Starting /dee2/code/volunteer_pipeline.sh SRR7473355 current disk space = 1515896553472 free memory = 1598432348 SRR7473355 SRAfilesize 1d0c96491e8b54fc48949837d065eac5 SRR7473355.sra SRR7473355.sra file validated SRR7473355 is paired end SRR7473355 is conventional basespace SRR7473355 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473355_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.337 34.0 33.0 34.0 33.0 34.0 2 33.38275 34.0 34.0 34.0 33.0 34.0 3 33.45675 34.0 34.0 34.0 33.0 34.0 4 33.4585 34.0 34.0 34.0 33.0 34.0 5 33.4305 34.0 34.0 34.0 33.0 34.0 6 37.049 38.0 38.0 38.0 36.0 38.0 7 37.4045 38.0 38.0 38.0 37.0 38.0 8 37.44725 38.0 38.0 38.0 37.0 38.0 9 37.42425 38.0 38.0 38.0 37.0 38.0 10-14 37.4254 38.0 38.0 38.0 37.4 38.0 15-19 37.428450000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.42345 38.0 38.0 38.0 37.2 38.0 25-29 37.361900000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.04795 38.0 38.0 38.0 36.2 38.0 35-39 37.108549999999994 38.0 38.0 38.0 36.6 38.0 40-44 37.0129 38.0 38.0 38.0 36.0 38.0 45-49 36.9521 38.0 38.0 38.0 35.8 38.0 50-54 36.7905 38.0 38.0 38.0 35.2 38.0 55-59 36.97430000000001 38.0 38.0 38.0 35.6 38.0 60-64 36.891000000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.66655000000001 38.0 38.0 38.0 34.8 38.0 70-74 36.54845 38.0 38.0 38.0 34.2 38.0 75-79 36.67305 38.0 38.0 38.0 34.8 38.0 80-84 36.46655 38.0 38.0 38.0 34.0 38.0 85-89 36.4464 38.0 38.0 38.0 34.0 38.0 90-94 36.147999999999996 38.0 37.6 38.0 33.6 38.0 95-99 35.850300000000004 38.0 37.0 38.0 31.6 38.0 100-104 35.68035 38.0 36.6 38.0 31.0 38.0 105-109 35.664249999999996 38.0 36.0 38.0 30.8 38.0 110-114 35.3347 38.0 35.8 38.0 30.2 38.0 115-119 34.8415 38.0 35.0 38.0 27.8 38.0 120-124 34.734700000000004 38.0 35.0 38.0 27.2 38.0 125-129 34.36535 38.0 34.8 38.0 25.2 38.0 130-134 33.9149 38.0 34.2 38.0 23.0 38.0 135-139 33.18125 38.0 33.6 38.0 17.4 38.0 140-144 32.74210000000001 38.0 33.0 38.0 14.4 38.0 145-149 31.659499999999998 36.6 32.2 38.0 11.2 38.0 150-151 26.91725 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 3.0 17 1.0 18 7.0 19 7.0 20 3.0 21 13.0 22 11.0 23 12.0 24 8.0 25 13.0 26 28.0 27 36.0 28 36.0 29 39.0 30 44.0 31 83.0 32 101.0 33 153.0 34 213.0 35 364.0 36 936.0 37 1877.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.23377599599098 11.47582059634177 10.623903783512905 40.66649962415435 2 24.53066332916145 16.12015018773467 33.76720901126408 25.5819774718398 3 22.15 20.4 25.275 32.175 4 27.325 28.175 21.475 23.025000000000002 5 26.375 29.9 22.725 21.0 6 21.05 34.150000000000006 23.175 21.625 7 16.925 20.925 40.825 21.325 8 20.875 22.55 28.599999999999998 27.975 9 21.15 20.925 32.574999999999996 25.35 10-14 23.49 25.105 24.825 26.58 15-19 23.625 25.235000000000003 25.085 26.055 20-24 23.385 25.045 25.36 26.21 25-29 23.615 24.895 25.4 26.090000000000003 30-34 23.43 24.445 25.8 26.325 35-39 23.111155557777888 25.136256812840642 25.796289814490724 25.956297814890743 40-44 23.76856528479272 24.988748312246837 24.933740061009154 26.308946341951295 45-49 23.41 24.68 25.290000000000003 26.619999999999997 50-54 23.3 24.55 25.080000000000002 27.07 55-59 23.9 24.58 24.575 26.945000000000004 60-64 23.385 24.959999999999997 24.81 26.845000000000002 65-69 23.995 24.605 25.055 26.345000000000002 70-74 23.775 24.715 24.755 26.755000000000003 75-79 24.125 25.035 24.575 26.265 80-84 23.945 24.505 25.445 26.105 85-89 24.4 25.245 24.29 26.064999999999998 90-94 24.191934354047834 25.16761733213249 24.48714099869909 26.153307315120582 95-99 23.998397435897438 24.384014423076923 25.215344551282055 26.40224358974359 100-104 24.610000000000003 24.195 24.915000000000003 