Starting /dee2/code/volunteer_pipeline.sh SRR7473358 current disk space = 1542839050240 free memory = 1602372464 SRR7473358 SRAfilesize 67a82e6deefbea887af973cbbc0b7758 SRR7473358.sra SRR7473358.sra file validated SRR7473358 is paired end SRR7473358 is conventional basespace SRR7473358 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4815 34.0 34.0 34.0 33.0 34.0 2 33.50625 34.0 34.0 34.0 33.0 34.0 3 33.51225 34.0 34.0 34.0 33.0 34.0 4 33.5695 34.0 34.0 34.0 33.0 34.0 5 33.5585 34.0 34.0 34.0 33.0 34.0 6 37.183 38.0 38.0 38.0 36.0 38.0 7 37.42475 38.0 38.0 38.0 37.0 38.0 8 37.571 38.0 38.0 38.0 38.0 38.0 9 37.61825 38.0 38.0 38.0 38.0 38.0 10-14 37.52935 38.0 38.0 38.0 38.0 38.0 15-19 37.55714999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.541 38.0 38.0 38.0 38.0 38.0 25-29 37.407 38.0 38.0 38.0 37.2 38.0 30-34 37.328799999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.25205 38.0 38.0 38.0 37.0 38.0 40-44 37.06195 38.0 38.0 38.0 36.2 38.0 45-49 36.987449999999995 38.0 38.0 38.0 35.8 38.0 50-54 37.12539999999999 38.0 38.0 38.0 36.0 38.0 55-59 37.15825 38.0 38.0 38.0 36.2 38.0 60-64 37.00019999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.89815 38.0 38.0 38.0 35.6 38.0 70-74 36.7478 38.0 38.0 38.0 35.2 38.0 75-79 36.73225 38.0 38.0 38.0 34.8 38.0 80-84 36.5867 38.0 38.0 38.0 34.8 38.0 85-89 36.49399999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.20955 38.0 38.0 38.0 33.8 38.0 95-99 35.9479 38.0 37.8 38.0 32.8 38.0 100-104 35.8226 38.0 37.0 38.0 32.2 38.0 105-109 35.724450000000004 38.0 37.0 38.0 31.8 38.0 110-114 35.4736 38.0 36.4 38.0 30.6 38.0 115-119 35.20615 38.0 36.0 38.0 28.4 38.0 120-124 34.9755 38.0 35.6 38.0 28.0 38.0 125-129 34.4261 38.0 35.2 38.0 25.6 38.0 130-134 33.7904 38.0 33.6 38.0 22.6 38.0 135-139 33.11619999999999 38.0 33.2 38.0 17.4 38.0 140-144 32.4632 38.0 32.8 38.0 13.0 38.0 145-149 31.246850000000002 38.0 30.8 38.0 8.2 38.0 150-151 25.858249999999998 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 2.0 14 4.0 15 2.0 16 2.0 17 3.0 18 8.0 19 10.0 20 9.0 21 14.0 22 8.0 23 11.0 24 20.0 25 16.0 26 26.0 27 29.0 28 40.0 29 56.0 30 50.0 31 56.0 32 84.0 33 97.0 34 181.0 35 329.0 36 831.0 37 2107.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.910047607116006 15.585066399398647 6.389376096216487 29.115509897268854 2 23.3 15.475 34.949999999999996 26.275 3 19.025 22.725 28.025 30.225 4 23.825 28.349999999999998 23.849999999999998 23.974999999999998 5 25.174999999999997 33.575 22.2 19.05 6 20.0 32.074999999999996 24.9 23.025000000000002 7 17.525 22.650000000000002 40.375 19.45 8 18.275 22.525000000000002 30.225 28.975 9 20.1 20.95 32.15 26.8 10-14 23.175 26.22 24.86 25.745 15-19 22.735 25.455 26.295 25.515 20-24 22.884999999999998 25.19 25.795 26.13 25-29 23.01 25.759999999999998 25.474999999999998 25.755 30-34 22.615 26.02 25.715 25.650000000000002 35-39 22.64566141535384 25.541385346336583 25.771442860715176 26.041510377594403 40-44 23.215984776403424 26.065401372126797 25.103911062146327 25.614702789323452 45-49 22.700215096793556 25.87664449002051 25.581511680256114 25.841628732929816 50-54 22.650000000000002 25.245 25.775 26.33 55-59 22.869999999999997 24.965 25.835 26.33 60-64 23.035 25.21 25.564999999999998 26.19 65-69 22.625 25.324999999999996 25.974999999999998 26.075 70-74 23.225 25.424999999999997 25.61 25.740000000000002 75-79 23.055 25.805 25.380000000000003 25.759999999999998 80-84 23.17731773177318 25.63256325632563 25.577557755775576 25.61256125612561 85-89 22.939999999999998 25.185000000000002 25.735000000000003 26.14 90-94 23.716601621134796 25.477834484138896 24.662263584509155 26.143300310217153 95-99 23.655967903711133 25.26579739217653 25.651955867602812 25.426278836509532 100-104 