Starting /dee2/code/volunteer_pipeline.sh SRR7473360 current disk space = 1542841139200 free memory = 1597338188 SRR7473360 SRAfilesize ab566ba92c8f4221854d948a0ccac37e SRR7473360.sra SRR7473360.sra file validated SRR7473360 is paired end SRR7473360 is conventional basespace SRR7473360 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473360_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29725 34.0 33.0 34.0 33.0 34.0 2 33.392 34.0 34.0 34.0 33.0 34.0 3 33.43625 34.0 34.0 34.0 33.0 34.0 4 33.41 34.0 34.0 34.0 33.0 34.0 5 33.358 34.0 34.0 34.0 33.0 34.0 6 37.081 38.0 38.0 38.0 36.0 38.0 7 37.42175 38.0 38.0 38.0 37.0 38.0 8 37.469 38.0 38.0 38.0 37.0 38.0 9 37.5195 38.0 38.0 38.0 38.0 38.0 10-14 37.4524 38.0 38.0 38.0 37.6 38.0 15-19 37.3895 38.0 38.0 38.0 37.0 38.0 20-24 37.4593 38.0 38.0 38.0 37.6 38.0 25-29 37.39065 38.0 38.0 38.0 37.0 38.0 30-34 37.1618 38.0 38.0 38.0 36.8 38.0 35-39 37.07 38.0 38.0 38.0 36.0 38.0 40-44 36.906349999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.823600000000006 38.0 38.0 38.0 35.0 38.0 50-54 36.855599999999995 38.0 38.0 38.0 35.2 38.0 55-59 36.8856 38.0 38.0 38.0 35.0 38.0 60-64 36.82875 38.0 38.0 38.0 35.2 38.0 65-69 36.61749999999999 38.0 38.0 38.0 34.4 38.0 70-74 36.4381 38.0 38.0 38.0 34.0 38.0 75-79 36.5109 38.0 38.0 38.0 34.0 38.0 80-84 36.422200000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.19405 38.0 37.6 38.0 33.4 38.0 90-94 35.9231 38.0 37.0 38.0 33.0 38.0 95-99 35.614200000000004 38.0 36.8 38.0 30.6 38.0 100-104 35.55145 38.0 36.4 38.0 30.8 38.0 105-109 35.34910000000001 38.0 36.0 38.0 29.8 38.0 110-114 35.1903 38.0 35.8 38.0 29.0 38.0 115-119 34.83525 38.0 35.2 38.0 27.6 38.0 120-124 34.49065 38.0 35.0 38.0 25.8 38.0 125-129 34.125 38.0 34.8 38.0 23.4 38.0 130-134 33.55095 38.0 34.0 38.0 21.0 38.0 135-139 33.06 38.0 33.6 38.0 16.2 38.0 140-144 32.0938 37.6 32.2 38.0 13.6 38.0 145-149 31.032400000000003 36.0 31.4 38.0 8.6 38.0 150-151 26.07775 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 0.0 13 1.0 14 2.0 15 3.0 16 6.0 17 5.0 18 7.0 19 14.0 20 8.0 21 8.0 22 8.0 23 16.0 24 22.0 25 18.0 26 24.0 27 37.0 28 41.0 29 52.0 30 58.0 31 81.0 32 95.0 33 152.0 34 214.0 35 375.0 36 846.0 37 1902.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.64156626506024 14.181726907630521 10.291164658634539 33.8855421686747 2 25.724999999999998 17.9 32.525 23.849999999999998 3 21.675 22.75 27.275 28.299999999999997 4 23.9 29.2 22.7 24.2 5 24.2728184553661 33.324974924774324 22.793380140421263 19.608826479438317 6 22.475 32.975 23.525 21.025 7 17.65 21.125 40.675 20.549999999999997 8 20.150000000000002 21.45 28.849999999999998 29.549999999999997 9 18.95 21.725 32.074999999999996 27.250000000000004 10-14 22.43 25.69 25.025 26.855 15-19 22.41 25.72 26.105 25.765 20-24 22.255 25.25 25.865 26.63 25-29 22.84 25.485000000000003 25.695 25.979999999999997 30-34 22.085 25.835 25.845000000000002 26.235000000000003 35-39 22.29337602561537 25.425255153091854 25.94056433860316 26.340804482689613 40-44 22.759999999999998 25.55 25.669999999999998 26.02 45-49 22.84 25.2 25.285000000000004 26.674999999999997 50-54 22.765 25.585 25.705 25.945 55-59 23.0 24.86 26.02 26.119999999999997 60-64 22.105 25.34 25.605 26.950000000000003 65-69 22.005 25.96 25.924999999999997 26.11 70-74 22.795 25.669999999999998 25.295 26.240000000000002 75-79 22.645 26.169999999999998 25.285000000000004 25.900000000000002 80-84 22.945 25.455 25.575 26.025 85-89 22.86 25.15 26.064999999999998 25.924999999999997 90-94 23.415 25.715 25.05 25.82 95-99 22.65585910137096 25.412788952266585 25.98819173421395 25.943160212148502 100-104 23.43 25.765 25.45 25.355 105-109 23.94 25.580000000000002 24.395 26.085 110-114 