26.279999999999998 105-109 24.215 24.69 24.48 26.615 110-114 24.610000000000003 25.295 24.310000000000002 25.785000000000004 115-119 24.385 24.990000000000002 24.4 26.224999999999998 120-124 23.94 25.005 24.415 26.640000000000004 125-129 24.455 24.62 24.325 26.6 130-134 24.43609022556391 24.847117794486216 24.471177944862156 26.245614035087723 135-139 24.846902921393436 24.626041562092162 24.861961650436704 25.665093866077704 140-144 24.95373380683239 24.943730305606962 24.338518481468512 25.764017406092133 145-149 24.16420229562428 24.6654303042454 25.031326750538817 26.1390406495915 150-151 25.62170308967596 23.97638784225069 23.687515699572973 26.714393368500378 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.5 28 2.5 29 2.5 30 4.0 31 14.5 32 21.5 33 21.0 34 29.5 35 36.0 36 48.5 37 66.5 38 77.5 39 88.0 40 107.0 41 122.5 42 153.5 43 182.0 44 186.0 45 182.5 46 169.5 47 175.0 48 175.0 49 174.0 50 168.0 51 144.5 52 126.5 53 114.0 54 110.0 55 111.0 56 105.0 57 100.5 58 97.0 59 87.5 60 84.5 61 81.5 62 79.0 63 66.5 64 69.5 65 71.5 66 58.0 67 52.5 68 46.5 69 40.5 70 37.0 71 28.5 72 18.5 73 19.5 74 13.5 75 7.0 76 4.5 77 4.0 78 4.0 79 2.5 80 2.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.06999999999999999 95-99 0.16 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.25 135-139 0.38999999999999996 140-144 0.034999999999999996 145-149 0.245 150-151 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14163090128756 98.175 2 0.7321383489017925 1.4500000000000002 3 0.12623074981065388 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.9249999999999999 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.1125 0.0 0.0 0.0 0.0 132-133 5.449999999999999 0.0 0.0 0.0 0.0 134-135 5.800000000000001 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGAC 10 0.006830828 145.0 4 >>END_MODULE SRR7473355 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473355_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10475 33.0 33.0 34.0 32.0 34.0 2 32.11175 33.0 33.0 34.0 32.0 34.0 3 32.2125 34.0 33.0 34.0 32.0 34.0 4 32.05725 34.0 33.0 34.0 32.0 34.0 5 32.1555 34.0 33.0 34.0 32.0 34.0 6 36.6275 38.0 38.0 38.0 35.0 38.0 7 36.81175 38.0 38.0 38.0 35.0 38.0 8 36.78275 38.0 38.0 38.0 36.0 38.0 9 36.9235 38.0 38.0 38.0 36.0 38.0 10-14 36.96565 38.0 38.0 38.0 36.4 38.0 15-19 36.79605 38.0 38.0 38.0 36.0 38.0 20-24 36.546200000000006 38.0 38.0 38.0 36.0 38.0 25-29 36.67295 38.0 38.0 38.0 36.0 38.0 30-34 36.721500000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.52955000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.648450000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.3532 38.0 38.0 38.0 35.2 38.0 50-54 36.463649999999994 38.0 38.0 38.0 35.2 38.0 55-59 36.5384 38.0 38.0 38.0 35.2 38.0 60-64 36.38340000000001 38.0 38.0 38.0 35.0 38.0 65-69 35.90445 38.0 38.0 38.0 33.6 38.0 70-74 36.1948 38.0 38.0 38.0 34.0 38.0 75-79 36.25805 38.0 38.0 38.0 34.0 38.0 80-84 36.09765 38.0 38.0 38.0 34.0 38.0 85-89 35.939800000000005 38.0 38.0 38.0 33.6 38.0 90-94 35.73895 38.0 38.0 38.0 32.6 38.0 95-99 35.3687 38.0 38.0 38.0 31.4 38.0 100-104 34.7465 38.0 36.6 38.0 27.4 38.0 105-109 34.68875 38.0 36.4 38.0 27.0 38.0 110-114 34.36845 38.0 36.0 38.0 25.0 38.0 115-119 33.79805 38.0 35.0 38.0 21.0 38.0 120-124 33.86999999999999 38.0 35.0 38.0 21.8 38.0 125-129 33.6892 38.0 34.8 38.0 20.4 38.0 130-134 33.205650000000006 38.0 34.2 38.0 15.8 38.0 135-139 32.745 38.0 33.8 38.0 13.8 38.0 140-144 32.182750000000006 38.0 32.8 38.0 13.0 38.0 145-149 31.106199999999994 38.0 31.2 38.0 6.4 38.0 150-151 26.042 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 8.0 4 23.0 5 2.0 6 3.0 7 2.0 8 3.0 9 4.0 10 3.0 11 3.0 12 4.0 13 7.0 14 4.0 15 8.0 16 8.0 17 12.0 18 13.0 19 17.0 20 13.0 21 13.0 22 12.0 23 30.0 24 20.0 25 21.0 26 32.0 27 31.0 28 35.0 29 46.0 30 63.0 31 69.0 32 85.0 33 108.0 34 175.0 35 252.0 36 645.0 37 2217.