Starting /dee2/code/volunteer_pipeline.sh SRR7473359 current disk space = 1542840078336 free memory = 1597345264 SRR7473359 SRAfilesize ec17d73b70ced640357392020da763a9 SRR7473359.sra SRR7473359.sra file validated SRR7473359 is paired end SRR7473359 is conventional basespace SRR7473359 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4325 34.0 34.0 34.0 33.0 34.0 2 33.50625 34.0 34.0 34.0 33.0 34.0 3 33.529 34.0 34.0 34.0 33.0 34.0 4 33.56125 34.0 34.0 34.0 33.0 34.0 5 33.54525 34.0 34.0 34.0 33.0 34.0 6 37.092 38.0 37.0 38.0 36.0 38.0 7 37.403 38.0 38.0 38.0 37.0 38.0 8 37.50275 38.0 38.0 38.0 38.0 38.0 9 37.53975 38.0 38.0 38.0 38.0 38.0 10-14 37.50535 38.0 38.0 38.0 38.0 38.0 15-19 37.50404999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.4992 38.0 38.0 38.0 38.0 38.0 25-29 37.3818 38.0 38.0 38.0 37.0 38.0 30-34 37.358799999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.2357 38.0 38.0 38.0 37.0 38.0 40-44 36.9995 38.0 38.0 38.0 36.0 38.0 45-49 36.969899999999996 38.0 38.0 38.0 36.0 38.0 50-54 37.110749999999996 38.0 38.0 38.0 36.0 38.0 55-59 37.09955 38.0 38.0 38.0 36.0 38.0 60-64 36.987899999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.74464999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.72195000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.70815 38.0 38.0 38.0 35.0 38.0 80-84 36.54935 38.0 38.0 38.0 34.2 38.0 85-89 36.472750000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.14 38.0 37.8 38.0 33.4 38.0 95-99 35.859899999999996 38.0 37.2 38.0 33.0 38.0 100-104 35.7766 38.0 37.0 38.0 31.8 38.0 105-109 35.60465000000001 38.0 37.0 38.0 31.0 38.0 110-114 35.37365 38.0 36.2 38.0 30.6 38.0 115-119 35.1483 38.0 36.0 38.0 29.0 38.0 120-124 34.834450000000004 38.0 35.0 38.0 27.4 38.0 125-129 34.3678 38.0 35.0 38.0 25.4 38.0 130-134 33.60425 38.0 33.6 38.0 21.0 38.0 135-139 33.0432 38.0 33.2 38.0 19.8 38.0 140-144 32.4884 38.0 32.6 38.0 13.0 38.0 145-149 31.1068 38.0 30.6 38.0 6.0 38.0 150-151 25.614 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 3.0 14 2.0 15 2.0 16 4.0 17 7.0 18 6.0 19 10.0 20 11.0 21 13.0 22 14.0 23 14.0 24 16.0 25 17.0 26 21.0 27 25.0 28 40.0 29 53.0 30 51.0 31 77.0 32 97.0 33 123.0 34 165.0 35 311.0 36 855.0 37 2059.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.704038123902684 14.823175319789314 10.383747178329571 35.08903937797843 2 24.3 15.875 32.75 27.075 3 20.95 22.650000000000002 27.650000000000002 28.749999999999996 4 25.674999999999997 27.175 23.799999999999997 23.35 5 25.874999999999996 31.15 22.900000000000002 20.075000000000003 6 22.975 31.324999999999996 23.799999999999997 21.9 7 17.974999999999998 20.5 39.050000000000004 22.475 8 20.525 22.725 26.525 30.225 9 20.25 20.674999999999997 30.725 28.349999999999998 10-14 23.325000000000003 25.0 24.375 27.3 15-19 22.85 24.89 25.419999999999998 26.840000000000003 20-24 23.44 25.4 24.85 26.31 25-29 23.080000000000002 24.740000000000002 25.119999999999997 27.060000000000002 30-34 23.18 24.545 25.21 27.065 35-39 23.273145600960333 25.213824838693544 24.993747811734107 26.519281748612016 40-44 23.290416311808027 24.80336656480136 25.184109012574517 26.72210811081609 45-49 23.506454518162716 24.402081457019914 25.16761733213249 26.923846692684876 50-54 23.425 25.09 24.54 26.945000000000004 55-59 23.44 24.465 25.169999999999998 26.924999999999997 60-64 23.455000000000002 24.215 25.419999999999998 26.91 65-69 23.155 25.145 25.069999999999997 26.63 70-74 23.39 24.805 24.945 26.86 75-79 24.012401240124014 