23.400000000000002 25.27 25.395 25.935000000000002 115-119 23.615 24.725 25.185000000000002 26.474999999999998 120-124 22.71 25.669999999999998 25.019999999999996 26.6 125-129 23.794999999999998 25.39 24.985 25.83 130-134 23.003964470316657 26.00993626737592 24.840668439805288 26.14543082250213 135-139 23.398817279743408 25.51368146737496 25.238047509271322 25.8494537436103 140-144 23.52 25.255 24.735 26.490000000000002 145-149 23.30646372603014 25.869924397937215 24.943673959845793 25.87993791618685 150-151 24.010088272383353 25.334174022698612 24.640605296343 26.01513240857503 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 2.0 27 1.5 28 4.0 29 8.5 30 9.0 31 8.5 32 14.0 33 21.5 34 27.0 35 38.5 36 53.5 37 63.0 38 84.5 39 111.5 40 128.5 41 149.5 42 157.5 43 150.5 44 185.0 45 207.5 46 193.5 47 197.5 48 197.5 49 181.0 50 164.0 51 164.5 52 161.0 53 148.5 54 139.0 55 119.5 56 100.5 57 94.5 58 95.0 59 85.5 60 64.5 61 66.0 62 64.0 63 47.0 64 37.5 65 40.0 66 40.5 67 35.0 68 34.5 69 29.0 70 19.0 71 12.0 72 11.5 73 7.0 74 5.0 75 5.5 76 5.0 77 3.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.06 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.06999999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.365 135-139 0.22999999999999998 140-144 0.0 145-149 0.135 150-151 0.8750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16434540389972 97.89999999999999 2 0.6330716637123323 1.25 3 0.10129146619397315 0.3 4 0.07596859964547988 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02532286654849329 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 10 0.25 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.4125 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.4375 0.0 0.0 0.0 0.0 138-139 6.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATAG 10 0.006597606 146.67088 3 >>END_MODULE SRR7473360 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473360_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88425 33.0 33.0 34.0 31.0 34.0 2 32.23825 33.0 33.0 34.0 32.0 34.0 3 32.13425 34.0 33.0 34.0 32.0 34.0 4 32.09925 34.0 33.0 34.0 32.0 34.0 5 32.16125 34.0 33.0 34.0 32.0 34.0 6 36.4635 38.0 38.0 38.0 35.0 38.0 7 36.59975 38.0 38.0 38.0 36.0 38.0 8 36.71675 38.0 38.0 38.0 35.0 38.0 9 36.83875 38.0 38.0 38.0 36.0 38.0 10-14 36.926249999999996 38.0 38.0 38.0 36.8 38.0 15-19 36.705650000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.322100000000006 38.0 38.0 38.0 35.0 38.0 25-29 36.500350000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.53545 38.0 38.0 38.0 36.0 38.0 35-39 36.48355 38.0 38.0 38.0 36.0 38.0 40-44 36.57875 38.0 38.0 38.0 36.0 38.0 45-49 36.3977 38.0 38.0 38.0 35.6 38.0 50-54 36.3625 38.0 38.0 38.0 35.2 38.0 55-59 36.4436 38.0 38.0 38.0 35.6 38.0 60-64 36.204950000000004 38.0 38.0 38.0 34.4 38.0 65-69 35.95275 38.0 38.0 38.0 33.8 38.0 70-74 36.0777 38.0 38.0 38.0 34.0 38.0 75-79 36.05135 38.0 38.0 38.0 34.0 38.0 80-84 35.95354999999999 38.0 38.0 38.0 34.0 38.0 85-89 35.77465 38.0 38.0 38.0 33.0 38.0 90-94 35.535000000000004 38.0 38.0 38.0 32.2 38.0 95-99 35.171200000000006 38.0 38.0 38.0 30.0 38.0 100-104 34.65650000000001 38.0 37.0 38.0 26.4 38.0 105-109 34.58855 38.0 36.4 38.0 26.6 38.0 110-114 34.3094 38.0 36.2 38.0 23.8 38.0 115-119 33.917500000000004 38.0 35.2 38.0 21.8 38.0 120-124 33.8408 38.0 35.2 38.0 21.8 38.0 125-129 33.5224 38.0 35.0 38.0 18.4 38.0 130-134 32.81385 38.0 33.8 38.0 14.2 38.0 135-139 32.3701 38.0 33.4 38.0 13.2 38.0 140-144 31.7529 38.0 32.0 38.0 10.8 38.0 145-149 30.56755 38.0 30.6 38.0 2.0 38.0 150-151 24.9625 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 14.0 4 22.0 5 2.0 6 3.0 7 5.0 8 1.0 9 4.0 10 3.0 11 2.0 12 6.0 13 5.0 14 7.0 15 9.0 