Starting /dee2/code/volunteer_pipeline.sh SRR7473354 current disk space = 1542885097472 free memory = 1600144096 SRR7473354 SRAfilesize b9074011928a0e4a10a01f181430034e SRR7473354.sra SRR7473354.sra file validated SRR7473354 is paired end SRR7473354 is conventional basespace SRR7473354 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473354_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05325 34.0 33.0 34.0 33.0 34.0 2 33.38025 34.0 33.0 34.0 33.0 34.0 3 33.37025 34.0 34.0 34.0 33.0 34.0 4 33.37825 34.0 34.0 34.0 33.0 34.0 5 33.26125 34.0 33.0 34.0 33.0 34.0 6 36.9495 38.0 37.0 38.0 35.0 38.0 7 37.372 38.0 38.0 38.0 37.0 38.0 8 37.4255 38.0 38.0 38.0 37.0 38.0 9 37.43925 38.0 38.0 38.0 37.0 38.0 10-14 37.382600000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.387449999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.43445 38.0 38.0 38.0 37.2 38.0 25-29 37.26754999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.075950000000006 38.0 38.0 38.0 36.2 38.0 35-39 37.03145 38.0 38.0 38.0 36.0 38.0 40-44 36.82815 38.0 38.0 38.0 35.0 38.0 45-49 36.7928 38.0 38.0 38.0 35.0 38.0 50-54 36.60065 38.0 38.0 38.0 34.2 38.0 55-59 36.833600000000004 38.0 38.0 38.0 35.0 38.0 60-64 36.637600000000006 38.0 38.0 38.0 34.4 38.0 65-69 36.45125 38.0 38.0 38.0 33.8 38.0 70-74 36.277249999999995 38.0 38.0 38.0 33.6 38.0 75-79 36.339600000000004 38.0 38.0 38.0 33.8 38.0 80-84 36.2606 38.0 37.8 38.0 33.6 38.0 85-89 36.018499999999996 38.0 37.2 38.0 32.8 38.0 90-94 35.76855 38.0 36.6 38.0 32.0 38.0 95-99 35.4858 38.0 36.0 38.0 29.8 38.0 100-104 35.27525 38.0 36.0 38.0 29.0 38.0 105-109 35.042950000000005 38.0 35.8 38.0 28.6 38.0 110-114 34.7141 38.0 35.0 38.0 27.0 38.0 115-119 34.1792 38.0 34.6 38.0 23.2 38.0 120-124 33.948249999999994 38.0 34.2 38.0 22.6 38.0 125-129 33.33775 38.0 34.0 38.0 18.6 38.0 130-134 33.0089 38.0 33.6 38.0 15.0 38.0 135-139 32.38775 37.4 32.8 38.0 14.2 38.0 140-144 31.7566 36.0 32.0 38.0 13.6 38.0 145-149 30.063499999999998 36.0 29.8 38.0 6.4 38.0 150-151 25.149500000000003 33.5 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 3.0 12 2.0 13 2.0 14 2.0 15 7.0 16 5.0 17 5.0 18 9.0 19 11.0 20 7.0 21 15.0 22 9.0 23 15.0 24 17.0 25 24.0 26 33.0 27 41.0 28 49.0 29 59.0 30 71.0 31 89.0 32 112.0 33 155.0 34 264.0 35 426.0 36 985.0 37 1582.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.10212335692619 12.740141557128412 10.869565217391305 35.28816986855409 2 26.464697045568354 15.473209814722082 31.922884326489736 26.139208813219827 3 21.85 22.5 26.05 29.599999999999998 4 25.1 28.9 22.425 23.575 5 25.833124530192936 30.343272362816336 22.60085191681283 21.2227511901779 6 22.05 31.724999999999998 23.549999999999997 22.675 7 18.475 20.925 39.550000000000004 21.05 8 20.974999999999998 22.475 27.425 29.125 9 20.1 20.125 32.65 27.125 10-14 23.75 24.92 24.42 26.91 15-19 24.2 24.15 25.005 26.645000000000003 20-24 23.665 24.795 25.169999999999998 26.369999999999997 25-29 24.075 24.465 25.155 26.305 30-34 23.76 24.185000000000002 26.0 26.055 35-39 24.031201560078003 23.50117505875294 25.716285814290714 26.75133756687834 40-44 24.240908408783955 24.77614926717023 