Starting /dee2/code/volunteer_pipeline.sh SRR7473361 current disk space = 1542866706432 free memory = 1601092376 SRR7473361 SRAfilesize 3549d75a249a3826c6cecb4dd3327c99 SRR7473361.sra SRR7473361.sra file validated SRR7473361 is paired end SRR7473361 is conventional basespace SRR7473361 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10875 34.0 33.0 34.0 33.0 34.0 2 33.31525 34.0 34.0 34.0 33.0 34.0 3 33.386 34.0 34.0 34.0 33.0 34.0 4 33.42125 34.0 34.0 34.0 33.0 34.0 5 33.3245 34.0 34.0 34.0 33.0 34.0 6 37.02175 38.0 37.0 38.0 36.0 38.0 7 37.42375 38.0 38.0 38.0 37.0 38.0 8 37.51275 38.0 38.0 38.0 37.0 38.0 9 37.516 38.0 38.0 38.0 37.0 38.0 10-14 37.51845 38.0 38.0 38.0 38.0 38.0 15-19 37.47005 38.0 38.0 38.0 37.8 38.0 20-24 37.51135000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.29915 38.0 38.0 38.0 37.0 38.0 30-34 37.1957 38.0 38.0 38.0 37.0 38.0 35-39 37.17695 38.0 38.0 38.0 36.4 38.0 40-44 36.9325 38.0 38.0 38.0 35.6 38.0 45-49 36.95295 38.0 38.0 38.0 36.0 38.0 50-54 36.880849999999995 38.0 38.0 38.0 35.2 38.0 55-59 37.013549999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.86035 38.0 38.0 38.0 35.2 38.0 65-69 36.717349999999996 38.0 38.0 38.0 34.6 38.0 70-74 36.5652 38.0 38.0 38.0 34.0 38.0 75-79 36.56705 38.0 38.0 38.0 34.0 38.0 80-84 36.4935 38.0 38.0 38.0 34.0 38.0 85-89 36.24785000000001 38.0 38.0 38.0 33.8 38.0 90-94 36.0542 38.0 37.4 38.0 33.2 38.0 95-99 35.869049999999994 38.0 37.0 38.0 32.8 38.0 100-104 35.70270000000001 38.0 36.8 38.0 31.0 38.0 105-109 35.44305 38.0 36.0 38.0 30.2 38.0 110-114 35.27885 38.0 36.0 38.0 29.2 38.0 115-119 34.80395 38.0 35.2 38.0 27.4 38.0 120-124 34.5058 38.0 35.0 38.0 26.0 38.0 125-129 33.87795 38.0 34.4 38.0 22.2 38.0 130-134 33.685750000000006 38.0 34.0 38.0 22.2 38.0 135-139 32.9673 38.0 33.8 38.0 14.8 38.0 140-144 32.425 38.0 33.0 38.0 13.8 38.0 145-149 30.6055 36.4 30.4 38.0 6.4 38.0 150-151 25.80275 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 2.0 14 2.0 15 1.0 16 3.0 17 5.0 18 13.0 19 8.0 20 7.0 21 13.0 22 13.0 23 15.0 24 11.0 25 21.0 26 32.0 27 28.0 28 51.0 29 44.0 30 63.0 31 74.0 32 100.0 33 119.0 34 215.0 35 361.0 36 912.0 37 1884.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.24291497975709 12.904858299595142 8.552631578947368 33.29959514170041 2 26.36067218459995 15.475294707800352 30.42387760220717 27.74015550539253 3 23.225 22.125 24.95 29.7 4 26.1 27.400000000000002 22.575 23.925 5 26.272248683880672 31.135622963148656 21.38380546502883 21.20832288794184 6 23.200000000000003 32.15 23.075000000000003 21.575 7 18.325 21.675 40.425 19.575 8 21.2 21.75 28.325 28.725 9 20.3 21.25 31.4 27.05 10-14 23.32 26.26 24.27 26.150000000000002 15-19 23.13 25.27 25.735000000000003 25.865 20-24 23.400000000000002 25.185000000000002 25.009999999999998 26.405 25-29 23.044999999999998 25.2 25.535000000000004 26.22 30-34 23.294999999999998 25.2 25.345000000000002 26.16 35-39 23.777133139941984 24.74742422726818 24.81744523357007 26.657997399219767 40-44 23.51498773957864 24.741029875394087 25.856978431666917 25.887003953360356 45-49 23.56060227102196 25.136311340103045 24.801160522235005 26.501925866639986 50-54 23.496174808740435 25.26626331316566 24.671233561678083 26.56632831641582 55-59 23.685000000000002 24.965 24.83 26.52 60-64 23.75 24.79 25.025 26.435 65-69 23.305 25.03 25.014999999999997 26.650000000000002 70-74 23.54 25.124999999999996 25.064999999999998 26.27 75-79 23.49352402860429 25.558833825073762 24.273641046156925 26.67400110016502 80-84 23.75975195039008 25.20504100820164 24.69493898779756 26.34026805361072 85-89 23.80476095219044 24.6749349869974 25.545109021804365 25.975195039007804 90-94 23.935345043286794 24.726017114547368 25.251463744182555 26.087174097983283 95-99 24.255788313120178 24.47128395309211 24.581537536333567 26.691390197454147 100-104 23.865 24.41 25.765 