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45563794425978 17.872666837126054 10.9946305292764 32.67706468933776 2 30.315465503975382 22.749422928956143 27.34034367786612 19.594767889202362 3 23.759590792838875 24.42455242966752 26.317135549872123 25.498721227621484 4 27.445442875481383 30.80872913992298 18.305519897304237 23.4403080872914 5 28.890028197897976 32.27377595488336 17.94411689310433 20.89207895411433 6 22.747861097131352 34.87669854051333 20.105686965274284 22.269753397081026 7 22.55563890972743 17.079269817454364 36.1090272568142 24.256064016004 8 24.356089022255563 22.030507626906726 22.95573893473368 30.657664416104026 9 23.40585146286572 20.7551887971993 27.806951737934483 28.032008002000502 10-14 26.270508203281313 24.714885954381753 22.24389755902361 26.770708283313326 15-19 26.293060158682337 24.912122125138094 23.5161193130461 25.278698403133475 20-24 26.075987688581666 25.198042282658058 23.250416267218327 25.475553761541953 25-29 26.118652589240828 24.43438914027149 23.720462543991953 25.726495726495724 30-34 26.10854735152488 24.197431781701447 23.94161316211878 25.752407704654896 35-39 26.30091354161409 23.868167364861453 24.539443799525564 25.29147529399889 40-44 26.28594369448487 24.203342199026444 23.837005068500027 25.673709037988658 45-49 25.86259233026409 24.45613680056663 23.74279065061216 25.93848021855712 50-54 26.99405062014722 24.518503579711606 23.646263991126347 24.841181809014824 55-59 26.91459502806736 24.08279871692061 24.29831595829992 24.70429029671211 60-64 26.28508198370385 24.278241625590987 23.780303792375012 25.656372598330147 65-69 26.214430894308943 24.471544715447155 23.97357723577236 25.340447154471548 70-74 27.0565164923572 24.029565567176185 23.692679002413517 25.221238938053098 75-79 26.770786404365023 23.84241878159884 23.76733243229714 25.619462381738998 80-84 25.940584139071188 24.893542407695005 23.78638344772306 25.379490005510746 85-89 26.523046092184373 24.18837675350701 24.228456913827657 25.06012024048096 90-94 26.318962918299672 24.168425283891064 24.173449904532205 25.33916189327706 95-99 26.09930516812903 24.79078967388548 24.024953086169294 25.084952071816197 100-104 27.058643236616263 24.959133633020024 23.155905190028605 24.826317940335105 105-109 26.580011258379816 25.218770789621818 23.21273220408372 24.98848574791464 110-114 26.551211764103087 25.07045140134242 23.74340318696521 24.63493364758928 115-119 26.257586668038268 25.300894969653324 23.829852895792612 24.61166546651579 120-124 26.905211576744424 25.256495329488033 23.80174569955592 24.036547394211627 125-129 27.089278434569913 24.836934366082346 24.205055034651444 23.86873216469629 130-134 27.263427109974426 25.39130434782609 23.47314578005115 23.872122762148337 135-139 27.517356712106622 25.150762681802057 23.377084072366085 23.95479653372523 140-144 27.670443050778882 25.010115314586283 24.02387214242363 23.295569492211207 145-149 27.647208768799388 25.77619169003314 23.181238847820545 23.395360693346927 150-151 28.79372427983539 26.06738683127572 22.878086419753085 22.2608024691358 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.5 12 1.0 13 0.5 14 2.0 15 3.0 16 2.0 17 1.5 18 2.0 19 2.0 20 1.5 21 1.5 22 2.0 23 2.0 24 1.0 25 1.0 26 4.0 27 5.5 28 6.5 29 6.0 30 4.5 31 6.5 32 10.0 33 15.0 34 20.0 35 31.0 36 44.0 37 52.5 38 53.5 39 72.5 40 107.0 41 113.0 42 113.0 43 136.5 44 160.5 45 157.0 46 151.5 47 158.5 48 161.5 49 158.5 50 149.0 