Starting /dee2/code/volunteer_pipeline.sh SRR7473356 current disk space = 1542876581888 free memory = 1591538808 SRR7473356 SRAfilesize fcc957d313be1df1f67ac2883a841446 SRR7473356.sra SRR7473356.sra file validated SRR7473356 is paired end SRR7473356 is conventional basespace SRR7473356 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.43975 34.0 34.0 34.0 33.0 34.0 2 33.437 34.0 34.0 34.0 33.0 34.0 3 33.48575 34.0 34.0 34.0 33.0 34.0 4 33.53325 34.0 34.0 34.0 33.0 34.0 5 33.52475 34.0 34.0 34.0 33.0 34.0 6 37.10925 38.0 38.0 38.0 36.0 38.0 7 37.44725 38.0 38.0 38.0 37.0 38.0 8 37.52525 38.0 38.0 38.0 38.0 38.0 9 37.5885 38.0 38.0 38.0 38.0 38.0 10-14 37.60565 38.0 38.0 38.0 38.0 38.0 15-19 37.6238 38.0 38.0 38.0 38.0 38.0 20-24 37.617450000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.50555000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.40859999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.34355000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.19595 38.0 38.0 38.0 37.0 38.0 45-49 37.1288 38.0 38.0 38.0 36.6 38.0 50-54 37.26395 38.0 38.0 38.0 37.0 38.0 55-59 37.298500000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.19369999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.072199999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.925799999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.765499999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.68615 38.0 38.0 38.0 35.4 38.0 85-89 36.58239999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.34185 38.0 38.0 38.0 34.6 38.0 95-99 36.095150000000004 38.0 38.0 38.0 34.0 38.0 100-104 35.964600000000004 38.0 38.0 38.0 33.4 38.0 105-109 35.82765 38.0 38.0 38.0 33.0 38.0 110-114 35.653150000000004 38.0 37.6 38.0 32.4 38.0 115-119 35.45095 38.0 36.6 38.0 31.6 38.0 120-124 35.18325 38.0 36.0 38.0 29.8 38.0 125-129 34.7636 38.0 35.6 38.0 28.4 38.0 130-134 34.3232 38.0 35.0 38.0 25.8 38.0 135-139 33.7368 38.0 33.4 38.0 22.6 38.0 140-144 33.143 38.0 33.0 38.0 17.2 38.0 145-149 32.3172 38.0 33.0 38.0 10.8 38.0 150-151 27.229625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 2.0 13 3.0 14 4.0 15 4.0 16 5.0 17 2.0 18 12.0 19 19.0 20 7.0 21 13.0 22 10.0 23 7.0 24 16.0 25 14.0 26 22.0 27 28.0 28 33.0 29 35.0 30 44.0 31 53.0 32 78.0 33 89.0 34 122.0 35 221.0 36 678.0 37 2477.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.73238023576624 12.039127163280662 9.957361424630047 37.27113117632305 2 24.5 15.625 31.874999999999996 28.000000000000004 3 23.0 18.925 23.599999999999998 34.475 4 26.650000000000002 27.375 20.424999999999997 25.55 5 27.825 30.349999999999998 22.900000000000002 18.925 6 22.875 32.475 22.900000000000002 21.75 7 17.65 22.275 38.15 21.925 8 19.75 23.549999999999997 28.599999999999998 28.1 9 21.0 20.9 31.4 26.700000000000003 10-14 22.985 25.96 24.95 26.105 15-19 23.005 25.085 25.53 26.38 20-24 23.380000000000003 25.069999999999997 25.355 26.195 25-29 23.205000000000002 25.259999999999998 24.915000000000003 26.619999999999997 30-34 22.18 25.040000000000003 25.374999999999996 27.405 35-39 23.192319231923193 25.082508250825082 25.437543754375437 26.287628762876285 40-44 23.774264558735243 24.269561737042224 25.020012007204322 26.936161697018214 45-49 24.07601900475119 24.63115778944736 24.91122780695174 26.38159539884971 50-54 23.189999999999998 24.34 25.21 27.26 55-59 23.294999999999998 23.875 25.419999999999998 27.41 60-64 