16 7.0 17 20.0 18 14.0 19 11.0 20 20.0 21 18.0 22 15.0 23 26.0 24 29.0 25 22.0 26 24.0 27 27.0 28 39.0 29 36.0 30 56.0 31 65.0 32 78.0 33 103.0 34 181.0 35 275.0 36 644.0 37 2192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.949588477366255 19.032921810699587 11.419753086419753 27.5977366255144 2 31.32008154943935 22.50254841997961 25.739041794087665 20.438328236493376 3 23.74872318692543 25.408580183861083 27.911133810010213 22.93156281920327 4 27.019427402862984 32.02965235173824 19.683026584867076 21.267893660531698 5 27.170582226762 33.27374872318693 20.199182839632275 19.356486210418794 6 22.812341932220537 34.19322205361659 20.890237733940314 22.10419828022256 7 22.457200402819737 17.799597180261834 36.278952668680766 23.464249748237663 8 24.30538172715895 21.70212765957447 24.130162703379224 29.86232790988736 9 24.625 21.825 26.325 27.224999999999998 10-14 26.13 24.815 23.415 25.64 15-19 25.71643663739021 24.617314930991217 24.8732747804266 24.79297365119197 20-24 26.48996553821204 25.785526049057367 24.08777620109467 23.636732211635923 25-29 25.805313303422896 25.855724151837478 24.17200181479054 24.166960729949086 30-34 26.842263999195737 25.605710264401328 23.881572333366844 23.670453403036092 35-39 26.341537220092796 25.484163808755294 24.112366350615293 24.061932620536613 40-44 26.25325847202727 25.67174654100662 24.30318828955284 23.771806697413275 45-49 25.867985466289866 25.398667743237784 23.849414614452968 24.88393217601938 50-54 25.86519114688129 25.482897384305836 24.969818913480886 23.682092555331995 55-59 26.074756989678328 25.423389117146005 24.967431606373385 23.534422286802283 60-64 25.4991701453503 25.63999396469346 25.001257355529848 23.859578534426397 65-69 26.650478069509788 25.33009561390196 24.480194263165885 23.53923205342237 70-74 26.333785890280083 25.609694775481472 24.568813797958466 23.487705536279982 75-79 25.96679540552741 25.179314841751516 24.557355670361638 24.296534082359432 80-84 26.043129388164495 25.566700100300903 24.538615847542626 23.851554663991976 85-89 27.00751879699248 25.44862155388471 24.30576441102757 23.238095238095237 90-94 25.90913669789463 25.33494509922434 24.74564319532588 24.01027500755515 95-99 26.81464926093361 25.697160562807948 24.5695128765175 22.918677299740946 100-104 26.839118654465516 25.172537191350138 24.732886866724606 23.25545728745974 105-109 26.58944790284723 25.798550872538012 24.37493621798143 23.23706500663333 110-114 26.21324469445155 25.44106366658144 24.259780107389414 24.085911531577604 115-119 26.237649106640042 26.28884451953105 24.84513387600471 22.628372497824195 120-124 26.938379922464804 25.969189961232402 24.40828402366864 22.684146092634155 125-129 27.23376026942899 26.00398020105118 24.27412359034546 22.488135939174363 130-134 26.952385823147345 25.868153224569117 24.604919961131284 22.574540991152254 135-139 27.864609763523802 26.35237998579113 23.81508170100477 21.967928549680302 140-144 27.680242853528963 25.782949658487226 24.8773083733873 21.65949911459651 145-149 27.14844742592875 26.497941759414545 23.94673984855415 22.406870966102556 150-151 28.523533204384265 25.77691811734365 24.61637653127015 21.08317214700193 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.0 8 0.5 9 2.0 10 1.5 11 1.5 12 3.0 13 2.5 14 1.0 15 0.0 16 0.5 17 2.0 18 3.0 19 1.5 20 1.5 21 2.0 22 1.5 23 1.5 24 2.0 25 3.5 26 2.5 27 3.0 28 4.5 29 7.0 30 10.0 31 9.5 32 10.5 33 15.0 34 23.0 35 35.5 36 38.5 37 47.5 38 61.5 39 78.0 40 103.0 41 118.0 42 135.5 43 157.5 44 167.0 45 174.0 46 200.0 47 202.0 48 185.5 49 179.5 50 156.5 51 145.5 52 149.0 53 151.0 54 144.5 55 135.0 56 123.5 57 110.5 58 103.5 59 98.5 60 94.0 61 80.0 62 77.0 63 66.5 64 53.5 65 52.0 66 52.5 67 45.0 68 30.5 69 26.5 70 27.0 71 20.0 72 12.0 73 13.5 74 10.0 75 4.5 76 4.5 77 3.5 78 1.5 79 1.