51 137.5 52 132.5 53 127.5 54 118.0 55 115.0 56 108.5 57 107.0 58 118.0 59 114.0 60 102.0 61 103.0 62 95.5 63 85.0 64 83.0 65 79.5 66 69.5 67 67.0 68 74.0 69 62.5 70 43.0 71 37.5 72 31.5 73 18.5 74 12.5 75 10.5 76 10.0 77 6.5 78 2.5 79 1.5 80 0.5 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 2.5250000000000004 3 2.25 4 2.625 5 2.475 6 0.65 7 0.025 8 0.025 9 0.025 10-14 0.04 15-19 0.43 20-24 0.905 25-29 0.5499999999999999 30-34 0.32 35-39 0.935 40-44 0.365 45-49 1.17 50-54 0.83 55-59 0.24 60-64 0.59 65-69 1.6 70-74 0.5599999999999999 75-79 0.11499999999999999 80-84 0.19499999999999998 85-89 0.2 90-94 0.49 95-99 1.415 100-104 2.12 105-109 2.2950000000000004 110-114 2.415 115-119 2.79 120-124 2.045 125-129 1.8800000000000001 130-134 2.25 135-139 1.335 140-144 1.1400000000000001 145-149 1.925 150-151 2.8000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75602944909876 97.25 2 1.0662604722010662 2.1 3 0.07616146230007616 0.22499999999999998 4 0.07616146230007616 0.3 5 0.02538715410002539 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.4000000000000004 0.0 0.0 0.0 0.0 124-125 3.775 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAGTG 10 0.006349618 148.48685 5 ACAGTGC 10 0.007416892 141.0625 6 TACGATG 10 0.007416892 141.0625 9 CAGTGCT 10 0.007416892 141.0625 7 >>END_MODULE Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146882 spots for SRR7473355.sra Written 1146882 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra Read 1146866 spots for SRR7473355.sra Written 1146866 spots for SRR7473355.sra SRR ids: ['SRR7473355.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qf48m2el SRR7473355.sra spots: 22937336 blocks: [[1, 1146866], [1146867, 2293732], [2293733, 3440598], [3440599, 4587464], [4587465, 5734330], [5734331, 6881196], [6881197, 8028062], [8028063, 9174928], [9174929, 10321794], [10321795, 11468660], [11468661, 12615526], [12615527, 13762392], [13762393, 14909258], [14909259, 16056124], [16056125, 17202990], [17202991, 18349856], [18349857, 19496722], [19496723, 20643588], [20643589, 21790454], [21790455, 22937336]] SRR7473355 file size 7751010 SRR7473355 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473355 SRR7473355_1.fastq SRR7473355_2.fastq Input file: SRR7473355_1.fastq Paired file: SRR7473355_2.fastq trimmed: SRR7473355-trimmed-pair1.fastq, SRR7473355-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:34:08 2024 >> started Thu Dec 12 02:34:36 2024 >> done (28.089s) 22937336 read pairs processed; of these: 37561 ( 0.16%) short read pairs filtered out after trimming by size control 72200 ( 0.31%) empty read pairs filtered out after trimming by size control 22827575 (99.52%) read pairs available; of these: 12938482 (56.68%) trimmed read pairs available after processing 9889093 (43.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 17 0.00% 20 19 0.00% 21 27 0.00% 22 23 0.00% 23 31 0.00% 24 29 0.00% 25 29 0.00% 26 23 0.00% 27 29 0.00% 28 29 0.00% 29 43 0.00% 30 49 0.00% 31 38 0.00% 32 40 0.00% 33 33 0.00% 34 52 0.00% 35 46 0.00% 36 53 0.00% 37 81 0.00% 38 62 0.00% 39 70 0.00% 40 87 0.00% 41 86 0.00% 42 103 0.00% 43 87 0.00% 44 111 0.00% 45 119 0.00% 46 154 0.00% 47 130 0.00% 48 177 0.00% 49 143 0.00% 50 189 0.00% 51 209 0.00% 52 229 0.00% 53 235 0.00% 54 289 0.00% 55 346 0.00% 56 319 0.00% 57 331 0.00% 58 421 0.00% 59 419 0.00% 60 490 0.00% 61 623 0.00% 62 608 0.00% 63 671 0.00% 64 769 0.00% 65 853 0.00% 66 973 0.00% 67 1122 0.00% 68 1315 0.01% 69 1856 0.01% 70 2042 0.01% 71 1685 0.01% 72 1896 0.01% 73 2051 0.01% 74 2166 0.01% 75 2415 0.01% 76 2652 0.01% 77 3008 0.01% 78 3321 0.01% 79 3699 0.02% 80 4079 0.02% 81 4648 0.02% 82 5327 0.02% 