23.425 24.26 25.735000000000003 26.58 65-69 23.865 25.28 23.815 27.04 70-74 24.03 25.46 24.6 25.91 75-79 23.896194809740486 25.83129156457823 23.956197809890494 26.31631581579079 80-84 23.70618530926546 25.006250312515625 24.506225311265563 26.781339066953347 85-89 24.47 24.115000000000002 25.095 26.32 90-94 24.91870528790835 24.198309069988493 24.3383861123618 26.544599529741358 95-99 23.980154355016538 24.24075373358725 24.75192943770673 27.027162473689486 100-104 24.48 25.095 24.8 25.624999999999996 105-109 24.195 24.85 24.15 26.805 110-114 24.435000000000002 25.069999999999997 24.005000000000003 26.490000000000002 115-119 24.22 24.93 23.810000000000002 27.04 120-124 24.43 24.765 24.03 26.775 125-129 24.127031908488863 25.030102347983142 23.98153722657034 26.861328516957656 130-134 24.628706640487337 24.66898253033278 23.82822332980919 26.87408749937069 135-139 24.034442821894356 24.331537338234554 24.351679339342365 27.28234050052873 140-144 25.11176972924097 24.599387150248656 23.710252674938463 26.57859044557191 145-149 24.133071619105138 25.01887362222558 24.117972721324676 26.730082037344605 150-151 25.61588738059326 24.145299145299145 23.40372046254399 26.8350930115636 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 2.5 27 3.0 28 0.5 29 2.5 30 6.0 31 10.0 32 17.0 33 19.5 34 27.5 35 43.0 36 50.0 37 64.0 38 79.5 39 97.5 40 104.5 41 118.0 42 148.5 43 164.0 44 153.5 45 156.0 46 180.0 47 184.5 48 171.5 49 158.0 50 144.0 51 135.5 52 142.5 53 138.0 54 129.0 55 128.5 56 117.0 57 106.5 58 105.0 59 107.0 60 102.0 61 89.5 62 81.0 63 64.0 64 58.0 65 60.5 66 59.5 67 56.5 68 44.0 69 35.5 70 29.0 71 20.5 72 19.0 73 21.0 74 21.5 75 10.0 76 2.5 77 3.5 78 2.5 79 1.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.06 45-49 0.025 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.0 90-94 0.055 95-99 0.22999999999999998 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.33999999999999997 130-134 0.685 135-139 0.705 140-144 0.46499999999999997 145-149 0.655 150-151 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.2055366936537 93.05 2 2.1415513188822146 4.1000000000000005 3 0.3917471924784539 1.125 4 0.15669887699138157 0.6 5 0.026116479498563595 0.125 6 0.05223295899712719 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026116479498563595 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTTAGATCTCGTATGC 28 0.7000000000000001 TruSeq Adapter, Index 8 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTTAGATCTCGTATGCC 6 0.15 TruSeq Adapter, Index 8 (97% over 36bp) CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 6 0.15 No Hit GGCATTTGTTGCTTCAGCACCGTAGTGCCTCGTCATCACGCCTCAGCCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.7625 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.3499999999999996 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.362500000000001 0.0 0.0 0.0 0.0 116-117 4.8125 0.0 0.0 0.0 0.0 118-119 5.2 0.0 0.0 0.0 0.0 120-121 5.550000000000001 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.6375 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.725 0.0 0.0 0.0 0.0 134-135 9.4625 0.0 0.0 0.0 0.0 136-137 10.3 0.0 0.0 0.0 0.0 138-139 10.