Starting /dee2/code/volunteer_pipeline.sh SRR7473357 current disk space = 1542818627584 free memory = 1596742036 SRR7473357 SRAfilesize b9f4d17e018f75f26544eb7e41743950 SRR7473357.sra SRR7473357.sra file validated SRR7473357 is paired end SRR7473357 is conventional basespace SRR7473357 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.31425 34.0 33.0 34.0 33.0 34.0 2 33.30275 34.0 33.0 34.0 33.0 34.0 3 33.479 34.0 34.0 34.0 33.0 34.0 4 33.37925 34.0 33.0 34.0 33.0 34.0 5 33.246 34.0 33.0 34.0 33.0 34.0 6 36.7845 38.0 37.0 38.0 35.0 38.0 7 37.10975 38.0 38.0 38.0 36.0 38.0 8 37.28275 38.0 38.0 38.0 37.0 38.0 9 37.388 38.0 38.0 38.0 37.0 38.0 10-14 37.3943 38.0 38.0 38.0 37.0 38.0 15-19 37.3969 38.0 38.0 38.0 37.2 38.0 20-24 37.45335000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.301 38.0 38.0 38.0 37.0 38.0 30-34 37.1198 38.0 38.0 38.0 36.4 38.0 35-39 37.008300000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.198 38.0 37.6 38.0 32.2 38.0 45-49 36.687050000000006 38.0 38.0 38.0 34.8 38.0 50-54 36.519349999999996 38.0 38.0 38.0 34.0 38.0 55-59 36.6663 38.0 38.0 38.0 34.8 38.0 60-64 36.43105 38.0 38.0 38.0 34.0 38.0 65-69 36.130700000000004 38.0 38.0 38.0 33.0 38.0 70-74 35.030150000000006 38.0 37.0 38.0 26.4 38.0 75-79 31.817149999999998 38.0 35.0 38.0 2.0 38.0 80-84 31.764549999999996 38.0 35.0 38.0 2.0 38.0 85-89 31.64945 38.0 34.8 38.0 2.0 38.0 90-94 31.36515 38.0 34.0 38.0 2.0 38.0 95-99 31.0905 38.0 33.6 38.0 2.0 38.0 100-104 31.0186 38.0 33.6 38.0 2.0 38.0 105-109 30.83805 38.0 33.0 38.0 2.0 38.0 110-114 30.3608 38.0 31.8 38.0 2.0 38.0 115-119 30.127700000000004 38.0 30.6 38.0 2.0 38.0 120-124 29.85165 38.0 29.6 38.0 2.0 38.0 125-129 29.4467 38.0 27.6 38.0 2.0 38.0 130-134 28.8812 37.4 24.6 38.0 2.0 38.0 135-139 28.474149999999998 36.0 22.6 38.0 2.0 38.0 140-144 27.918650000000003 36.0 18.4 38.0 2.0 38.0 145-149 27.27285 35.8 11.6 38.0 2.0 38.0 150-151 23.303874999999998 31.5 2.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 1.0 9 2.0 10 2.0 11 2.0 12 6.0 13 10.0 14 10.0 15 21.0 16 50.0 17 85.0 18 161.0 19 211.0 20 13.0 21 24.0 22 29.0 23 26.0 24 18.0 25 13.0 26 28.0 27 30.0 28 36.0 29 28.0 30 53.0 31 73.0 32 76.0 33 94.0 34 167.0 35 300.0 36 742.0 37 1686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.564019042846404 9.320972187421699 14.031571034828364 37.083437734903534 2 20.87719298245614 26.466165413533833 28.195488721804512 24.461152882205514 3 21.099999999999998 18.025 31.724999999999998 29.15 4 24.15 22.425 17.525 35.9 5 35.8826479438315 26.053159478435305 18.806419257773317 19.257773319959878 6 32.525 27.85 20.424999999999997 19.2 7 15.85 31.125000000000004 35.15 17.875 8 18.25 32.65 25.275 23.825 9 31.724999999999998 18.7 27.6 21.975 10-14 22.53 27.785 21.11 28.575 15-19 22.625 24.104999999999997 25.3 27.97 20-24 22.935 27.58 24.11 25.374999999999996 25-29 22.025 24.465 25.06 28.449999999999996 30-34 19.965 26.479999999999997 25.05 28.505000000000003 35-39 19.865 21.095 30.830000000000002 28.21 40-44 19.612941941291194 24.07361104165625 28.309246386958044 28.004200630094516 45-49 26.025 23.73 27.355 22.89 50-54 22.855 21.185000000000002 24.47 31.490000000000002 