23.549999999999997 25.624999999999996 25.174999999999997 25.650000000000002 105-109 23.47 25.28 25.145 26.105 110-114 22.830000000000002 25.650000000000002 25.319999999999997 26.200000000000003 115-119 23.64 25.900000000000002 24.79 25.669999999999998 120-124 23.855 25.119999999999997 24.775 26.25 125-129 23.178874441488027 25.50328831768663 25.58361363522265 25.73422360560269 130-134 23.323585761823132 25.27478067964102 25.09327417565796 26.30835938287789 135-139 23.88059701492537 24.994957644211375 24.833602258975393 26.29084308188786 140-144 24.52469570465748 24.901921335881703 24.846594909968818 25.726788049492004 145-149 24.023388275618732 25.550682998134988 24.86516457482736 25.560764151418923 150-151 23.819120796070035 25.607759163622624 24.62526766595289 25.94785237435445 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 1.0 26 2.0 27 1.5 28 2.5 29 4.5 30 8.0 31 13.5 32 19.0 33 23.5 34 31.0 35 43.0 36 57.0 37 75.5 38 92.5 39 106.5 40 125.0 41 160.5 42 190.0 43 176.5 44 182.0 45 206.0 46 198.0 47 187.5 48 175.5 49 164.0 50 146.5 51 136.5 52 130.5 53 125.0 54 124.0 55 111.0 56 96.0 57 85.5 58 79.5 59 79.5 60 80.5 61 79.5 62 75.0 63 56.0 64 53.5 65 51.0 66 39.0 67 41.5 68 40.5 69 29.5 70 23.0 71 17.0 72 12.0 73 12.5 74 8.5 75 5.0 76 5.0 77 4.0 78 1.0 79 1.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.155 45-49 0.045 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.06999999999999999 95-99 0.3 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.40499999999999997 130-134 0.83 135-139 0.84 140-144 0.59 145-149 0.8049999999999999 150-151 0.7625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44665138782786 96.65 2 1.3496307613954672 2.65 3 0.17825311942959002 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025464731347084286 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCTCCATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.15 0.0 0.0 0.0 0.0 116-117 2.3375000000000004 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 3.9250000000000003 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.925 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473358 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473358_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.319 33.0 33.0 34.0 32.0 34.0 2 32.4945 34.0 33.0 34.0 32.0 34.0 3 32.53875 34.0 33.0 34.0 32.0 34.0 4 32.4845 34.0 33.0 34.0 32.0 34.0 5 32.447 34.0 33.0 34.0 32.0 34.0 6 36.38425 38.0 38.0 38.0 36.0 38.0 7 36.46125 38.0 38.0 38.0 36.0 38.0 8 36.572 38.0 38.0 38.0 36.0 38.0 9 36.643 38.0 38.0 38.0 36.0 38.0 10-14 36.661350000000006 38.0 38.0 38.0 36.0 38.0 15-19 36.562599999999996 38.0 38.0 38.0 36.6 38.0 20-24 36.36 38.0 38.0 38.0 36.0 38.0 25-29 36.3648 38.0 38.0 38.0 36.0 38.0 30-34 36.402300000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.426500000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.48305 38.0 38.0 38.0 36.2 38.0 45-49 36.384299999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.42045 38.0 38.0 38.0 36.0 38.0 55-59 36.372550000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.221999999999994 38.0 38.0 38.0 35.6 38.0 65-69 35.959649999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.0637 38.0 38.0 38.0 34.8 38.0 75-79 36.0149 38.0 38.0 38.0 34.8 38.0 80-84 35.91715 38.0 38.0 38.0 34.0 38.0 85-89 35.859550000000006 38.0 38.0 38.0 34.0 38.0 90-94 35.713649999999994 38.0 38.0 38.0 33.8 38.0 95-99 35.4443 38.0 38.0 38.0 32.8 38.0 100-104 34.79155000000001 38.0 38.0 38.0 28.2 38.0 105-109 34.7079 38.0 37.8 38.0 28.0 38.0 110-114 34.4585 38.0 37.0 38.0 26.0 38.0 115-119 34.262449999999994 38.0 36.0 38.0 23.6 38.0 120-124 34.1277 38.0 35.8 38.0 23.8 38.0 125-129 33.7949 38.0 35.6 38.0 22.2 38.0 130-134 33.393600000000006 38.0 34.0 38.0 16.2 38.0 135-139 32.70565 38.0 33.0 38.0 13.0 38.0 140-144 32.267 38.0 33.0 38.0 10.4 38.0 145-149 30.787599999999998 38.0 31.0 38.0 2.0 38.0 150-151 24.777875 32.