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473356 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473356_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27475 33.0 33.0 34.0 32.0 34.0 2 32.50775 34.0 33.0 34.0 32.0 34.0 3 32.5355 34.0 33.0 34.0 32.0 34.0 4 32.522 34.0 33.0 34.0 32.0 34.0 5 32.59825 34.0 33.0 34.0 32.0 34.0 6 36.41925 38.0 38.0 38.0 36.0 38.0 7 36.51725 38.0 38.0 38.0 36.0 38.0 8 36.6405 38.0 38.0 38.0 36.0 38.0 9 36.7605 38.0 38.0 38.0 36.0 38.0 10-14 36.65875 38.0 38.0 38.0 36.0 38.0 15-19 36.49945 38.0 38.0 38.0 36.0 38.0 20-24 36.2977 38.0 38.0 38.0 35.8 38.0 25-29 36.32765 38.0 38.0 38.0 35.8 38.0 30-34 36.4152 38.0 38.0 38.0 36.0 38.0 35-39 36.3744 38.0 38.0 38.0 36.0 38.0 40-44 36.433350000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.29575 38.0 38.0 38.0 35.8 38.0 50-54 36.3846 38.0 38.0 38.0 36.0 38.0 55-59 36.3438 38.0 38.0 38.0 36.0 38.0 60-64 36.23335 38.0 38.0 38.0 35.4 38.0 65-69 35.88045000000001 38.0 38.0 38.0 34.4 38.0 70-74 35.8981 38.0 38.0 38.0 34.4 38.0 75-79 35.8882 38.0 38.0 38.0 34.6 38.0 80-84 35.7841 38.0 38.0 38.0 34.0 38.0 85-89 35.70945 38.0 38.0 38.0 34.0 38.0 90-94 35.5475 38.0 38.0 38.0 33.4 38.0 95-99 35.2265 38.0 38.0 38.0 32.4 38.0 100-104 34.60625 38.0 37.8 38.0 27.4 38.0 105-109 34.4196 38.0 37.4 38.0 25.2 38.0 110-114 34.1819 38.0 36.6 38.0 23.4 38.0 115-119 33.9303 38.0 35.8 38.0 21.0 38.0 120-124 33.7755 38.0 35.4 38.0 21.0 38.0 125-129 33.37515 38.0 34.4 38.0 15.8 38.0 130-134 33.00915 38.0 33.2 38.0 13.0 38.0 135-139 32.474900000000005 38.0 33.0 38.0 12.2 38.0 140-144 31.67025 38.0 32.6 38.0 5.6 38.0 145-149 30.2451 38.0 30.0 38.0 2.0 38.0 150-151 24.461750000000002 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 25.0 4 8.0 5 8.0 6 4.0 7 4.0 8 1.0 9 2.0 10 4.0 11 3.0 12 4.0 13 5.0 14 5.0 15 9.0 16 7.0 17 26.0 18 13.0 19 17.0 20 7.0 21 16.0 22 17.0 23 14.0 24 34.0 25 28.0 26 21.0 27 23.0 28 22.0 29 41.0 30 55.0 31 60.0 32 76.0 33 97.0 34 144.0 35 245.0 36 621.0 37 2296.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.12433527475311 16.409217523423653 12.4588503418587 30.007596859964547 2 30.27081751455328 21.235130346747656 25.740318906605925 22.75373323209314 3 24.974696356275302 23.279352226720647 27.454453441295545 24.291497975708502 4 26.914329037149354 29.441496082891078 19.989891331817034 23.654283548142534 5 30.469934310257706 31.35421930267812 18.847902981303687 19.327943405760482 6 24.4861710225831 33.44328850545547 19.58893681806648 22.48160365389495 7 22.556962025316455 19.417721518987342 33.51898734177215 24.50632911392405 8 25.901639344262296 22.44640605296343 21.84110970996217 29.810844892812106 9 24.59718026183283 21.576032225579052 25.42799597180262 28.3987915407855 10-14 26.732424135675103 25.167329273816115 22.03210709073524 26.06813949977354 15-19 26.929309297144016 24.129025724123963 23.364391330767674 25.57727364796435 20-24 27.550086443608258 24.656768026034783 23.06010373232991 24.733041798027052 25-29 26.812807631805956 24.493834678033185 23.225249911199068 25.46810777896179 30-34 26.440746753246753 25.2739448051948 23.031655844155843 25.2536525974026 35-39 27.111065948582464 24.25566507468753 23.58500152423534 25.048267452494667 40-44 28.36919017657804 24.0004059265273 23.051552668966917 24.578851227927746 45-49 27.153767820773933 24.86252545824847 23.029531568228105 24.954175152749492 50-54 27.256116130342097 24.286874428991982 23.819916759719824 24.637092680946097 55-59 26.927759740259738 24.360795454545457 23.828125 24.883319805194805 60-64 26.631097560975608 25.16260162601626 23.191056910569106 25.01524390243902 65-69 27.17969709373721 25.455382726156365 22.74355300859599 