24.956230303636637 26.02671202040918 45-49 23.687368736873687 24.582458245824583 24.857485748574856 26.872687268726875 50-54 23.74 24.654999999999998 24.965 26.640000000000004 55-59 23.915 24.05 25.205 26.83 60-64 23.794999999999998 23.46 25.275 27.47 65-69 23.974999999999998 23.990000000000002 24.73 27.305 70-74 23.735 24.529999999999998 24.75 26.985 75-79 24.46 23.865 25.025 26.650000000000002 80-84 23.93 24.33 24.55 27.189999999999998 85-89 24.005000000000003 24.59 24.44 26.965 90-94 24.525941862210438 24.000600390253666 24.85115324961225 26.62230449792365 95-99 24.190800681431003 24.195811203527406 24.777031766710092 26.836356348331496 100-104 24.815 24.474999999999998 24.675 26.035000000000004 105-109 24.099999999999998 24.425 24.525 26.950000000000003 110-114 25.169999999999998 23.445 24.455 26.93 115-119 24.45 24.305 24.675 26.57 120-124 25.240096038415366 23.944577831132452 24.054621848739497 26.760704281712684 125-129 24.645452267602106 23.91881733901278 24.30969681784014 27.126033575544977 130-134 24.797137241066476 24.00080641096719 24.625774910538784 26.57628143742755 135-139 25.275721408067685 23.910963388225813 23.996575514931763 26.81673968877474 140-144 25.5819774718398 23.88986232790989 24.220275344180227 26.307884856070086 145-149 25.268032415563496 23.73785674737001 24.477777218503043 26.516333618563447 150-151 25.025252525252522 24.684343434343432 23.825757575757574 26.464646464646464 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 3.0 27 4.5 28 4.0 29 4.0 30 8.5 31 11.0 32 13.0 33 20.5 34 29.0 35 37.0 36 41.5 37 50.0 38 76.0 39 90.0 40 100.5 41 107.0 42 113.5 43 146.5 44 159.0 45 159.5 46 173.0 47 171.5 48 156.5 49 163.0 50 171.0 51 166.5 52 158.5 53 145.0 54 137.5 55 135.0 56 130.0 57 117.0 58 104.0 59 91.5 60 85.0 61 87.5 62 79.5 63 70.5 64 65.0 65 63.5 66 56.0 67 51.5 68 54.0 69 43.0 70 36.0 71 33.5 72 20.5 73 13.0 74 15.5 75 11.0 76 6.5 77 5.0 78 2.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.15 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.045 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.065 95-99 0.21 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.22499999999999998 130-134 0.795 135-139 0.715 140-144 0.125 145-149 0.6649999999999999 150-151 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.02462801436634 95.525 2 1.5135967162647512 2.9499999999999997 3 0.3078501795792714 0.8999999999999999 4 0.12827090815802974 0.5 5 0.02565418163160595 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1375000000000002 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.5125000000000002 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.025 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.8499999999999996 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACCT 10 0.006606125 146.6076 1 >>END_MODULE SRR7473354 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473354_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9595 33.0 33.0 34.0 31.0 34.0 2 32.23675 33.0 33.0 34.0 31.0 34.0 3 32.12175 34.0 33.0 34.0 32.0 34.0 4 32.13725 34.0 33.0 34.0 32.0 34.0 5 32.02775 34.0 33.0 34.0 32.0 34.0 6 36.0735 38.0 38.0 38.0 34.0 38.0 7 