55-59 22.54 20.86 30.085 26.515 60-64 22.845 23.695 27.750000000000004 25.71 65-69 19.415 36.254999999999995 21.705 22.625 70-74 20.185 35.154999999999994 21.52 23.14 75-79 20.255000000000003 31.385 22.925 25.435000000000002 80-84 20.73 27.46 25.869999999999997 25.94 85-89 21.990000000000002 25.36 25.740000000000002 26.91 90-94 21.874374874974993 23.929785957191438 26.760352070414083 27.435487097419486 95-99 22.664931424567023 23.801181299429373 27.009710681749926 26.524176594253678 100-104 21.310000000000002 29.970000000000002 24.279999999999998 24.44 105-109 21.055 33.135 22.405 23.405 110-114 21.43 32.61 22.06 23.9 115-119 21.7 30.945 22.89 24.465 120-124 21.375 30.665 22.915 25.045 125-129 22.11259140538916 29.705499348893117 22.938996293699287 25.242912952018433 130-134 21.33400707427994 29.828196058615465 23.51187468418393 25.325922182920667 135-139 21.883195481137786 28.898527335081702 23.345773653419407 25.872503530361108 140-144 22.231123573002204 28.80532745844182 23.03224514320048 25.931303825355496 145-149 22.228373005887978 28.26229178199386 23.85888983946455 25.650445372653618 150-151 21.57702481420834 29.34878448167276 23.793928706386193 25.280261997732712 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 1.5 27 0.5 28 2.0 29 4.0 30 4.0 31 8.0 32 11.0 33 14.0 34 20.5 35 34.5 36 53.0 37 72.5 38 104.5 39 135.5 40 162.0 41 174.5 42 185.5 43 206.0 44 207.0 45 196.5 46 189.5 47 177.5 48 159.5 49 163.0 50 170.0 51 148.5 52 125.0 53 115.5 54 121.5 55 122.0 56 101.5 57 86.0 58 78.5 59 74.0 60 76.0 61 71.0 62 58.0 63 49.5 64 43.0 65 27.0 66 22.5 67 35.0 68 34.0 69 27.0 70 26.0 71 23.5 72 21.5 73 16.5 74 12.0 75 10.5 76 6.5 77 3.0 78 2.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.25 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.02 95-99 0.11 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.16999999999999998 130-134 1.05 135-139 0.86 140-144 0.13999999999999999 145-149 0.645 150-151 0.7625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.3751846381093 83.25 2 1.2703101920236337 2.15 3 0.11816838995568685 0.3 4 0.08862629246676515 0.3 5 0.0 0.0 6 0.029542097488921712 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.08862629246676515 1.55 >50 0.0 0.0 >100 0.029542097488921712 12.3 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATGC 492 12.3 TruSeq Adapter, Index 27 (98% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATG 34 0.8500000000000001 TruSeq Adapter, Index 27 (97% over 49bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATATCGTATGC 16 0.4 TruSeq Adapter, Index 27 (97% over 41bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATGCC 12 0.3 TruSeq Adapter, Index 27 (98% over 50bp) TCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATGCCG 6 0.15 TruSeq Adapter, Index 27 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.9 0.0 0.0 0.0 0.0 2 0.925 0.0 0.0 0.0 0.0 3 0.925 0.0 0.0 0.0 0.0 4 0.925 0.0 0.0 0.0 0.0 5 0.925 0.0 0.0 0.0 0.0 6 0.925 0.0 0.0 0.0 0.0 7 0.925 0.0 0.0 0.0 0.0 8 0.925 0.0 0.0 0.0 0.0 9 0.925 0.0 0.0 0.0 0.0 10-11 0.925 0.0 0.0 0.0 0.0 12-13 0.925 0.0 0.0 0.0 0.0 14-15 0.925 0.0 0.0 0.0 0.0 16-17 0.925 0.0 0.0 0.0 0.0 18-19 