24.69246924692469 24.552455245524552 26.742674267426743 80-84 23.730932733183295 24.68617154288572 25.08627156789197 26.49662415603901 85-89 24.31621581079054 23.84119205960298 24.70123506175309 27.141357067853395 90-94 23.710153630586 24.02542160836711 25.061302106790773 27.203122654256116 95-99 23.927550047664443 24.655059956851137 24.845717726155236 26.571672269329188 100-104 24.387438743874387 24.71247124712471 24.072407240724072 26.82768276827683 105-109 24.065 24.66 24.265 27.01 110-114 24.497449744974496 25.002500250025 24.192419241924192 26.307630763076308 115-119 24.365000000000002 24.805 24.060000000000002 26.77 120-124 23.845 25.15 24.48 26.525 125-129 24.001607474757623 24.6445973778068 24.63455066057166 26.719244486863918 130-134 24.69466034117291 24.09912183304734 24.442313515695975 26.76390431008378 135-139 24.64163133454472 24.505350292751867 24.318594791035736 26.534423581667678 140-144 24.160837401237988 24.84021941522822 24.170902319963766 26.828040863570024 145-149 24.331685665288006 24.573791990315748 24.03409664077474 27.060425703621505 150-151 23.662966700302725 25.22704339051463 24.00353178607467 27.106458123107974 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 2.0 26 3.5 27 4.0 28 5.0 29 8.5 30 11.0 31 15.0 32 17.0 33 26.0 34 41.0 35 48.0 36 53.0 37 60.0 38 76.0 39 90.5 40 97.0 41 126.5 42 158.5 43 147.5 44 144.5 45 160.0 46 170.5 47 160.0 48 148.0 49 154.0 50 146.0 51 142.0 52 137.5 53 138.5 54 144.5 55 137.0 56 115.5 57 104.0 58 103.5 59 95.5 60 88.0 61 82.0 62 82.0 63 74.5 64 69.5 65 64.0 66 50.5 67 53.5 68 57.0 69 43.5 70 30.0 71 28.0 72 26.0 73 14.5 74 9.5 75 10.5 76 9.5 77 6.0 78 3.0 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.19499999999999998 45-49 0.06999999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.025 85-89 0.005 90-94 0.08499999999999999 95-99 0.345 100-104 0.01 105-109 0.0 110-114 0.01 115-119 0.0 120-124 0.0 125-129 0.46499999999999997 130-134 0.9299999999999999 135-139 0.9400000000000001 140-144 0.645 145-149 0.8699999999999999 150-151 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.62825470482083 94.675 2 1.907708172209332 3.6999999999999997 3 0.30935808197989173 0.8999999999999999 4 0.07733952049497293 0.3 5 0.051559680329981955 0.25 6 0.0 0.0 7 0.025779840164990978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGATATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 35bp) CTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGC 5 0.125 No Hit GGCCAACATAGCCTTCTCCGTCCCCCCTTCGCAGTAACACCAAGTACAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.7625 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.2125 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.8125 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.5125 0.0 0.0 0.0 0.0 120-121 4.8 0.0 0.0 0.0 0.0 122-123 5.262499999999999 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 6.25 0.0 0.0 0.0 0.0 128-129 7.012499999999999 0.0 0.0 0.0 0.0 130-131 7.375 0.0 0.0 0.0 0.0 132-133 7.7125 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.625 0.0 0.0 0.0 0.0 138-139 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473359 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473359_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2635 33.0 33.0 34.0 32.0 34.0 2 32.4775 33.0 33.0 34.0 32.0 34.0 3 32.471 34.0 33.0 34.0 32.0 34.0 4 32.37075 34.0 33.0 34.0 32.0 34.0 5 32.4265 34.0 33.0 34.0 32.0 34.0 6 36.24225 38.0 38.0 38.0 35.0 38.0 7 36.399 38.0 38.0 38.0 36.0 38.0 8 36.52275 38.0 38.0 