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 20.0 4 13.0 5 2.0 6 2.0 7 1.0 8 1.0 9 2.0 10 5.0 11 7.0 12 3.0 13 2.0 14 3.0 15 6.0 16 6.0 17 16.0 18 12.0 19 12.0 20 6.0 21 12.0 22 14.0 23 19.0 24 28.0 25 33.0 26 17.0 27 20.0 28 31.0 29 34.0 30 29.0 31 53.0 32 78.0 33 103.0 34 139.0 35 247.0 36 609.0 37 2366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.5246067985794 21.968543886352105 7.483510908168442 24.02333840690005 2 28.835911742328175 22.520923154958155 29.140248541719505 19.502916560994166 3 21.506467156987068 24.346943951306113 29.87572914024854 24.27085975145828 4 26.374461616417534 32.91107170002533 19.91385862680517 20.800608056751962 5 26.904581118704122 35.66185775752974 19.134396355353076 18.29916476841306 6 22.7735368956743 36.972010178117046 18.575063613231553 21.679389312977097 7 21.635347892331133 18.943626206196036 36.05891315388522 23.362112747587606 8 22.997220116249682 22.1379833206975 24.76623704826889 30.09855951478393 9 23.162414751199798 21.141702450113662 26.471331144228337 29.224551654458196 10-14 26.067449715178707 25.523012552301257 23.17890810102334 25.230629631496697 15-19 26.04060913705584 25.248730964467004 24.248730964467004 24.461928934010153 20-24 26.02760658075689 24.907044262211585 24.29582845209596 24.76952070493557 25-29 25.52260820914501 25.97019480189207 24.083210416560703 24.423986572402217 30-34 26.408952187182095 24.98474059003052 24.53204476093591 24.074262461851475 35-39 25.85653922516927 25.377997250929084 24.06455225780176 24.700911266099883 40-44 25.884865744507728 25.406834825061026 24.6033360455655 24.104963384865744 45-49 25.885711372788904 24.794820818677678 24.641892236325635 24.67757557220778 50-54 26.2742903652457 25.216196968155458 24.412452945365754 24.097059721233087 55-59 25.979769226859144 24.9936461139633 24.72424134600722 24.302343313170336 60-64 25.68970782856561 25.180698360989513 24.824391733686248 24.30520207675863 65-69 25.829578041786156 25.035845964768537 24.969274887341253 24.165301106104057 70-74 26.235760781122863 25.21358828315704 24.40500406834825 24.14564686737185 75-79 26.367754084177314 24.76970838210596 24.744261794493358 24.118275739223368 80-84 25.982288273615634 25.544584690553744 24.501221498371336 23.971905537459286 85-89 26.092701768652166 25.98597275869079 24.268143931693434 23.65318154096361 90-94 26.33587786259542 24.559796437659035 24.97201017811705 24.1323155216285 95-99 26.216174740395925 25.090797483247222 25.054990025065223 23.638037751291627 100-104 26.165803108808287 25.968911917098445 24.264248704663213 23.60103626943005 105-109 25.802277432712216 25.724637681159418 24.865424430641824 23.607660455486542 110-114 26.722619417676924 25.779711946948503 25.059579318205365 22.438089317169204 115-119 26.70070658620867 25.71561194491722 24.04456134921863 23.539120119655475 120-124 26.69932955131511 25.425477050025787 24.78597215059309 23.089221248066014 125-129 26.520819359166193 26.34538981476704 24.322790361694445 22.811000464372324 130-134 27.049772821148288 25.913878562577448 24.504337050805454 22.532011565468814 135-139 27.00703682777749 25.86676254558529 24.464533360727312 22.66166726590991 140-144 27.098727422003282 26.257183908045977 24.594622331691298 22.049466338259442 145-149 27.29433650268706 25.816453079785035 24.555601488218272 22.33360892930963 150-151 27.220704903108338 26.089218363896478 24.281441019638443 22.40863571335674 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 15.0 2 7.0 3 6.0 4 6.0 5 4.0 6 1.5 7 2.5 8 1.5 9 1.0 10 1.5 11 1.5 12 2.0 13 2.0 14 1.