0.925 0.0 0.0 0.0 0.0 20-21 0.925 0.0 0.0 0.0 0.0 22-23 0.925 0.0 0.0 0.0 0.0 24-25 0.925 0.0 0.0 0.0 0.0 26-27 0.925 0.0 0.0 0.0 0.0 28-29 0.925 0.0 0.0 0.0 0.0 30-31 0.925 0.0 0.0 0.0 0.0 32-33 0.925 0.0 0.0 0.0 0.0 34-35 0.925 0.0 0.0 0.0 0.0 36-37 0.925 0.0 0.0 0.0 0.0 38-39 0.925 0.0 0.0 0.0 0.0 40-41 0.925 0.0 0.0 0.0 0.0 42-43 0.95 0.0 0.0 0.0 0.0 44-45 0.975 0.0 0.0 0.0 0.0 46-47 1.0 0.0 0.0 0.0 0.0 48-49 1.0 0.0 0.0 0.0 0.0 50-51 1.0 0.0 0.0 0.0 0.0 52-53 1.0 0.0 0.0 0.0 0.0 54-55 1.025 0.0 0.0 0.0 0.0 56-57 1.025 0.0 0.0 0.0 0.0 58-59 1.025 0.0 0.0 0.0 0.0 60-61 1.05 0.0 0.0 0.0 0.0 62-63 1.0625 0.0 0.0 0.0 0.0 64-65 1.0875 0.0 0.0 0.0 0.0 66-67 1.1125 0.0 0.0 0.0 0.0 68-69 1.125 0.0 0.0 0.0 0.0 70-71 1.125 0.0 0.0 0.0 0.0 72-73 1.1625 0.0 0.0 0.0 0.0 74-75 1.175 0.0 0.0 0.0 0.0 76-77 1.2 0.0 0.0 0.0 0.0 78-79 1.2125 0.0 0.0 0.0 0.0 80-81 1.225 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.2875 0.0 0.0 0.0 0.0 86-87 1.4125 0.0 0.0 0.0 0.0 88-89 1.575 0.0 0.0 0.0 0.0 90-91 1.7000000000000002 0.0 0.0 0.0 0.0 92-93 1.8 0.0 0.0 0.0 0.0 94-95 1.975 0.0 0.0 0.0 0.0 96-97 2.125 0.0 0.0 0.0 0.0 98-99 2.3499999999999996 0.0 0.0 0.0 0.0 100-101 2.5375 0.0 0.0 0.0 0.0 102-103 2.7125 0.0 0.0 0.0 0.0 104-105 2.8875 0.0 0.0 0.0 0.0 106-107 3.1 0.0 0.0 0.0 0.0 108-109 3.325 0.0 0.0 0.0 0.0 110-111 3.625 0.0 0.0 0.0 0.0 112-113 3.8875 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.55 0.0 0.0 0.0 0.0 118-119 4.85 0.0 0.0 0.0 0.0 120-121 5.425000000000001 0.0 0.0 0.0 0.0 122-123 5.825 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.425000000000001 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.4 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.162500000000001 0.0 0.0 0.0 0.0 136-137 8.725 0.0 0.0 0.0 0.0 138-139 9.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 105 0.0 96.21667 9 AGAGCAC 105 0.0 96.21667 8 AAGAGCA 110 0.0 91.84318 7 TCGGAAG 115 0.0 87.85 3 ATCGGAA 115 0.0 87.85 2 GGAAGAG 115 0.0 87.85 5 GATCGGA 120 0.0 84.18958 1 GAAGAGC 120 0.0 84.18958 6 CGGAAGA 120 0.0 84.18958 4 TATGCCG 70 0.0 28.865 45-49 TTCTGCT 70 0.0 28.865 55-59 CCGTCTT 70 0.0 28.865 50-54 GCCGTCT 70 0.0 28.865 45-49 CTTGAAA 70 0.0 28.865 60-64 CGTCTTC 70 0.0 28.865 50-54 CCTATCT 75 0.0 26.940668 35-39 TCCTATC 75 0.0 26.940668 35-39 TGCCGTC 75 0.0 26.940668 45-49 TCTGCTT 75 0.0 26.940668 55-59 TTCCTAT 75 0.0 26.940668 35-39 >>END_MODULE SRR7473357 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473357_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.86875 33.0 33.0 34.0 31.0 34.0 2 32.04575 33.0 33.0 34.0 32.0 34.0 3 31.7835 33.0 33.0 34.0 31.0 34.0 4 31.91075 33.0 33.0 34.0 31.0 34.0 5 31.833 33.0 33.0 34.0 31.0 34.0 6 36.0185 38.0 38.0 38.0 34.0 38.0 7 36.09325 38.0 38.0 38.0 34.0 38.0 8 36.37725 38.0 38.0 38.0 34.0 38.0 9 36.4 38.0 38.0 38.0 34.0 38.0 10-14 36.4482 38.0 38.0 38.0 35.6 38.0 15-19 36.0569 38.0 38.0 38.0 34.6 38.0 20-24 35.857299999999995 38.0 38.0 38.0 34.2 38.0 25-29 35.8974 38.0 38.0 38.0 34.0 38.0 30-34 35.6555 38.0 38.0 38.0 32.8 38.0 35-39 35.59185 38.0 38.0 38.0 32.8 38.0 40-44 35.643950000000004 38.0 38.0 38.0 33.2 38.0 45-49 35.12465 38.0 37.8 38.0 28.8 38.0 50-54 