38.0 36.0 38.0 9 36.631 38.0 38.0 38.0 36.0 38.0 10-14 36.6315 38.0 38.0 38.0 36.0 38.0 15-19 36.44465 38.0 38.0 38.0 36.0 38.0 20-24 36.26370000000001 38.0 38.0 38.0 35.8 38.0 25-29 36.274950000000004 38.0 38.0 38.0 35.8 38.0 30-34 36.38655 38.0 38.0 38.0 36.0 38.0 35-39 36.337900000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.39635 38.0 38.0 38.0 36.0 38.0 45-49 36.188050000000004 38.0 38.0 38.0 35.6 38.0 50-54 36.27665 38.0 38.0 38.0 35.8 38.0 55-59 36.28144999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.0926 38.0 38.0 38.0 34.8 38.0 65-69 35.85895000000001 38.0 38.0 38.0 34.4 38.0 70-74 35.93895 38.0 38.0 38.0 34.2 38.0 75-79 35.8705 38.0 38.0 38.0 34.0 38.0 80-84 35.77329999999999 38.0 38.0 38.0 34.0 38.0 85-89 35.695800000000006 38.0 38.0 38.0 33.6 38.0 90-94 35.553749999999994 38.0 38.0 38.0 33.2 38.0 95-99 35.22005 38.0 38.0 38.0 31.6 38.0 100-104 34.58005000000001 38.0 37.4 38.0 27.0 38.0 105-109 34.43685 38.0 36.8 38.0 25.6 38.0 110-114 34.187 38.0 36.4 38.0 23.6 38.0 115-119 33.9294 38.0 35.6 38.0 22.2 38.0 120-124 33.734500000000004 38.0 35.0 38.0 21.0 38.0 125-129 33.33425 38.0 34.2 38.0 15.4 38.0 130-134 32.94005 38.0 33.0 38.0 13.0 38.0 135-139 32.16975000000001 38.0 33.0 38.0 11.8 38.0 140-144 31.4078 38.0 32.2 38.0 5.6 38.0 145-149 30.240750000000002 38.0 29.4 38.0 2.0 38.0 150-151 24.365000000000002 32.0 14.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 27.0 4 12.0 5 7.0 6 1.0 7 1.0 8 3.0 9 1.0 10 2.0 11 4.0 12 9.0 13 3.0 14 8.0 15 7.0 16 6.0 17 17.0 18 16.0 19 15.0 20 12.0 21 14.0 22 12.0 23 19.0 24 34.0 25 39.0 26 11.0 27 18.0 28 25.0 29 45.0 30 38.0 31 69.0 32 76.0 33 93.0 34 161.0 35 255.0 36 678.0 37 2220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.06145251396648 18.71508379888268 11.020822752666328 29.20264093448451 2 30.38842345773039 21.95988829652196 27.138867732927142 20.51282051282051 3 24.25088877602844 24.936515997968513 26.536312849162012 24.276282376841035 4 26.027397260273972 32.44545915778792 19.48249619482496 22.04464738711314 5 26.91527143581938 33.61237950279046 18.39167935058346 21.080669710806696 6 24.191494779730075 34.07181054239878 18.41100076394194 23.325693913929207 7 22.90872107805746 18.78972794304602 32.79938977879481 25.502161200101703 8 25.38558786346397 21.5929203539823 22.326169405815424 30.695322376738304 9 24.62082912032356 21.840242669362993 24.87360970677452 28.665318503538927 10-14 26.881557707828897 24.571226795803067 22.94693301049233 25.60028248587571 15-19 27.394752898108603 24.674598332316453 22.44763066910718 25.483018100467763 20-24 26.624802164701077 24.960432940215448 23.515597079695716 24.899167815387756 25-29 27.113895680521598 25.4278728606357 22.6619804400978 24.796251018744904 30-34 26.417112299465238 25.29666412019353 23.407181054239878 24.87904252610135 35-39 27.170696867666567 24.798489950005102 22.773186409550046 25.257626772778284 40-44 27.532467532467532 24.899414311179015 22.780748663101605 24.787369493251845 45-49 27.42529676627098 24.46275071633238 23.34731887024151 24.764633647155136 50-54 27.082378114014976 25.00382087727342 23.358296398186358 24.555504610525244 55-59 27.14074677805512 25.108247160103918 22.540879221639244 25.210126840201724 60-64 26.70579229395254 24.88900229650421 23.398826231181424 25.006379178361826 65-69 27.226044983054326 24.509602546985725 23.518537537229125 24.74581493273082 70-74 26.872673499566567 24.39447248992912 23.72138085768191 25.011473152822393 75-79 26.84033442088091 24.388254486133768 