25.96 105-109 23.941197059852993 24.691234561728088 24.996249812490625 26.3713185659283 110-114 23.866193309665483 24.666233311665582 24.40622031101555 27.061353067653382 115-119 24.13 24.785 24.759999999999998 26.325 120-124 24.24591065979691 25.06627982592167 24.295933169926467 26.39187634435496 125-129 24.942332765018556 24.756794704643468 23.839133487112626 26.46173904322535 130-134 24.054272167860386 25.45647130031272 24.513265409058814 25.975991122768082 135-139 24.07519403285959 24.805967140409233 24.679971777038606 26.438867049692572 140-144 24.683195592286502 24.703230653643875 24.117205108940645 26.496368645128975 145-149 24.70890669892636 24.829880538333583 24.225011341297446 26.236201421442612 150-151 24.45707070707071 25.303030303030305 24.179292929292927 26.060606060606062 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.0 26 2.0 27 1.5 28 2.5 29 3.0 30 5.0 31 9.0 32 15.0 33 25.5 34 29.0 35 33.5 36 48.0 37 57.0 38 69.0 39 89.0 40 109.5 41 140.5 42 153.5 43 161.5 44 171.5 45 173.5 46 184.0 47 184.0 48 166.0 49 141.5 50 142.5 51 146.0 52 146.0 53 148.5 54 137.5 55 130.5 56 132.5 57 116.0 58 97.0 59 105.0 60 99.0 61 77.5 62 68.0 63 65.5 64 68.5 65 67.5 66 50.0 67 44.5 68 45.0 69 30.0 70 23.0 71 21.0 72 15.5 73 12.0 74 10.0 75 6.0 76 4.0 77 3.5 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.325 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.08499999999999999 45-49 0.045 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.02 85-89 0.02 90-94 0.08499999999999999 95-99 0.22999999999999998 100-104 0.0 105-109 0.005 110-114 0.005 115-119 0.0 120-124 0.045 125-129 0.29 130-134 0.8699999999999999 135-139 0.79 140-144 0.17500000000000002 145-149 0.8049999999999999 150-151 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15856777493606 95.95 2 1.6112531969309463 3.15 3 0.1534526854219949 0.44999999999999996 4 0.051150895140664954 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025575447570332477 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 10 0.25 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.1749999999999998 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.4124999999999996 0.0 0.0 0.0 0.0 118-119 3.7874999999999996 0.0 0.0 0.0 0.0 120-121 4.324999999999999 0.0 0.0 0.0 0.0 122-123 4.762499999999999 0.0 0.0 0.0 0.0 124-125 5.2375 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 7.9875 0.0 0.0 0.0 0.0 138-139 8.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATAAC 10 0.006606125 146.6076 1 >>END_MODULE SRR7473361 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473361_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.015 33.0 33.0 34.0 32.0 34.0 2 32.25625 33.0 33.0 34.0 32.0 34.0 3 32.183 34.0 33.0 34.0 32.0 34.0 4 32.172 34.0 33.0 34.0 32.0 34.0 5 32.04625 34.0 33.0 34.0 32.0 34.0 6 36.0905 38.0 38.0 38.0 34.0 38.0 7 36.40225 38.0 38.0 38.0 35.0 38.0 8 36.44575 38.0 38.0 38.0 34.0 38.0 9 36.598 38.0 38.0 38.0 35.0 38.0 10-14 36.6846 38.0 38.0 38.0 36.0 38.0 15-19 36.43605 38.0 38.0 38.0 35.8 38.0 20-24 36.0637 38.0 38.0 38.0 34.4 38.0 25-29 36.26855 38.0 38.0 38.0 35.0 38.0 30-34 36.3387 38.0 38.0 38.0 35.8 38.0 35-39 36.29015 38.0 38.0 38.0 35.4 38.0 40-44 36.287549999999996 38.0 38.0 38.0 35.2 38.0 45-49 36.1472 38.0 38.0 38.0 34.6 38.0 50-54 36.2545 38.0 38.0 38.0 35.0 38.0 55-59 36.1011 38.0 38.0 38.0 34.2 38.0 60-64 36.0499 38.0 38.0 38.0 34.0 38.0 65-69 35.6627 38.0 38.0 38.0 33.0 38.0 70-74 35.7685 38.0 38.0 38.0 33.2 38.0 75-79 35.66865 38.0 38.0 38.0 33.0 38.0 80-84 35.654849999999996 38.0 38.0 38.0 33.0 38.0 85-89 35.422399999999996 38.0 38.0 38.0 31.0 38.0 90-94 35.25805 38.0 37.8 38.0 30.6 38.0 95-99 34.8148 38.0 37.2 38.0 28.2 38.0 100-104 34.1563 38.0 36.2 38.0 23.2 38.0 105-109 34.090500000000006 38.0 36.0 38.0 22.8 38.0 110-114 33.7482 38.0 35.2 38.0 17.4 38.0 115-119 33.3966 38.0 35.0 38.0 16.2 38.0 120-124 33.21130000000001 38.0 34.8 38.0 14.6 38.0 125-129 32.86195 38.0 34.4 38.0 14.0 38.0 130-134 32.1628 38.0 32.8 38.0 13.0 38.0 135-139 31.65675 38.0 31.6 38.0 13.0 38.0 140-144 30.97615 38.0 30.8 38.0 2.0 38.0 145-149 29.600150000000003 37.0 28.8 38.0 2.0 38.0 150-151 23.500625 30.5 7.