35.18945 38.0 37.6 38.0 29.0 38.0 55-59 35.4274 38.0 38.0 38.0 31.0 38.0 60-64 35.61895 38.0 38.0 38.0 33.6 38.0 65-69 33.68825 38.0 36.8 38.0 19.6 38.0 70-74 31.187900000000003 38.0 35.6 38.0 2.0 38.0 75-79 31.100599999999996 38.0 35.8 38.0 2.0 38.0 80-84 30.919999999999998 38.0 35.0 38.0 2.0 38.0 85-89 30.8461 38.0 35.0 38.0 2.0 38.0 90-94 30.68625 38.0 34.2 38.0 2.0 38.0 95-99 30.328650000000003 38.0 33.4 38.0 2.0 38.0 100-104 29.54205 38.0 29.0 38.0 2.0 38.0 105-109 29.473749999999995 38.0 28.8 38.0 2.0 38.0 110-114 29.29895 38.0 27.6 38.0 2.0 38.0 115-119 29.073950000000004 38.0 25.2 38.0 2.0 38.0 120-124 29.0229 38.0 25.6 38.0 2.0 38.0 125-129 28.741000000000003 38.0 23.0 38.0 2.0 38.0 130-134 28.161 38.0 17.2 38.0 2.0 38.0 135-139 27.966649999999998 38.0 13.8 38.0 2.0 38.0 140-144 27.345999999999997 36.6 13.0 38.0 2.0 38.0 145-149 26.4349 36.0 4.2 38.0 2.0 38.0 150-151 22.19675 29.5 2.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 50.0 3 46.0 4 17.0 5 6.0 6 4.0 7 7.0 8 2.0 9 4.0 10 8.0 11 6.0 12 10.0 13 16.0 14 22.0 15 44.0 16 92.0 17 355.0 18 29.0 19 21.0 20 9.0 21 12.0 22 18.0 23 25.0 24 24.0 25 36.0 26 13.0 27 30.0 28 25.0 29 36.0 30 39.0 31 46.0 32 75.0 33 83.0 34 108.0 35 203.0 36 504.0 37 1975.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.33205814843153 12.853863810252486 17.266003570517725 31.548074470798266 2 25.459183673469386 30.816326530612244 24.209183673469386 19.51530612244898 3 22.470467385721623 21.289162814586543 35.15665125834617 21.08371854134566 4 24.375955170657157 24.45236882322975 18.543046357615893 32.628629648497196 5 39.23076923076923 25.538461538461537 17.974358974358974 17.256410256410255 6 35.23104416645392 27.521062037273424 17.487873372478937 19.76002042379372 7 20.0 27.29351969504447 31.054637865311307 21.651842439644216 8 22.121441169060216 33.05618543713782 20.71050642479214 24.111866969009828 9 35.59789420907495 20.381047881674604 22.286287290047632 21.73477061920281 10-14 28.71386342001102 24.810862267648677 21.62934014730197 24.845934165038326 15-19 28.685077273878896 21.418799087914874 25.832277679250065 24.063845958956172 20-24 31.378642755247604 27.07866313429794 20.959853270837577 20.58284083961687 25-29 28.28041656083312 30.30226060452121 20.81280162560325 20.604521209042417 30-34 28.784333672431334 24.8118006103764 25.829094608341812 20.574771108850456 35-39 23.40794371080406 25.233263651659616 25.233263651659616 26.125528985876716 40-44 34.42148550540691 21.480428491648475 22.87658018987663 21.22150581306798 45-49 26.60231857412798 21.735355701955978 23.43598386190695 28.22634186200909 50-54 25.918968318440292 25.050771730300568 25.365556458164097 23.664703493095043 55-59 22.857432981316002 30.20410235580829 25.929122664500404 21.009341998375305 60-64 23.07731434384537 36.14954221770091 20.386571719226858 20.386571719226858 65-69 23.65204888569375 35.81185169970217 20.2372393961179 20.298860018486188 70-74 23.9813264322322 33.47541482721875 21.352818795351904 21.190439945197138 75-79 25.076235007115265 32.11018499695059 21.43728400081317 21.37629599512096 80-84 26.160529373137344 30.36318634136485 21.998282568065868 21.478001717431937 