23.236133768352367 25.535277324632954 80-84 27.517838939857285 24.413863404689092 23.277268093781856 24.791029561671763 85-89 27.107942973523418 25.239307535641547 23.090631364562118 24.562118126272914 90-94 26.96623482607365 25.10966030806896 23.411200652861368 24.512904212996023 95-99 27.42722185141449 24.74200338861221 23.602197463675104 24.228577296298198 100-104 27.86961946350593 25.181950509461426 22.816593886462883 24.131836140569764 105-109 27.278862126245844 25.103820598006642 23.312915282392026 24.30440199335548 110-114 27.586206896551722 25.70108018280017 23.255089322808477 23.457623597839632 115-119 28.277395666339146 25.495164710141182 22.837048146041266 23.39039147747841 120-124 28.017999379331748 24.785352229233474 23.14575359470363 24.05089479673115 125-129 27.769151138716357 25.020703933747413 23.8768115942029 23.333333333333332 130-134 28.156546047522905 25.324843402184605 23.238598126003 23.280012424289488 135-139 28.060961795901555 25.471115230151376 23.046030274945938 23.42189269900113 140-144 28.47961334772996 25.0398478070852 23.512777006529898 22.967761838654944 145-149 28.498160907630936 25.519349323939284 23.084494638139148 22.897995130290628 150-151 29.055816379760042 26.81272822117893 22.10485133020344 22.026604068857587 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 14.5 2 9.0 3 7.5 4 7.0 5 6.5 6 3.0 7 2.0 8 2.0 9 2.5 10 2.0 11 0.5 12 1.5 13 2.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 1.5 24 3.5 25 6.0 26 5.0 27 2.5 28 5.5 29 7.0 30 5.5 31 7.5 32 11.5 33 17.5 34 23.0 35 23.5 36 33.0 37 43.0 38 62.5 39 84.5 40 95.5 41 107.5 42 119.5 43 135.5 44 148.5 45 151.0 46 150.5 47 138.5 48 115.0 49 125.5 50 140.0 51 118.0 52 117.5 53 147.5 54 151.0 55 135.0 56 125.0 57 119.5 58 107.5 59 106.5 60 111.5 61 104.5 62 106.5 63 97.5 64 73.0 65 79.0 66 80.0 67 64.0 68 68.5 69 59.5 70 47.0 71 43.5 72 30.0 73 22.5 74 17.0 75 10.0 76 8.0 77 4.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 1.525 3 1.55 4 1.4500000000000002 5 1.4500000000000002 6 1.825 7 1.675 8 1.125 9 1.0999999999999999 10-14 0.88 15-19 1.66 20-24 2.0650000000000004 25-29 1.8399999999999999 30-34 1.825 35-39 1.9900000000000002 40-44 1.825 45-49 2.2800000000000002 50-54 1.855 55-59 1.8450000000000002 60-64 2.025 65-69 2.63 70-74 1.9449999999999998 75-79 1.92 80-84 1.9 85-89 1.7999999999999998 90-94 1.97 95-99 2.6149999999999998 100-104 3.82 105-109 3.6799999999999997 110-114 3.7199999999999998 115-119 3.315 120-124 3.3300000000000005 125-129 3.4000000000000004 130-134 3.415 135-139 2.8899999999999997 140-144 2.7550000000000003 145-149 3.485 150-151 4.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.55399427530575 93.72500000000001 2 1.8214936247723135 3.5000000000000004 3 0.2602133749674733 0.75 4 0.20817069997397866 0.8 5 0.026021337496747333 0.125 6 0.052042674993494666 0.3 7 0.026021337496747333 0.17500000000000002 8 0.026021337496747333 0.2 9 0.0 0.0 >10 0.026021337496747333 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 8 0.2 No Hit GCTCGATCGATCAGTAGTGTGATCTCAGAGCTCCCATCGCGATCGAGCAG 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 6 0.15 No Hit CGGGAACTCAAAGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.4749999999999996 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.15 0.0 0.0 0.0 0.0 112-113 3.4625 0.0 0.0 0.0 0.0 114-115 3.8 0.0 0.0 0.0 0.0 116-117 4.1375 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.7625 0.0 0.0 0.0 0.0 122-123 5.2 0.0 0.0 0.0 0.0 124-125 5.5 0.0 0.0 0.0 0.0 126-127 6.0875 0.0 0.0 0.0 0.0 128-129 6.8125 0.0 0.0 0.0 0.0 130-131 7.1125 0.0 0.0 0.0 0.0 132-133 7.4125 0.0 0.0 0.0 0.0 134-135 7.824999999999999 0.0 0.0 0.0 0.0 136-137 8.35 0.0 0.0 0.0 0.0 138-139 8.