36.46975 38.0 38.0 38.0 35.0 38.0 8 36.565 38.0 38.0 38.0 35.0 38.0 9 36.5745 38.0 38.0 38.0 35.0 38.0 10-14 36.70515 38.0 38.0 38.0 36.0 38.0 15-19 36.45315 38.0 38.0 38.0 35.4 38.0 20-24 35.9704 38.0 38.0 38.0 34.0 38.0 25-29 36.2224 38.0 38.0 38.0 34.8 38.0 30-34 36.35555000000001 38.0 38.0 38.0 35.4 38.0 35-39 36.3389 38.0 38.0 38.0 35.6 38.0 40-44 36.2848 38.0 38.0 38.0 35.4 38.0 45-49 36.12035 38.0 38.0 38.0 34.4 38.0 50-54 36.19615 38.0 38.0 38.0 34.8 38.0 55-59 36.112899999999996 38.0 38.0 38.0 34.4 38.0 60-64 35.9929 38.0 38.0 38.0 34.0 38.0 65-69 35.61385 38.0 38.0 38.0 33.0 38.0 70-74 35.8047 38.0 38.0 38.0 33.0 38.0 75-79 35.7598 38.0 38.0 38.0 33.0 38.0 80-84 35.7247 38.0 38.0 38.0 33.0 38.0 85-89 35.673500000000004 38.0 38.0 38.0 33.0 38.0 90-94 35.4836 38.0 38.0 38.0 32.2 38.0 95-99 34.86785 38.0 37.2 38.0 29.0 38.0 100-104 34.161500000000004 38.0 36.2 38.0 23.4 38.0 105-109 34.143299999999996 38.0 36.0 38.0 23.0 38.0 110-114 33.812 38.0 35.4 38.0 20.2 38.0 115-119 33.31925 38.0 35.0 38.0 15.0 38.0 120-124 33.29075 38.0 35.0 38.0 14.8 38.0 125-129 33.001400000000004 38.0 34.4 38.0 14.0 38.0 130-134 32.407149999999994 38.0 33.4 38.0 13.0 38.0 135-139 32.0551 38.0 32.8 38.0 13.0 38.0 140-144 31.2922 38.0 31.2 38.0 6.4 38.0 145-149 30.05925 38.0 29.2 38.0 2.0 38.0 150-151 24.457125 31.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 31.0 4 16.0 5 3.0 6 1.0 7 6.0 8 2.0 9 0.0 10 2.0 11 5.0 12 2.0 13 11.0 14 12.0 15 9.0 16 18.0 17 13.0 18 9.0 19 16.0 20 21.0 21 14.0 22 9.0 23 13.0 24 50.0 25 26.0 26 23.0 27 29.0 28 53.0 29 40.0 30 51.0 31 65.0 32 97.0 33 119.0 34 163.0 35 271.0 36 694.0 37 2081.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.95304080061586 18.835001283038235 12.034898639979472 30.177059276366435 2 32.12646608873024 21.57062723100459 25.395206527282 20.90770015298317 3 24.858902001026166 24.371472550025654 26.192919445869677 24.576706003078503 4 26.19229788319306 30.757459831675593 18.566692170364703 24.483550114766643 5 26.654694715238588 33.73524884556183 18.522319138019498 21.08773730118009 6 24.507042253521128 34.08450704225352 18.693982074263765 22.714468629961587 7 23.318158826504806 16.944865958523014 34.59787556904401 25.139099645928177 8 24.1136535076691 22.15237616293689 22.15237616293689 31.581594166457126 9 24.893670252689517 22.39179384538404 24.39329497122842 28.32124093069802 10-14 27.040432887419207 24.941129315095946 22.110326168645724 25.90811162883912 15-19 26.754518832676965 24.492578006664647 22.8516611127941 25.90124204786428 20-24 26.198376639950993 25.248864158456275 23.104803716371432 25.447955485221296 25-29 26.535576728157306 24.229677680924386 22.952564362456922 26.282181228461383 30-34 26.850258175559382 24.91647261314164 23.215551280753267 25.017717930545714 35-39 26.783181357649443 24.235055724417425 23.353596757852078 25.628166160081058 40-44 26.909643128321942 24.555808656036447 22.713237155150594 25.821311060491013 45-49 26.831376137461238 24.792842255096335 22.342534695745005 26.03324691169742 50-54 27.430766120881344 24.161107742065898 23.377804730139477 25.03032140691328 55-59 27.582195245321195 24.63834092058675 