85-89 26.661631419939575 30.11077542799597 22.134944612286002 21.09264853977845 90-94 26.296109146033352 28.938858009095505 22.425467407781706 22.33956543708944 95-99 26.08383724505483 28.87157937890745 22.932253766526596 22.112329609511118 100-104 26.33993743482795 29.03545359749739 22.768508863399376 21.856100104275285 105-109 26.746060637578655 29.127879764938374 22.00842477507931 22.117634822403662 110-114 25.856860089592665 30.440670903219086 22.08563392020002 21.616835086988228 115-119 26.70701427684668 29.024415476929445 22.82226360438651 21.446306641837367 120-124 26.49130074565037 30.05903065451533 22.06400165700083 21.385666942833474 125-129 26.72851663729657 29.44956981445009 21.934280087073702 21.887633461179643 130-134 26.372370812775902 29.171643728901586 22.59672812256557 21.859257335756947 135-139 27.0023587324377 29.125217926366524 22.23361706491642 21.638806276279357 140-144 27.477708311981143 29.112432100030748 21.840729732499746 21.569129855488367 145-149 27.668946932006634 28.55514096185738 22.61608623548922 21.159825870646767 150-151 28.14795383001049 29.4202518363064 22.04879328436516 20.383001049317944 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 2.0 2 4.5 3 5.5 4 3.5 5 2.5 6 3.0 7 2.5 8 1.5 9 2.5 10 5.0 11 4.5 12 2.5 13 3.5 14 5.0 15 4.0 16 2.5 17 2.5 18 2.5 19 2.0 20 2.0 21 2.5 22 2.5 23 1.5 24 1.5 25 3.0 26 3.5 27 1.5 28 3.0 29 6.0 30 8.0 31 14.0 32 22.5 33 39.0 34 49.0 35 52.5 36 74.5 37 88.0 38 97.0 39 113.5 40 126.5 41 143.5 42 153.5 43 161.5 44 166.5 45 171.5 46 170.5 47 162.5 48 150.0 49 143.0 50 146.5 51 132.0 52 126.5 53 124.5 54 113.0 55 114.5 56 107.5 57 88.5 58 78.0 59 77.5 60 78.0 61 70.5 62 74.5 63 69.0 64 55.5 65 54.0 66 47.5 67 35.0 68 33.5 69 37.5 70 32.0 71 27.5 72 21.5 73 14.5 74 11.0 75 11.0 76 8.0 77 5.0 78 4.5 79 2.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 2.0 3 2.65 4 1.8499999999999999 5 2.5 6 2.075 7 1.625 8 0.775 9 0.27499999999999997 10-14 0.20500000000000002 15-19 1.325 20-24 1.8599999999999999 25-29 1.575 30-34 1.7000000000000002 35-39 1.9349999999999998 40-44 1.5150000000000001 45-49 2.095 50-54 1.52 55-59 1.52 60-64 1.7000000000000002 65-69 2.63 70-74 1.465 75-79 1.6199999999999999 80-84 1.015 85-89 0.7000000000000001 90-94 1.05 95-99 2.4299999999999997 100-104 4.1000000000000005 105-109 3.855 110-114 4.01 115-119 3.34 120-124 3.44 125-129 3.53 130-134 3.7249999999999996 135-139 2.4899999999999998 140-144 2.4299999999999997 145-149 3.52 150-151 4.7 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.63372093023256 84.82499999999999 2 0.9883720930232558 1.7000000000000002 3 0.1744186046511628 0.44999999999999996 4 0.11627906976744186 0.4 5 0.029069767441860465 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029069767441860465 0.8 >50 0.0 0.0 >100 0.029069767441860465 11.700000000000001 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 468 11.700000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 32 0.8 Illumina Single End PCR Primer 1 (100% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGGCGCCG 5 0.125 Illumina Single End PCR Primer 1 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.8 0.0 0.0 0.0 0.0 2 0.825 