24.62136717151044 70-74 27.106171335769385 24.88834754364596 23.21863580998782 24.786845310596835 75-79 26.89868601288621 24.52945056060068 23.738014306732282 24.833849119780833 80-84 27.23028519232721 24.698061504110424 23.601948645082715 24.469704658479653 85-89 27.342246530942976 24.511293426516765 23.77190317026233 24.37455687227793 90-94 27.212748680470973 24.766544863987008 23.599269183922047 24.421437271619975 95-99 27.514687100893997 24.991060025542783 23.157088122605362 24.337164750957854 100-104 27.278379358582455 25.39246671156935 23.320035231335165 24.009118698513028 105-109 26.923275906668735 25.138393088105953 23.798437580837085 24.139893424388227 110-114 28.121118012422357 25.207039337474118 23.38509316770186 23.286749482401657 115-119 27.79954629820582 25.12373685295937 23.10785729016292 23.96885955867189 120-124 27.46624059375322 25.389135140707143 23.502731677146684 23.64189258839295 125-129 27.612171222279525 25.98762248581743 23.120165033522433 23.28004125838061 130-134 27.972966001135013 25.50172831862973 23.59799824588557 22.92730743434969 135-139 28.193290243151736 25.674566533292293 23.181491741048525 22.95065148250744 140-144 28.4448768498131 25.905064263403144 23.196272210558657 22.4537866762251 145-149 28.201290322580647 26.08 22.766451612903225 22.95225806451613 150-151 28.731004026496947 26.328094557734772 23.10689699961034 21.834004416157942 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 16.0 1 11.0 2 6.0 3 6.0 4 6.0 5 3.0 6 0.0 7 3.0 8 4.0 9 1.5 10 0.5 11 0.5 12 0.5 13 0.5 14 1.5 15 1.0 16 0.0 17 1.0 18 1.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 2.0 25 1.5 26 3.0 27 3.5 28 3.5 29 3.5 30 4.5 31 7.0 32 11.5 33 13.0 34 16.0 35 21.5 36 27.5 37 37.0 38 47.0 39 63.0 40 78.5 41 106.5 42 128.5 43 128.5 44 128.0 45 137.5 46 147.5 47 158.0 48 164.0 49 167.0 50 164.5 51 156.0 52 154.5 53 141.5 54 137.5 55 135.0 56 116.5 57 115.5 58 122.0 59 115.0 60 108.0 61 104.0 62 106.0 63 96.5 64 79.5 65 75.0 66 69.5 67 60.5 68 55.5 69 52.5 70 42.5 71 32.0 72 29.5 73 23.5 74 15.5 75 10.0 76 5.5 77 2.0 78 0.5 79 1.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 1.225 3 1.2 4 1.075 5 1.05 6 1.4749999999999999 7 1.25 8 0.8750000000000001 9 0.7000000000000001 10-14 0.645 15-19 1.26 20-24 1.67 25-29 1.465 30-34 1.44 35-39 1.59 40-44 1.46 45-49 1.7999999999999998 50-54 1.49 55-59 1.44 60-64 1.6 65-69 2.2800000000000002 70-74 1.48 75-79 1.4449999999999998 80-84 1.47 85-89 1.27 90-94 1.48 95-99 2.125 100-104 3.495 105-109 3.3550000000000004 110-114 3.4000000000000004 115-119 3.02 120-124 2.9899999999999998 125-129 3.05 130-134 3.085 135-139 2.53 140-144 2.355 145-149 3.125 150-151 3.7624999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.175 #Duplication Level Percentage of deduplicated Percentage of total 1 97.5305432804783 93.8 2 1.9755653756173643 3.8 3 0.25994281258123214 0.75 4 0.10397712503249285 0.4 5 0.02599428125812321 0.125 6 0.05198856251624642 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05198856251624642 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 22 0.5499999999999999 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit GTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAA 6 0.15 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.7125 0.0 0.0 0.0 0.0 108-109 2.9000000000000004 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.725 0.0 0.0 0.0 0.0 114-115 4.237500000000001 0.0 0.0 0.0 0.0 116-117 4.6625 0.0 0.0 0.0 0.0 118-119 5.0375 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 5.9125 0.0 0.0 0.0 0.0 124-125 6.4125 0.0 0.0 0.0 0.0 126-127 6.925000000000001 0.0 0.0 0.0 0.0 128-129 7.4125 0.0 0.0 0.0 0.0 130-131 7.9375 0.0 0.0 0.0 0.0 132-133 8.3625 0.0 0.0 0.0 0.0 134-135 9.024999999999999 0.0 0.0 0.0 0.0 136-137 9.837499999999999 0.0 0.0 0.0 0.0 138-139 10.