22.72635306019221 25.05311077389985 60-64 26.956036712134274 24.577861163227016 22.798032554130117 25.668069570508596 65-69 27.067130577159233 24.718583708555055 23.188702415063446 25.02558329922227 70-74 26.754430379746836 24.131645569620254 23.098734177215192 26.01518987341772 75-79 26.759638219392652 24.32924056389268 22.990248092567327 25.92087312414734 80-84 26.752041948169808 24.68992638902894 23.464757487143288 25.09327417565796 85-89 27.404910444757498 24.05413564097404 23.07305292815456 25.467900986113907 90-94 27.15674362089915 24.55447549615229 22.777440259214256 25.51134062373431 95-99 26.569155760841674 24.464973056197074 23.479599692070824 25.486271490890427 100-104 27.644218287553873 23.90570642297108 23.246274469079392 25.20380082039566 105-109 27.10222268276255 24.863996684109633 22.96772187969535 25.066058753432465 110-114 27.381445433837232 24.549596189687307 23.736798509008075 24.332159867467386 115-119 27.65527950310559 24.65320910973085 22.851966873706004 24.839544513457557 120-124 27.407445654980123 24.52625600247844 23.436773893736767 24.62952444880467 125-129 27.63777490297542 24.65717981888745 23.063389391979303 24.641655886157825 130-134 27.695330678938934 24.577279073375045 23.21733285071617 24.510057396969852 135-139 28.179397911120212 25.27134958017612 22.475936924022115 24.07331558468155 140-144 27.825908648177577 25.380632593427997 22.77131286204952 24.022145896344902 145-149 27.932932160674795 25.45389086046392 23.134289975826775 23.478887003034508 150-151 27.92887029288703 25.183054393305436 22.554916317991633 24.3331589958159 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.5 2 2.0 3 3.0 4 4.0 5 3.5 6 2.0 7 2.0 8 2.5 9 1.5 10 0.5 11 1.0 12 3.0 13 2.5 14 4.0 15 4.5 16 1.5 17 0.5 18 0.5 19 2.0 20 3.0 21 4.0 22 3.0 23 1.0 24 1.5 25 3.5 26 4.5 27 4.0 28 4.5 29 7.5 30 8.0 31 7.5 32 11.0 33 15.5 34 16.0 35 24.5 36 30.0 37 32.0 38 50.0 39 67.5 40 81.5 41 95.5 42 112.5 43 116.5 44 124.0 45 142.0 46 149.5 47 158.0 48 156.5 49 157.5 50 153.5 51 136.0 52 136.5 53 142.0 54 140.5 55 128.5 56 122.0 57 115.0 58 116.5 59 124.0 60 112.5 61 107.5 62 113.0 63 103.0 64 80.0 65 76.5 66 71.0 67 68.0 68 72.5 69 58.5 70 42.0 71 33.0 72 28.0 73 25.0 74 19.5 75 14.5 76 8.5 77 5.0 78 5.0 79 2.5 80 1.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 1.95 3 2.55 4 1.975 5 2.55 6 2.375 7 1.15 8 0.575 9 0.075 10-14 0.20500000000000002 15-19 0.97 20-24 2.0549999999999997 25-29 1.34 30-34 1.23 35-39 1.3 40-44 1.225 45-49 1.645 50-54 1.06 55-59 1.15 60-64 1.395 65-69 2.2800000000000002 70-74 1.25 75-79 1.045 80-84 0.83 85-89 0.62 90-94 1.24 95-99 2.5749999999999997 100-104 3.705 105-109 3.495 110-114 3.42 115-119 3.4000000000000004 120-124 3.1649999999999996 125-129 3.375 130-134 3.305 135-139 2.34 140-144 2.465 145-149 2.785 150-151 4.3999999999999995 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.1006160164271 95.55 2 1.3603696098562628 2.65 3 0.3593429158110883 1.05 4 0.1540041067761807 0.6 5 0.0 0.0 6 0.025667351129363452 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9125000000000001 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.3250000000000002 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.1 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.3125 0.0 0.0 0.0 0.0 136-137 4.625 0.0 0.0 0.0 0.0 138-139 4.