0.0 0.0 0.0 0.0 3 0.825 0.0 0.0 0.0 0.0 4 0.825 0.0 0.0 0.0 0.0 5 0.825 0.0 0.0 0.0 0.0 6 0.825 0.0 0.0 0.0 0.0 7 0.825 0.0 0.0 0.0 0.0 8 0.825 0.0 0.0 0.0 0.0 9 0.825 0.0 0.0 0.0 0.0 10-11 0.825 0.0 0.0 0.0 0.0 12-13 0.825 0.0 0.0 0.0 0.0 14-15 0.825 0.0 0.0 0.0 0.0 16-17 0.825 0.0 0.0 0.0 0.0 18-19 0.825 0.0 0.0 0.0 0.0 20-21 0.825 0.0 0.0 0.0 0.0 22-23 0.825 0.0 0.0 0.0 0.0 24-25 0.825 0.0 0.0 0.0 0.0 26-27 0.825 0.0 0.0 0.0 0.0 28-29 0.825 0.0 0.0 0.0 0.0 30-31 0.825 0.0 0.0 0.0 0.0 32-33 0.825 0.0 0.0 0.0 0.0 34-35 0.825 0.0 0.0 0.0 0.0 36-37 0.825 0.0 0.0 0.0 0.0 38-39 0.825 0.0 0.0 0.0 0.0 40-41 0.825 0.0 0.0 0.0 0.0 42-43 0.85 0.0 0.0 0.0 0.0 44-45 0.875 0.0 0.0 0.0 0.0 46-47 0.9 0.0 0.0 0.0 0.0 48-49 0.9 0.0 0.0 0.0 0.0 50-51 0.925 0.0 0.0 0.0 0.0 52-53 0.925 0.0 0.0 0.0 0.0 54-55 0.925 0.0 0.0 0.0 0.0 56-57 0.925 0.0 0.0 0.0 0.0 58-59 0.975 0.0 0.0 0.0 0.0 60-61 0.975 0.0 0.0 0.0 0.0 62-63 1.0125 0.0 0.0 0.0 0.0 64-65 1.0375 0.0 0.0 0.0 0.0 66-67 1.0625 0.0 0.0 0.0 0.0 68-69 1.075 0.0 0.0 0.0 0.0 70-71 1.075 0.0 0.0 0.0 0.0 72-73 1.1125 0.0 0.0 0.0 0.0 74-75 1.125 0.0 0.0 0.0 0.0 76-77 1.15 0.0 0.0 0.0 0.0 78-79 1.1625 0.0 0.0 0.0 0.0 80-81 1.175 0.0 0.0 0.0 0.0 82-83 1.175 0.0 0.0 0.0 0.0 84-85 1.225 0.0 0.0 0.0 0.0 86-87 1.3375 0.0 0.0 0.0 0.0 88-89 1.475 0.0 0.0 0.0 0.0 90-91 1.5875 0.0 0.0 0.0 0.0 92-93 1.675 0.0 0.0 0.0 0.0 94-95 1.85 0.0 0.0 0.0 0.0 96-97 2.0 0.0 0.0 0.0 0.0 98-99 2.2375 0.0 0.0 0.0 0.0 100-101 2.45 0.0 0.0 0.0 0.0 102-103 2.6375 0.0 0.0 0.0 0.0 104-105 2.825 0.0 0.0 0.0 0.0 106-107 3.0374999999999996 0.0 0.0 0.0 0.0 108-109 3.2125000000000004 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.7625 0.0 0.0 0.0 0.0 114-115 4.1 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.6375 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.5375 0.0 0.0 0.0 0.0 124-125 5.7375 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.425000000000001 0.0 0.0 0.0 0.0 130-131 7.0375 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 7.8625 0.0 0.0 0.0 0.0 136-137 8.4375 0.0 0.0 0.0 0.0 138-139 8.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTCAT 10 0.0068861037 144.51315 5 AAGAGCG 105 0.0 89.460526 7 GAGCGTC 110 0.0 88.470665 9 AGAGCGT 110 0.0 88.470665 8 TCGGAAG 110 0.0 85.39414 3 CGGAAGA 110 0.0 85.39414 4 ATCGGAA 110 0.0 85.39414 2 GATCGGA 115 0.0 81.68135 1 GAAGAGC 115 0.0 81.68135 6 GGAAGAG 115 0.0 81.68135 5 CGTATCA 60 1.6370905E-11 28.902634 45-49 CCGTATC 65 1.8189894E-12 28.902632 45-49 CGCCGTA 65 1.8189894E-12 28.902632 45-49 TTAAAAA 65 1.8189894E-12 28.902632 55-59 TGGTCGC 70 3.6379788E-12 26.838158 40-44 ATCTCGG 70 3.6379788E-12 26.838158 35-39 GTCGCCG 70 3.6379788E-12 26.838158 40-44 TCGGTGG 70 3.6379788E-12 26.838158 35-39 CATTAAA 70 3.6379788E-12 26.838158 50-54 TCTCGGT 70 3.6379788E-12 26.838158 35-39 >>END_MODULE Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205465 spots for SRR7473357.sra Written 1205465 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra Read 1205459 spots for SRR7473357.sra Written 1205459 spots for SRR7473357.sra SRR ids: ['SRR7473357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mm0r3jp8 SRR7473357.sra spots: 24109186 