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGACATG 10 0.0076557267 139.575 8 >>END_MODULE Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951501 spots for SRR7473359.sra Written 951501 spots for SRR7473359.sra Read 951515 spots for SRR7473359.sra Written 951515 spots for SRR7473359.sra SRR ids: ['SRR7473359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ibtqklng SRR7473359.sra spots: 19030034 blocks: [[1, 951501], [951502, 1903002], [1903003, 2854503], [2854504, 3806004], [3806005, 4757505], [4757506, 5709006], [5709007, 6660507], [6660508, 7612008], [7612009, 8563509], [8563510, 9515010], [9515011, 10466511], [10466512, 11418012], [11418013, 12369513], [12369514, 13321014], [13321015, 14272515], [14272516, 15224016], [15224017, 16175517], [16175518, 17127018], [17127019, 18078519], [18078520, 19030034]] SRR7473359 file size 6426953 SRR7473359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473359 SRR7473359_1.fastq SRR7473359_2.fastq Input file: SRR7473359_1.fastq Paired file: SRR7473359_2.fastq trimmed: SRR7473359-trimmed-pair1.fastq, SRR7473359-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:59:43 2024 >> started Sat Dec 7 15:00:04 2024 >> done (21.557s) 19030034 read pairs processed; of these: 46534 ( 0.24%) short read pairs filtered out after trimming by size control 83333 ( 0.44%) empty read pairs filtered out after trimming by size control 18900167 (99.32%) read pairs available; of these: 11768674 (62.27%) trimmed read pairs available after processing 7131493 (37.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 38 0.00% 20 28 0.00% 21 24 0.00% 22 42 0.00% 23 29 0.00% 24 31 0.00% 25 42 0.00% 26 39 0.00% 27 44 0.00% 28 43 0.00% 29 53 0.00% 30 44 0.00% 31 63 0.00% 32 72 0.00% 33 57 0.00% 34 41 0.00% 35 78 0.00% 36 63 0.00% 37 75 0.00% 38 92 0.00% 39 87 0.00% 40 94 0.00% 41 131 0.00% 42 120 0.00% 43 138 0.00% 44 161 0.00% 45 188 0.00% 46 180 0.00% 47 174 0.00% 48 210 0.00% 49 226 0.00% 50 307 0.00% 51 336 0.00% 52 366 0.00% 53 372 0.00% 54 342 0.00% 55 439 0.00% 56 456 0.00% 57 497 0.00% 58 531 0.00% 59 593 0.00% 60 657 0.00% 61 833 0.00% 62 885 0.00% 63 1005 0.01% 64 1140 0.01% 65 1349 0.01% 66 1677 0.01% 67 2284 0.01% 68 3199 0.02% 69 5735 0.03% 70 7373 0.04% 71 5303 0.03% 72 4047 0.02% 73 3696 0.02% 74 3395 0.02% 75 3506 0.02% 76 3732 0.02% 77 4072 0.02% 78 4247 0.02% 79 4820 0.03% 80 5421 0.03% 81 6174 0.03% 82 7153 0.04% 83 8290 0.04% 84 10351 0.05% 85 11088 0.06% 86 11354 0.06% 87 11925 0.06% 88 12877 0.07% 89 13515 0.07% 90 14491 0.08% 91 16023 0.08% 92 16969 0.09% 93 19342 0.10% 94 20491 0.11% 95 21817 0.12% 96 22176 0.12% 97 22072 0.12% 98 22471 0.12% 99 23819 0.13% 100 25298 0.13% 101 25525 0.14% 102 27969 0.15% 103 30043 0.16% 104 32249 0.17% 105 35059 0.19% 106 34808 0.18% 107 34515 0.18% 108 36006 0.19% 109 38413 0.20% 110 39493 0.21% 111 38855 0.21% 112 41229 0.22% 113 46159 0.24% 114 46278 0.24% 115 49147 0.26% 116 50739 0.27% 117 50098 0.27% 118 50730 0.27% 119 51026 0.27% 120 53502 0.28% 121 54950 0.29% 122 57992 0.31% 123 61642 0.33% 124 65913 0.35% 125 67096 0.36% 126 68944 0.36% 127 70557 0.37% 128 71734 0.38% 129 73710 0.39% 130 76438 0.40% 131 78808 0.42% 132 82814 0.44% 133 88608 0.47% 134 95302 0.50% 135 101875 0.54% 136 107678 0.57% 137 113863 0.60% 138 119260 0.63% 139 126914 0.67% 140 