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 0.5 25 1.5 26 3.0 27 5.0 28 6.5 29 6.5 30 7.0 31 9.5 32 12.0 33 17.5 34 24.5 35 32.0 36 45.5 37 60.0 38 77.5 39 88.5 40 111.0 41 130.0 42 138.0 43 164.5 44 193.5 45 194.5 46 166.0 47 162.5 48 174.0 49 161.0 50 144.5 51 133.5 52 129.0 53 117.0 54 109.5 55 110.0 56 97.5 57 94.0 58 98.5 59 94.0 60 92.5 61 89.0 62 81.5 63 72.5 64 68.0 65 66.0 66 58.0 67 57.5 68 52.5 69 42.5 70 37.0 71 28.5 72 19.0 73 14.0 74 10.0 75 8.0 76 6.0 77 3.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 1.425 3 1.425 4 1.325 5 1.225 6 1.7500000000000002 7 1.55 8 1.075 9 1.0250000000000001 10-14 0.815 15-19 1.5 20-24 1.8350000000000002 25-29 1.695 30-34 1.7000000000000002 35-39 1.7850000000000001 40-44 1.68 45-49 1.915 50-54 1.71 55-59 1.635 60-64 1.77 65-69 2.36 70-74 1.68 75-79 1.755 80-84 1.76 85-89 1.6199999999999999 90-94 1.7500000000000002 95-99 2.255 100-104 3.5000000000000004 105-109 3.4000000000000004 110-114 3.49 115-119 3.055 120-124 3.05 125-129 3.0949999999999998 130-134 3.16 135-139 2.6550000000000002 140-144 2.56 145-149 3.2399999999999998 150-151 3.8875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.25506800102643 95.72500000000001 2 1.437002822684116 2.8000000000000003 3 0.12830382345393893 0.375 4 0.10264305876315115 0.4 5 0.025660764690787787 0.125 6 0.0 0.0 7 0.025660764690787787 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025660764690787787 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) GCTCGATCGATCAGTAGTGTGATCTCAGAGCTCCCATCGCGATCGAGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847334 spots for SRR7473358.sra Written 847334 spots for SRR7473358.sra Read 847342 spots for SRR7473358.sra Written 847342 spots for SRR7473358.sra SRR ids: ['SRR7473358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v5_tyn2a SRR7473358.sra spots: 16946688 blocks: [[1, 847334], [847335, 1694668], [1694669, 2542002], [2542003, 3389336], [3389337, 4236670], [4236671, 5084004], [5084005, 5931338], [5931339, 6778672], [6778673, 7626006], [7626007, 8473340], [8473341, 9320674], [9320675, 10168008], [10168009, 11015342], [11015343, 11862676], [11862677, 12710010], [12710011, 13557344], [13557345, 14404678], [14404679, 15252012], [15252013, 16099346], [16099347, 16946688]] SRR7473358 file size 5720976 SRR7473358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473358 SRR7473358_1.fastq SRR7473358_2.fastq Input file: SRR7473358_1.fastq Paired file: SRR7473358_2.fastq trimmed: SRR7473358-trimmed-pair1.fastq, SRR7473358-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:59:09 2024 >> started Sat Dec 7 14:59:29 2024 >> done (20.101s) 16946688 read pairs processed; of these: 40778 ( 0.24%) short read pairs filtered out after trimming by size control 53969 ( 0.32%) empty read pairs filtered out after trimming by size control 16851941 (99.44%) read pairs available; of these: 10005768 (59.37%) trimmed read pairs available after processing 6846173 (40.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 36 0.00% 20 33 0.00% 21 30 0.00% 22 38 0.00% 23 45 0.00% 24 54 0.00% 25 48 0.00% 26 46 0.00% 27 35 0.00% 28 55 0.00% 29 59 0.00% 30 60 0.00% 31 66 0.00% 32 54 0.00% 33 64 0.00% 34 66 0.00% 35 67 0.00% 36 68 0.00% 37 59 0.00% 38 75 0.00% 39 65 0.00% 40 96 0.00% 41 89 0.00% 42 105 0.00% 43 96 0.00% 44 100 0.00% 45 139 0.00% 46 148 0.00% 47 129 0.00% 48 162 0.00% 49 160 0.00% 50 191 0.00% 51 191 0.00% 52 204 0.00% 53 229 0.00% 54 228 0.00% 55 249 0.00% 56 265 0.00% 57 314 0.00% 58 336 0.00% 59 382 0.00% 60 396 0.00% 61 413 0.00% 62 480 0.00% 63 537 0.00% 64 619 0.00% 65 771 0.00% 66 906 0.01% 67 1382 0.01% 68 2240 0.01% 69 4110 0.02% 70 3767 0.02% 71 2008 0.01% 72 1612 0.01% 73 1675 0.01% 74 1676 0.01% 75 1897 0.01% 76 1935 0.01% 77 2068 0.01% 78 2276 