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCGA 10 0.007096334 143.1625 4 AACCGAG 10 0.007096334 143.1625 5 ACCGAGT 10 0.007096334 143.1625 6 CCGAGTC 10 0.007096334 143.1625 7 CGAGTCT 10 0.007096334 143.1625 8 TTGAATG 10 0.007096334 143.1625 7 AAAGAAA 30 0.001890654 71.58125 4 >>END_MODULE Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718669 spots for SRR7473356.sra Written 718669 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra Read 718664 spots for SRR7473356.sra Written 718664 spots for SRR7473356.sra SRR ids: ['SRR7473356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jxt8th72 SRR7473356.sra spots: 14373285 blocks: [[1, 718664], [718665, 1437328], [1437329, 2155992], [2155993, 2874656], [2874657, 3593320], [3593321, 4311984], [4311985, 5030648], [5030649, 5749312], [5749313, 6467976], [6467977, 7186640], [7186641, 7905304], [7905305, 8623968], [8623969, 9342632], [9342633, 10061296], [10061297, 10779960], [10779961, 11498624], [11498625, 12217288], [12217289, 12935952], [12935953, 13654616], [13654617, 14373285]] SRR7473356 file size 4848934 SRR7473356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473356 SRR7473356_1.fastq SRR7473356_2.fastq Input file: SRR7473356_1.fastq Paired file: SRR7473356_2.fastq trimmed: SRR7473356-trimmed-pair1.fastq, SRR7473356-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:42:41 2024 >> started Sat Dec 7 14:42:57 2024 >> done (16.865s) 14373285 read pairs processed; of these: 34371 ( 0.24%) short read pairs filtered out after trimming by size control 153970 ( 1.07%) empty read pairs filtered out after trimming by size control 14184944 (98.69%) read pairs available; of these: 8463786 (59.67%) trimmed read pairs available after processing 5721158 (40.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 18 0.00% 20 16 0.00% 21 29 0.00% 22 23 0.00% 23 28 0.00% 24 33 0.00% 25 26 0.00% 26 32 0.00% 27 34 0.00% 28 43 0.00% 29 36 0.00% 30 46 0.00% 31 71 0.00% 32 44 0.00% 33 52 0.00% 34 73 0.00% 35 77 0.00% 36 84 0.00% 37 77 0.00% 38 88 0.00% 39 128 0.00% 40 149 0.00% 41 151 0.00% 42 151 0.00% 43 186 0.00% 44 236 0.00% 45 301 0.00% 46 277 0.00% 47 342 0.00% 48 314 0.00% 49 377 0.00% 50 476 0.00% 51 539 0.00% 52 569 0.00% 53 504 0.00% 54 522 0.00% 55 618 0.00% 56 642 0.00% 57 701 0.00% 58 845 0.01% 59 828 0.01% 60 867 0.01% 61 1083 0.01% 62 1163 0.01% 63 1370 0.01% 64 1601 0.01% 65 2313 0.02% 66 2710 0.02% 67 4419 0.03% 68 6847 0.05% 69 12002 0.08% 70 14839 0.10% 71 8469 0.06% 72 5548 0.04% 73 4865 0.03% 74 4425 0.03% 75 4483 0.03% 76 4470 0.03% 77 4689 0.03% 78 5164 0.04% 79 5754 0.04% 80 6203 0.04% 81 6784 0.05% 82 7347 0.05% 83 8579 0.06% 84 10270 0.07% 85 11047 0.08% 86 11930 0.08% 87 12395 0.09% 88 13864 0.10% 89 14263 0.10% 90 14886 0.10% 91 15955 0.11% 92 16173 0.11% 93 18038 0.13% 94 19178 0.14% 95 20727 0.15% 96 21587 0.15% 97 21824 0.15% 98 22545 0.16% 99 23517 0.17% 100 24854 0.18% 101 25029 0.18% 102 25771 0.18% 103 27024 0.19% 104 28521 0.20% 105 30967 0.22% 