27191 0.11% 102 28648 0.12% 103 30162 0.12% 104 31376 0.13% 105 33927 0.14% 106 35723 0.15% 107 36869 0.15% 108 38356 0.16% 109 40711 0.17% 110 42010 0.17% 111 42521 0.17% 112 44835 0.18% 113 47902 0.20% 114 48547 0.20% 115 51682 0.21% 116 54012 0.22% 117 54447 0.22% 118 56550 0.23% 119 58960 0.24% 120 61630 0.25% 121 63515 0.26% 122 66488 0.27% 123 69092 0.28% 124 72875 0.30% 125 74185 0.31% 126 76487 0.31% 127 80179 0.33% 128 82964 0.34% 129 86737 0.36% 130 90922 0.37% 131 93797 0.39% 132 99163 0.41% 133 104398 0.43% 134 109809 0.45% 135 115830 0.48% 136 122867 0.51% 137 130818 0.54% 138 140030 0.58% 139 150666 0.62% 140 162654 0.67% 141 180656 0.74% 142 201709 0.83% 143 229775 0.95% 144 268072 1.10% 145 325279 1.34% 146 408950 1.68% 147 556195 2.29% 148 857583 3.53% 149 1598038 6.57% 150 6336773 26.07% 151 10108055 41.59% 24305870 reads passed initial QC criterion=sequence-density sequence-density=1.28 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=15 prefix-density=1.34 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=15.61 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=9 prefix-density=1.00 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=41.22 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.3 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR7473352 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:40:07 Started mapping on | Dec 07 14:40:08 Finished on | Dec 07 14:48:01 Mapping speed, Million of reads per hour | 184.99 Number of input reads | 24305870 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 22254737 Uniquely mapped reads % | 91.56% Average mapped length | 292.49 Number of splices: Total | 24463947 Number of splices: Annotated (sjdb) | 23007409 Number of splices: GT/AG | 24156539 Number of splices: GC/AG | 275337 Number of splices: AT/AC | 10249 Number of splices: Non-canonical | 21822 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 194815 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 25600 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.81% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1872679 1872679 1872679 N_multimapping 194815 194815 194815 N_noFeature 744419 21428466 1127696 N_ambiguous 515584 3384 73794 UnstrandedReadsAssigned:20994734 PositiveStrandReadsAssigned:822887 NegativeStrandReadsAssigned:21053247 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473352 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473352-trimmed-pair1.fastq SRR7473352-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,305,870 reads, 21,132,046 reads pseudoaligned [quant] estimated average fragment length: 274.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52973 SRR7473352.ke.tsv 35125 SRR7473352.se.tsv 88098 total ==> SRR7473352.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.182 15.3677 1.4872 PNS24247 1044 770.177 35.0235 2.91851 PNS24249 1928 1654.18 25.9112 1.00531 PNS24246 1044 770.177 35.0235 2.91851 PNS24248 1044 770.177 35.0235 2.91851 PNS24244 1471 1197.18 91.6506 4.91325 PNS24243 293 93.9727 0 0 KQK14069 1603 1329.18 141.996 6.85625 KQK14071 474 229.098 3.76413 1.05447 ==> SRR7473352.se.tsv <== BRADI_1g14170v3 231 BRADI_1g53295v3 68 BRADI_1g59795v3 283 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 2282 BRADI_1g74790v3 228 BRADI_1g09890v3 9 BRADI_1g77505v3 268 BRADI_1g48960v3 0 SRR7473352 completed mapping pipeline successfully