0.01% 79 2614 0.02% 80 2944 0.02% 81 3247 0.02% 82 3625 0.02% 83 4227 0.03% 84 5435 0.03% 85 6169 0.04% 86 6564 0.04% 87 6579 0.04% 88 7363 0.04% 89 7857 0.05% 90 8250 0.05% 91 9035 0.05% 92 9247 0.05% 93 10188 0.06% 94 10825 0.06% 95 11788 0.07% 96 12378 0.07% 97 12605 0.07% 98 13067 0.08% 99 13944 0.08% 100 15162 0.09% 101 15361 0.09% 102 16084 0.10% 103 17199 0.10% 104 18784 0.11% 105 20196 0.12% 106 21057 0.12% 107 20928 0.12% 108 22149 0.13% 109 24611 0.15% 110 25034 0.15% 111 25299 0.15% 112 26595 0.16% 113 29541 0.18% 114 29691 0.18% 115 31477 0.19% 116 33407 0.20% 117 33318 0.20% 118 35127 0.21% 119 36127 0.21% 120 38884 0.23% 121 40168 0.24% 122 41803 0.25% 123 43544 0.26% 124 47109 0.28% 125 47579 0.28% 126 49854 0.30% 127 51710 0.31% 128 54280 0.32% 129 56819 0.34% 130 59264 0.35% 131 61953 0.37% 132 66197 0.39% 133 69791 0.41% 134 74660 0.44% 135 78978 0.47% 136 84519 0.50% 137 90371 0.54% 138 97522 0.58% 139 104406 0.62% 140 113441 0.67% 141 127311 0.76% 142 142050 0.84% 143 160998 0.96% 144 184566 1.10% 145 223568 1.33% 146 282613 1.68% 147 388694 2.31% 148 597852 3.55% 149 1156647 6.86% 150 4667792 27.70% 151 6846173 40.63% 16851941 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.79 prefix-fanout=2.0 sequence=GGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=116.80 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=10.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=28 prefix-density=0.56 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=29.40 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.3 sequence=CTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCG SRR7473358 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:00:23 Started mapping on | Dec 07 15:00:23 Finished on | Dec 07 15:04:31 Mapping speed, Million of reads per hour | 244.62 Number of input reads | 16851941 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15604959 Uniquely mapped reads % | 92.60% Average mapped length | 293.34 Number of splices: Total | 16523848 Number of splices: Annotated (sjdb) | 15582822 Number of splices: GT/AG | 16307956 Number of splices: GC/AG | 191542 Number of splices: AT/AC | 8069 Number of splices: Non-canonical | 16281 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 160241 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 17200 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.55% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1102841 1102841 1102841 N_multimapping 160241 160241 160241 N_noFeature 618591 15080345 811843 N_ambiguous 394667 2459 63828 UnstrandedReadsAssigned:14591701 PositiveStrandReadsAssigned:522155 NegativeStrandReadsAssigned:14729288 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473358 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473358-trimmed-pair1.fastq SRR7473358-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,851,941 reads, 14,804,192 reads pseudoaligned [quant] estimated average fragment length: 267.076 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52973 SRR7473358.ke.tsv 35125 SRR7473358.se.tsv 88098 total ==> SRR7473358.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.536 43.4608 5.76272 PNS24247 1044 777.924 26.0719 2.9798 PNS24249 1928 1661.92 48.1615 2.57657 PNS24246 1044 777.924 26.0719 2.9798 PNS24248 1044 777.924 26.0719 2.9798 PNS24244 1471 1204.92 46.162 3.40625 PNS24243 293 92.0796 0 0 KQK14069 1603 1336.92 1288.69 85.7029 KQK14071 474 231.48 22.8563 8.77899 ==> SRR7473358.se.tsv <== BRADI_1g14170v3 1468 BRADI_1g53295v3 481 BRADI_1g59795v3 1175 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 1534 BRADI_1g74790v3 70 BRADI_1g09890v3 3 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR7473358 completed mapping pipeline successfully