blocks: [[1, 1205459], [1205460, 2410918], [2410919, 3616377], [3616378, 4821836], [4821837, 6027295], [6027296, 7232754], [7232755, 8438213], [8438214, 9643672], [9643673, 10849131], [10849132, 12054590], [12054591, 13260049], [13260050, 14465508], [14465509, 15670967], [15670968, 16876426], [16876427, 18081885], [18081886, 19287344], [19287345, 20492803], [20492804, 21698262], [21698263, 22903721], [22903722, 24109186]] SRR7473357 file size 8148111 SRR7473357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473357 SRR7473357_1.fastq SRR7473357_2.fastq Input file: SRR7473357_1.fastq Paired file: SRR7473357_2.fastq trimmed: SRR7473357-trimmed-pair1.fastq, SRR7473357-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:57:50 2024 >> started Sat Dec 7 14:58:21 2024 >> done (30.877s) 24109186 read pairs processed; of these: 119066 ( 0.49%) short read pairs filtered out after trimming by size control 3638294 (15.09%) empty read pairs filtered out after trimming by size control 20351826 (84.42%) read pairs available; of these: 11948942 (58.71%) trimmed read pairs available after processing 8402884 (41.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 158 0.00% 19 153 0.00% 20 131 0.00% 21 213 0.00% 22 145 0.00% 23 131 0.00% 24 140 0.00% 25 114 0.00% 26 132 0.00% 27 169 0.00% 28 169 0.00% 29 168 0.00% 30 170 0.00% 31 176 0.00% 32 151 0.00% 33 166 0.00% 34 195 0.00% 35 207 0.00% 36 270 0.00% 37 375 0.00% 38 334 0.00% 39 362 0.00% 40 396 0.00% 41 555 0.00% 42 552 0.00% 43 710 0.00% 44 1301 0.01% 45 2058 0.01% 46 2219 0.01% 47 2280 0.01% 48 2428 0.01% 49 3228 0.02% 50 4667 0.02% 51 4957 0.02% 52 5957 0.03% 53 4094 0.02% 54 3311 0.02% 55 4075 0.02% 56 5076 0.02% 57 6114 0.03% 58 7909 0.04% 59 4543 0.02% 60 4423 0.02% 61 9479 0.05% 62 4045 0.02% 63 4442 0.02% 64 5398 0.03% 65 9767 0.05% 66 15382 0.08% 67 28768 0.14% 68 67243 0.33% 69 221633 1.09% 70 179639 0.88% 71 50027 0.25% 72 26510 0.13% 73 19531 0.10% 74 15464 0.08% 75 13074 0.06% 76 11818 0.06% 77 11669 0.06% 78 11280 0.06% 79 11603 0.06% 80 11866 0.06% 81 12476 0.06% 82 13364 0.07% 83 14550 0.07% 84 17263 0.08% 85 19641 0.10% 86 22058 0.11% 87 26030 0.13% 88 30591 0.15% 89 32253 0.16% 90 31036 0.15% 91 29080 0.14% 92 27951 0.14% 93 28858 0.14% 94 28783 0.14% 95 30651 0.15% 96 31173 0.15% 97 31865 0.16% 98 31713 0.16% 99 33048 0.16% 100 33469 0.16% 101 33779 0.17% 102 35155 0.17% 103 36543 0.18% 104 38033 0.19% 105 39243 0.19% 106 40614 0.20% 107 41414 0.20% 108 43273 0.21% 109 45506 0.22% 110 45759 0.22% 111 46491 0.23% 112 47884 0.24% 113 49264 0.24% 114 49898 0.25% 115 52864 0.26% 116 53934 0.27% 117 54331 0.27% 118 56162 0.28% 119 57974 0.28% 120 60169 0.30% 121 61541 0.30% 122 65244 0.32% 123 66760 0.33% 124 68504 0.34% 125 68374 0.34% 126 70418 0.35% 127 72645 0.36% 128 75083 0.37% 129 77439 0.38% 130 79856 0.39% 131 82289 0.40% 132 84939 0.42% 133 88541 0.44% 134 92241 0.45% 135 95970 0.47% 136 100764 0.50% 137 107059 0.53% 138 112913 0.55% 139 119215 0.59% 140 126970 0.62% 141 137282 0.67% 142 149257 0.73% 143 167788 0.82% 144 190112 0.93% 145 223243 1.10% 146 275040 1.35% 147 366758 1.80% 148 553659 2.72% 149 1081420 5.31% 150 4829755 23.73% 