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309645 spots for SRR7473354.sra Written 1309645 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra Read 1309640 spots for SRR7473354.sra Written 1309640 spots for SRR7473354.sra SRR ids: ['SRR7473354.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pkvkhwwc SRR7473354.sra spots: 26192805 blocks: [[1, 1309640], [1309641, 2619280], [2619281, 3928920], [3928921, 5238560], [5238561, 6548200], [6548201, 7857840], [7857841, 9167480], [9167481, 10477120], [10477121, 11786760], [11786761, 13096400], [13096401, 14406040], [14406041, 15715680], [15715681, 17025320], [17025321, 18334960], [18334961, 19644600], [19644601, 20954240], [20954241, 22263880], [22263881, 23573520], [23573521, 24883160], [24883161, 26192805]] SRR7473354 file size 8854181 SRR7473354 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473354 SRR7473354_1.fastq SRR7473354_2.fastq Input file: SRR7473354_1.fastq Paired file: SRR7473354_2.fastq trimmed: SRR7473354-trimmed-pair1.fastq, SRR7473354-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:42:14 2024 >> started Sat Dec 7 14:42:42 2024 >> done (27.847s) 26192805 read pairs processed; of these: 54935 ( 0.21%) short read pairs filtered out after trimming by size control 112237 ( 0.43%) empty read pairs filtered out after trimming by size control 26025633 (99.36%) read pairs available; of these: 15194035 (58.38%) trimmed read pairs available after processing 10831598 (41.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 28 0.00% 20 27 0.00% 21 25 0.00% 22 31 0.00% 23 30 0.00% 24 33 0.00% 25 36 0.00% 26 44 0.00% 27 43 0.00% 28 40 0.00% 29 50 0.00% 30 63 0.00% 31 55 0.00% 32 41 0.00% 33 51 0.00% 34 53 0.00% 35 64 0.00% 36 72 0.00% 37 65 0.00% 38 80 0.00% 39 102 0.00% 40 90 0.00% 41 89 0.00% 42 123 0.00% 43 110 0.00% 44 137 0.00% 45 133 0.00% 46 166 0.00% 47 185 0.00% 48 197 0.00% 49 212 0.00% 50 274 0.00% 51 258 0.00% 52 339 0.00% 53 316 0.00% 54 351 0.00% 55 363 0.00% 56 419 0.00% 57 420 0.00% 58 517 0.00% 59 560 0.00% 60 606 0.00% 61 760 0.00% 62 744 0.00% 63 895 0.00% 64 1003 0.00% 65 1259 0.00% 66 1386 0.01% 67 1518 0.01% 68 1858 0.01% 69 3862 0.01% 70 6447 0.02% 71 5869 0.02% 72 4145 0.02% 73 3073 0.01% 74 2981 0.01% 75 2962 0.01% 76 3089 0.01% 77 3338 0.01% 78 3629 0.01% 79 3976 0.02% 80 4473 0.02% 81 5072 0.02% 82 5834 0.02% 83 6852 0.03% 84 9244 0.04% 85 10036 0.04% 86 10290 0.04% 87 10786 0.04% 88 11204 0.04% 89 11619 0.04% 90 12621 0.05% 91 13755 0.05% 92 14556 0.06% 93 16520 0.06% 94 17511 0.07% 95 18886 0.07% 96 19073 0.07% 97 19759 0.08% 98 19730 0.08% 99 21227 0.08% 100 22827 0.09% 101 23309 0.09% 102 25430 0.10% 103 27617 0.11% 104 29138 0.11% 105 32012 0.12% 106 32157 0.12% 107 33042 0.13% 108 34111 0.13% 109 36326 0.14% 110 37127 0.14% 111 38332 0.15% 112 41671 0.16% 113 44921 0.17% 114 46885 0.18% 115 50724 0.19% 116 52540 0.20% 117 52792 0.20% 118 54110 0.21% 119 55099 0.21% 120 57780 0.22% 121 60339 0.23% 122 64155 0.25% 123 68215 