106 30951 0.22% 107 31393 0.22% 108 32617 0.23% 109 35936 0.25% 110 36585 0.26% 111 35144 0.25% 112 36163 0.25% 113 39238 0.28% 114 38246 0.27% 115 40689 0.29% 116 42372 0.30% 117 42256 0.30% 118 42927 0.30% 119 43501 0.31% 120 45666 0.32% 121 46034 0.32% 122 47412 0.33% 123 48434 0.34% 124 51530 0.36% 125 51582 0.36% 126 52627 0.37% 127 54984 0.39% 128 56247 0.40% 129 57514 0.41% 130 59789 0.42% 131 60583 0.43% 132 63485 0.45% 133 66690 0.47% 134 69569 0.49% 135 72961 0.51% 136 75763 0.53% 137 80712 0.57% 138 84779 0.60% 139 89788 0.63% 140 95668 0.67% 141 104616 0.74% 142 113181 0.80% 143 124532 0.88% 144 141141 1.00% 145 167478 1.18% 146 205499 1.45% 147 278012 1.96% 148 422260 2.98% 149 820712 5.79% 150 3660360 25.80% 151 5721158 40.33% 14184944 reads passed initial QC criterion=sequence-density sequence-density=1.31 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=14 prefix-density=1.36 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=24 fanout-score=12.98 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=4.3 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=9 prefix-density=1.12 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=33.31 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.4 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7473356 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:43:43 Started mapping on | Dec 07 14:43:43 Finished on | Dec 07 14:48:26 Mapping speed, Million of reads per hour | 180.44 Number of input reads | 14184944 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12683769 Uniquely mapped reads % | 89.42% Average mapped length | 290.33 Number of splices: Total | 13035237 Number of splices: Annotated (sjdb) | 12342458 Number of splices: GT/AG | 12869796 Number of splices: GC/AG | 147954 Number of splices: AT/AC | 5481 Number of splices: Non-canonical | 12006 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 119673 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 13550 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.79% % of reads unmapped: other | 0.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1392649 1392649 1392649 N_multimapping 119673 119673 119673 N_noFeature 334738 12278712 451981 N_ambiguous 334603 1410 47391 UnstrandedReadsAssigned:12014428 PositiveStrandReadsAssigned:403647 NegativeStrandReadsAssigned:12184397 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7473356 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473356-trimmed-pair1.fastq SRR7473356-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,184,944 reads, 12,238,653 reads pseudoaligned [quant] estimated average fragment length: 243.015 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52973 SRR7473356.ke.tsv 35125 SRR7473356.se.tsv 88098 total ==> SRR7473356.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.284 0 0 PNS24247 1044 801.985 15.9576 1.97287 PNS24249 1928 1685.98 32.8294 1.93066 PNS24246 1044 801.985 15.9576 1.97287 PNS24248 1044 801.985 15.9576 1.97287 PNS24244 1471 1228.98 46.2978 3.73517 PNS24243 293 100.738 0 0 KQK14069 1603 1360.98 409.039 29.7994 KQK14071 474 246.75 8.55915 3.4393 ==> SRR7473356.se.tsv <== BRADI_1g14170v3 459 BRADI_1g53295v3 35 BRADI_1g59795v3 284 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1094 BRADI_1g74790v3 82 BRADI_1g09890v3 8 BRADI_1g77505v3 271 BRADI_1g48960v3 0 SRR7473356 completed mapping pipeline successfully