151 8402884 41.29% 20351826 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=31 prefix-density=0.52 prefix-fanout=2.2 sequence=GTATTTAGCCTTGGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=92.68 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=9.8 sequence=TCTTCTCCTCCGCTTATTTATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCGGAGCGACGCGCACTCCGTTTTTTGGGGTCCTTGGAGGCCTTTACGCCGGCTACGCACCTGCAGCGCTGCGCTGAGTAAAGCGAGATCGCCCACCACGCGCTGTGCCCGGCACGATACGCCGGCAGCCCGATCTTCGGCCAACCGCGCCCAGAGGCACGGGGAGCCATAAGCCGCGTCCTGCCCCCCACAAGGGGTGGCGGTGGGAGCGTGTTTTGGCGTGACGCCCAGGCAGGCGTGCCCTCGACCGGGTGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGAGTCGTGTCGATTGAATAGCATTGCAAAACGGGGGGCAGCAAGCAAGCTGGCCGCGTCCCCGGATTAGGCACA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=5.31 fanout-score-rank=19 prefix-density=0.89 prefix-fanout=2.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=63.08 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=8.1 sequence=AAGGAGAAGCTCCC SRR7473357 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:59:07 Started mapping on | Dec 07 14:59:07 Finished on | Dec 07 15:04:27 Mapping speed, Million of reads per hour | 228.96 Number of input reads | 20351826 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 16533604 Uniquely mapped reads % | 81.24% Average mapped length | 290.36 Number of splices: Total | 16812217 Number of splices: Annotated (sjdb) | 15779087 Number of splices: GT/AG | 16590197 Number of splices: GC/AG | 189044 Number of splices: AT/AC | 9656 Number of splices: Non-canonical | 23320 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.01% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316577 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 157407 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.34% % of reads unmapped: other | 6.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3527050 3527050 3527050 N_multimapping 316577 316577 316577 N_noFeature 538526 15988479 746986 N_ambiguous 380410 2211 43666 UnstrandedReadsAssigned:15614668 PositiveStrandReadsAssigned:542914 NegativeStrandReadsAssigned:15742952 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7473357 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473357-trimmed-pair1.fastq SRR7473357-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,351,826 reads, 15,924,683 reads pseudoaligned [quant] estimated average fragment length: 248.442 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52973 SRR7473357.ke.tsv 35125 SRR7473357.se.tsv 88098 total ==> SRR7473357.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.234 68.3846 8.71962 PNS24247 1044 796.558 40.6312 4.48278 PNS24249 1928 1680.56 160.469 8.39157 PNS24246 1044 796.558 40.6312 4.48278 PNS24248 1044 796.558 40.6312 4.48278 PNS24244 1471 1223.56 82.2531 5.90791 PNS24243 293 98.565 1 0.891627 KQK14069 1603 1355.56 413.502 26.808 KQK14071 474 242.81 0 0 ==> SRR7473357.se.tsv <== BRADI_1g14170v3 448 BRADI_1g53295v3 23 BRADI_1g59795v3 55 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 637 BRADI_1g74790v3 311 BRADI_1g09890v3 0 BRADI_1g77505v3 89 BRADI_1g48960v3 1 SRR7473357 completed mapping pipeline successfully