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 1.9 3 2.1 4 2.1999999999999997 5 2.1 6 1.15 7 0.7000000000000001 8 0.125 9 0.0 10-14 0.0 15-19 0.375 20-24 1.34 25-29 0.815 30-34 0.53 35-39 0.86 40-44 0.26 45-49 0.9199999999999999 50-54 0.6 55-59 0.21 60-64 0.585 65-69 1.165 70-74 0.565 75-79 0.315 80-84 0.3 85-89 0.25 90-94 0.73 95-99 1.5650000000000002 100-104 2.1950000000000003 105-109 2.01 110-114 2.225 115-119 2.335 120-124 1.9800000000000002 125-129 2.015 130-134 2.235 135-139 1.47 140-144 1.175 145-149 1.6150000000000002 150-151 3.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80437547697787 97.1 2 0.8903586873569066 1.7500000000000002 3 0.22894937674891885 0.675 4 0.02543881963876876 0.1 5 0.02543881963876876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02543881963876876 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.4749999999999996 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.8499999999999996 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.112500000000001 0.0 0.0 0.0 0.0 128-129 4.5125 0.0 0.0 0.0 0.0 130-131 4.925000000000001 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.8625 0.0 0.0 0.0 0.0 136-137 6.3875 0.0 0.0 0.0 0.0 138-139 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTGG 10 0.00636923 148.38461 4 GGTATCG 10 0.00636923 148.38461 3 CCGGTAT 10 0.00636923 148.38461 1 >>END_MODULE Read 1069499 spots for SRR7473360.sra Written 1069499 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra Read 1069493 spots for SRR7473360.sra Written 1069493 spots for SRR7473360.sra SRR ids: ['SRR7473360.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f47l_zds SRR7473360.sra spots: 21389866 blocks: [[1, 1069493], [1069494, 2138986], [2138987, 3208479], [3208480, 4277972], [4277973, 5347465], [5347466, 6416958], [6416959, 7486451], [7486452, 8555944], [8555945, 9625437], [9625438, 10694930], [10694931, 11764423], [11764424, 12833916], [12833917, 13903409], [13903410, 14972902], [14972903, 16042395], [16042396, 17111888], [17111889, 18181381], [18181382, 19250874], [19250875, 20320367], [20320368, 21389866]] SRR7473360 file size 7226623 SRR7473360 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473360 SRR7473360_1.fastq SRR7473360_2.fastq Input file: SRR7473360_1.fastq Paired file: SRR7473360_2.fastq trimmed: SRR7473360-trimmed-pair1.fastq, SRR7473360-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:19:56 2024 >> started Sat Dec 7 15:20:21 2024 >> done (25.418s) 21389866 read pairs processed; of these: 47528 ( 0.22%) short read pairs filtered out after trimming by size control 93457 ( 0.44%) empty read pairs filtered out after trimming by size control 21248881 (99.34%) read pairs available; of these: 12285992 (57.82%) trimmed read pairs available after processing 8962889 (42.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 26 0.00% 20 29 0.00% 21 21 0.00% 22 35 0.00% 23 30 0.00% 24 22 0.00% 25 21 0.00% 26 36 0.00% 27 26 0.00% 28 33 0.00% 29 33 0.00% 30 47 0.00% 31 41 0.00% 32 45 0.00% 33 45 0.00% 34 49 0.00% 35 38 0.00% 36 56 0.00% 37 54 0.00% 38 80 0.00% 39 86 0.00% 40 93 0.00% 41 93 0.00% 42 106 0.00% 43 95 0.00% 44 104 0.00% 45 132 0.00% 46 129 0.00% 47 166 0.00% 48 177 0.00% 49 209 0.00% 50 227 0.00% 51 244 0.00% 52 296 0.00% 53 324 0.00% 54 298 0.00% 55 352 0.00% 56 390 0.00% 57 436 0.00% 58 502 0.00% 59 550 0.00% 60 606 0.00% 61 732 0.00% 62 879 0.00% 63 898 0.00% 64 988 0.00% 65 1167 0.01% 66 1342 0.01% 67 1818 0.01% 68 2231 0.01% 69 5126 0.02% 70 5747 0.03% 71 3259 0.02% 72 2788 0.01% 73 2967 0.01% 74 3016 0.01% 75 3290 0.02% 76 3547 0.02% 