0.26% 124 74029 0.28% 125 76158 0.29% 126 78643 0.30% 127 81680 0.31% 128 83589 0.32% 129 86586 0.33% 130 90547 0.35% 131 94798 0.36% 132 101527 0.39% 133 108298 0.42% 134 117256 0.45% 135 125529 0.48% 136 133275 0.51% 137 142403 0.55% 138 150407 0.58% 139 161476 0.62% 140 174114 0.67% 141 194461 0.75% 142 217383 0.84% 143 249459 0.96% 144 294023 1.13% 145 354947 1.36% 146 449034 1.73% 147 607593 2.33% 148 916790 3.52% 149 1761301 6.77% 150 6929306 26.62% 151 10831598 41.62% 26025633 reads passed initial QC criterion=sequence-density sequence-density=1.30 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=14 prefix-density=1.34 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=24.11 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.7 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=3.50 fanout-score-rank=10 prefix-density=1.07 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=98.74 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=7.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473354 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:43:27 Started mapping on | Dec 07 14:43:27 Finished on | Dec 07 14:50:01 Mapping speed, Million of reads per hour | 237.80 Number of input reads | 26025633 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 23605670 Uniquely mapped reads % | 90.70% Average mapped length | 293.35 Number of splices: Total | 25350319 Number of splices: Annotated (sjdb) | 23953801 Number of splices: GT/AG | 25031585 Number of splices: GC/AG | 284164 Number of splices: AT/AC | 11032 Number of splices: Non-canonical | 23538 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226859 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 31379 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.32% % of reads unmapped: other | 0.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2222477 2222477 2222477 N_multimapping 226859 226859 226859 N_noFeature 644248 22931530 833989 N_ambiguous 565087 3098 82159 UnstrandedReadsAssigned:22396335 PositiveStrandReadsAssigned:671042 NegativeStrandReadsAssigned:22689522 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473354 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473354-trimmed-pair1.fastq SRR7473354-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,025,633 reads, 22,799,308 reads pseudoaligned [quant] estimated average fragment length: 278.141 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52973 SRR7473354.ke.tsv 35125 SRR7473354.se.tsv 88098 total ==> SRR7473354.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.51 0 0 PNS24247 1044 766.859 38.4958 2.72412 PNS24249 1928 1650.86 52.8258 1.73646 PNS24246 1044 766.859 38.4958 2.72412 PNS24248 1044 766.859 38.4958 2.72412 PNS24244 1471 1193.86 113.687 5.16758 PNS24243 293 88.7049 1 0.611761 KQK14069 1603 1325.86 204.55 8.37206 KQK14071 474 222.855 8.98378 2.18759 ==> SRR7473354.se.tsv <== BRADI_1g14170v3 268 BRADI_1g53295v3 54 BRADI_1g59795v3 274 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 2607 BRADI_1g74790v3 252 BRADI_1g09890v3 8 BRADI_1g77505v3 422 BRADI_1g48960v3 0 SRR7473354 completed mapping pipeline successfully