134848 0.71% 141 148822 0.79% 142 165933 0.88% 143 187460 0.99% 144 218060 1.15% 145 262093 1.39% 146 327897 1.73% 147 446287 2.36% 148 685550 3.63% 149 1308603 6.92% 150 5094140 26.95% 151 7131493 37.73% 18900167 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=16 prefix-density=0.96 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.22 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=ATGTTCCAACAAGTAATTCACATATACAATTCCATTTCTTTGTATTCAGAAACTTACAATTCAAATCGTTTACCTGTGCGGCGATGAATCAAAAAAGGTACGGAATTTTCCAAACATGCATATATAGTGACGGCATTCTTAATTACTAGAATCAAGTGGCCTTGGCGTAGAAGGACCCGGTCTTCATGGCGTCGTCGTTGGCTTCACCCAGTGCAGCCTCACTGAGGTACTTGTCTGCAAGCTGCACCCTCTTCACGTTCTCCTGCTCCTGGACAAGCATGTGCCCATACTCCATGAGCTTACTGATTGTCATCTTCGGCTGCTCGAACTTGGGCGGGCCCTCCTTCGAGTTCACCAGCCTCTTGGAAATGTTCTCCACACCGATTTCCCCGACCCATTTCCGCACCTCGTCATCGTAAACCCTGGCACGCAGCGCGCCGAAGAAGTCGATGCTCTGCCCCGGGAACATGTCGACGAGCCTAACCACCGCCTCGTCGGGGACGCCATCGGT criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=33 prefix-density=1.05 prefix-fanout=2.3 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.13 sequence-density-rank=33 fanout-score=12.38 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=3.4 sequence=CTCGAGAACCTGGCCGACCACCTGTCCGACCCAGTGAACAACAACGCCTGGGCCTTCGCCACCAACTTCGTCCCCGGCAAGTGAGCTTAGTTAGCAAGCTCCAGCGCCTGCTCTATGCTGAGGCGCTTGGCCGACGACGTCATTGTTGATGATGGATGCTGCTGCATGTGTCGAGATTGAGTCAGGAGTCAGGACTGATAGATGTTGCATGTGAAAGTCAGAGATGAG SRR7473359 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:00:50 Started mapping on | Dec 07 15:00:50 Finished on | Dec 07 15:06:01 Mapping speed, Million of reads per hour | 218.78 Number of input reads | 18900167 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16989496 Uniquely mapped reads % | 89.89% Average mapped length | 291.34 Number of splices: Total | 16628508 Number of splices: Annotated (sjdb) | 15648494 Number of splices: GT/AG | 16419944 Number of splices: GC/AG | 180999 Number of splices: AT/AC | 9611 Number of splices: Non-canonical | 17954 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153090 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 16969 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.33% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1775279 1775279 1775279 N_multimapping 153090 153090 153090 N_noFeature 551382 16376770 806780 N_ambiguous 421595 2363 65636 UnstrandedReadsAssigned:16016519 PositiveStrandReadsAssigned:610363 NegativeStrandReadsAssigned:16117080 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7473359 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473359-trimmed-pair1.fastq SRR7473359-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,900,167 reads, 16,176,799 reads pseudoaligned [quant] estimated average fragment length: 258.852 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR7473359.ke.tsv 35125 SRR7473359.se.tsv 88098 total ==> SRR7473359.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.704 103.832 11.206 PNS24247 1044 786.148 11.4008 1.06227 PNS24249 1928 1670.15 66.3284 2.90902 PNS24246 1044 786.148 11.4008 1.06227 PNS24248 1044 786.148 11.4008 1.06227 PNS24244 1471 1213.15 56.6372 3.41972 PNS24243 293 97.7576 0 0 KQK14069 1603 1345.15 617.12 33.6048 KQK14071 474 238.641 8.35048 2.56312 ==> SRR7473359.se.tsv <== BRADI_1g14170v3 686 BRADI_1g53295v3 1766 BRADI_1g59795v3 715 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 696 BRADI_1g74790v3 83 BRADI_1g09890v3 6 BRADI_1g77505v3 204 BRADI_1g48960v3 0 SRR7473359 completed mapping pipeline successfully