77 3813 0.02% 78 4188 0.02% 79 4713 0.02% 80 5316 0.03% 81 6108 0.03% 82 7005 0.03% 83 8120 0.04% 84 10598 0.05% 85 11366 0.05% 86 11730 0.06% 87 12169 0.06% 88 12746 0.06% 89 13291 0.06% 90 14510 0.07% 91 15755 0.07% 92 16751 0.08% 93 18725 0.09% 94 19905 0.09% 95 20797 0.10% 96 21251 0.10% 97 21088 0.10% 98 21773 0.10% 99 22986 0.11% 100 24697 0.12% 101 25127 0.12% 102 26975 0.13% 103 28805 0.14% 104 30618 0.14% 105 33073 0.16% 106 33002 0.16% 107 33378 0.16% 108 34931 0.16% 109 37089 0.17% 110 37741 0.18% 111 38225 0.18% 112 40366 0.19% 113 44414 0.21% 114 45140 0.21% 115 48070 0.23% 116 49212 0.23% 117 49145 0.23% 118 50773 0.24% 119 51487 0.24% 120 53412 0.25% 121 55476 0.26% 122 59096 0.28% 123 61545 0.29% 124 66308 0.31% 125 67495 0.32% 126 69303 0.33% 127 71453 0.34% 128 72419 0.34% 129 75677 0.36% 130 78540 0.37% 131 81368 0.38% 132 86814 0.41% 133 91362 0.43% 134 97122 0.46% 135 103928 0.49% 136 109312 0.51% 137 116053 0.55% 138 123205 0.58% 139 130927 0.62% 140 140357 0.66% 141 154550 0.73% 142 173328 0.82% 143 196257 0.92% 144 229457 1.08% 145 278198 1.31% 146 347810 1.64% 147 470810 2.22% 148 721604 3.40% 149 1342949 6.32% 150 5446691 25.63% 151 8962889 42.18% 21248881 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=24.22 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.0 sequence=AACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=24 prefix-density=0.53 prefix-fanout=2.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=115.53 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.0 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGT SRR7473360 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:21:18 Started mapping on | Dec 07 15:21:19 Finished on | Dec 07 15:30:34 Mapping speed, Million of reads per hour | 137.83 Number of input reads | 21248881 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18901025 Uniquely mapped reads % | 88.95% Average mapped length | 292.16 Number of splices: Total | 20387524 Number of splices: Annotated (sjdb) | 19195643 Number of splices: GT/AG | 20140196 Number of splices: GC/AG | 218859 Number of splices: AT/AC | 8364 Number of splices: Non-canonical | 20105 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 191506 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 20747 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.25% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2180854 2180854 2180854 N_multimapping 191506 191506 191506 N_noFeature 636464 18233378 922184 N_ambiguous 443323 2894 62142 UnstrandedReadsAssigned:17821238 PositiveStrandReadsAssigned:664753 NegativeStrandReadsAssigned:17916699 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473360 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473360-trimmed-pair1.fastq SRR7473360-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,248,881 reads, 18,007,308 reads pseudoaligned [quant] estimated average fragment length: 274.382 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 SRR7473360.ke.tsv 35125 SRR7473360.se.tsv 88098 total ==> SRR7473360.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.605 97.0772 11.2818 PNS24247 1044 770.618 39.9853 4.00157 PNS24249 1928 1654.62 85.6784 3.9934 PNS24246 1044 770.618 39.9853 4.00157 PNS24248 1044 770.618 39.9853 4.00157 PNS24244 1471 1197.62 159.289 10.2574 PNS24243 293 93.6058 0 0 KQK14069 1603 1329.62 1075.25 62.3668 KQK14071 474 228.852 5.79521 1.95292 ==> SRR7473360.se.tsv <== BRADI_1g14170v3 1141 BRADI_1g53295v3 165 BRADI_1g59795v3 117 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 1124 BRADI_1g74790v3 858 BRADI_1g09890v3 2 BRADI_1g77505v3 152 BRADI_1g48960v3 1 SRR7473360 completed mapping pipeline successfully