83 6015 0.03% 84 7917 0.03% 85 8764 0.04% 86 9255 0.04% 87 9738 0.04% 88 10538 0.05% 89 11033 0.05% 90 11922 0.05% 91 12879 0.06% 92 13637 0.06% 93 15411 0.07% 94 16711 0.07% 95 17692 0.08% 96 18371 0.08% 97 19932 0.09% 98 20254 0.09% 99 21265 0.09% 100 22852 0.10% 101 23922 0.10% 102 25497 0.11% 103 27296 0.12% 104 28816 0.13% 105 30749 0.13% 106 32532 0.14% 107 33545 0.15% 108 35444 0.16% 109 37549 0.16% 110 39236 0.17% 111 39957 0.18% 112 41904 0.18% 113 45059 0.20% 114 46664 0.20% 115 49534 0.22% 116 51779 0.23% 117 52370 0.23% 118 54456 0.24% 119 56354 0.25% 120 59034 0.26% 121 60634 0.27% 122 64096 0.28% 123 67011 0.29% 124 70499 0.31% 125 71868 0.31% 126 74726 0.33% 127 77916 0.34% 128 80239 0.35% 129 83363 0.37% 130 87025 0.38% 131 89992 0.39% 132 93940 0.41% 133 99373 0.44% 134 104527 0.46% 135 110400 0.48% 136 117249 0.51% 137 124665 0.55% 138 131929 0.58% 139 141290 0.62% 140 151107 0.66% 141 165425 0.72% 142 182976 0.80% 143 205052 0.90% 144 236696 1.04% 145 283033 1.24% 146 352745 1.55% 147 475679 2.08% 148 727152 3.19% 149 1394603 6.11% 150 5894099 25.82% 151 9889093 43.32% 22827575 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=19 prefix-density=0.91 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=88.99 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=11.8 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=26 prefix-density=1.00 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=90.64 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.0 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473355 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:36:14 Started mapping on | Dec 12 02:36:14 Finished on | Dec 12 02:42:22 Mapping speed, Million of reads per hour | 223.31 Number of input reads | 22827575 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21259808 Uniquely mapped reads % | 93.13% Average mapped length | 292.74 Number of splices: Total | 22972008 Number of splices: Annotated (sjdb) | 21580918 Number of splices: GT/AG | 22666221 Number of splices: GC/AG | 272170 Number of splices: AT/AC | 10827 Number of splices: Non-canonical | 22790 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182987 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 19346 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.36% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1403577 1403577 1403577 N_multimapping 182987 182987 182987 N_noFeature 718754 20510832 988388 N_ambiguous 570136 3689 90997 UnstrandedReadsAssigned:19970918 PositiveStrandReadsAssigned:745287 NegativeStrandReadsAssigned:20180423 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473355 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473355-trimmed-pair1.fastq SRR7473355-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,827,575 reads, 20,274,379 reads pseudoaligned [quant] estimated average fragment length: 265.557 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52973 SRR7473355.ke.tsv 35125 SRR7473355.se.tsv 88098 total ==> SRR7473355.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.073 5.05264 0.467932 PNS24247 1044 779.443 47.7195 3.81059 PNS24249 1928 1663.44 113.693 4.25409 PNS24246 1044 779.443 47.7195 3.81059 PNS24248 1044 779.443 47.7195 3.81059 PNS24244 1471 1206.44 53.096 2.73928 PNS24243 293 93.9554 0 0 KQK14069 1603 1338.44 1823.47 84.7968 KQK14071 474 232.979 23.0578 6.16003 ==> SRR7473355.se.tsv <== BRADI_1g14170v3 1972 BRADI_1g53295v3 264 BRADI_1g59795v3 844 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 2384 BRADI_1g74790v3 329 BRADI_1g09890v3 2 BRADI_1g77505v3 268 BRADI_1g48960v3 0 SRR7473355 completed mapping pipeline successfully