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 27.0 4 15.0 5 2.0 6 1.0 7 3.0 8 1.0 9 2.0 10 2.0 11 3.0 12 10.0 13 8.0 14 12.0 15 8.0 16 15.0 17 15.0 18 10.0 19 14.0 20 17.0 21 9.0 22 15.0 23 29.0 24 39.0 25 36.0 26 21.0 27 35.0 28 23.0 29 59.0 30 56.0 31 73.0 32 77.0 33 131.0 34 161.0 35 320.0 36 715.0 37 2001.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.45298488342301 16.551370740456058 11.81142710735332 27.184217268767615 2 32.9936305732484 20.73885350318471 25.248407643312103 21.019108280254777 3 23.82172131147541 25.28176229508197 27.86885245901639 23.02766393442623 4 27.613462519122894 30.69862315145334 18.154003059663438 23.533911269760328 5 27.344951307022043 32.3167606355715 18.195797027165554 22.1424910302409 6 24.418307338276655 34.85042188698543 18.869854257223217 21.861416517514705 7 22.360091162319577 18.63762977969106 34.69232717143581 24.309951886553556 8 24.38901486520534 22.22222222222222 23.733938019652307 29.65482489292013 9 25.882352941176475 22.453066332916144 24.055068836045056 27.609511889862326 10-14 26.574092640866255 24.884700220573492 22.668939242029275 25.872267896530982 15-19 26.37695805962607 24.810510358767054 23.83021728145528 24.982314300151593 20-24 26.83337586118908 25.07782597601429 23.465169686144424 24.623628476652208 25-29 26.273594479399225 25.07611122386848 23.67566470468845 24.97462959204384 30-34 26.529888551165147 25.303951367781153 23.08004052684904 25.08611955420466 35-39 26.194097961667172 24.743940776797483 23.922523070682487 25.139438190852854 40-44 26.335781210433023 24.320081033172954 24.006077487971638 25.338060268422385 45-49 26.778178860135238 24.739437693832937 23.66668361380853 24.815699832223295 50-54 26.21035058430718 25.072089846714217 23.949005918955834 24.768553650022763 55-59 26.719335561632736 24.703737465815863 23.53388027955029 25.043046693001113 60-64 26.455214412585637 24.445572189799545 23.97361075869069 25.125602638924132 65-69 26.730041909434732 24.941224573239293 23.975263211693754 24.353470305632218 70-74 26.84805188225161 24.684602523179812 24.081674013274558 24.385671581294016 75-79 26.268143427906743 24.670004551661357 23.557376220098114 25.504475800333786 80-84 27.051579691127486 24.664378722115675 23.725648531341477 24.55839305541536 85-89 26.556518234938547 25.241789240378804 23.66512190207536 24.536570622607293 90-94 26.694357207982982 24.865768412521525 24.207273832438457 24.232600547057036 95-99 27.056654031349247 25.217703104190143 23.64511832804016 24.08052453642045 100-104 27.069617956560055 24.99092841221295 23.92307293556581 24.016380695661187 105-109 27.216761510605274 24.743921365752716 23.869632695292292 24.169684428349715 110-114 27.244998190559894 25.099519205914284 23.72434472418963 23.931137879336195 115-119 27.75423728813559 24.27139313766019 24.209384042992973 23.764985531211245 120-124 27.29523416546317 25.479678151433877 23.74148958118424 23.483598101918712 125-129 27.486045069257802 25.149886293156914 23.738887740334917 23.62518089725036 130-134 28.11838231496307 25.01936883425443 23.867568823924383 22.994680026858116 135-139 27.805626598465473 25.585677749360613 23.805626598465473 22.80306905370844 140-144 27.74874474843734 25.458551081053386 23.76268060252075 23.030023567988522 145-149 28.18667763157895 25.128495065789476 23.961759868421055 22.723067434210524 150-151 28.41131239410921 25.452886745731785 23.32855467222729 22.80724618793171 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 3.5 2 4.0 3 5.0 4 6.0 5 6.0 6 3.5 7 0.5 8 2.0 9 2.5 10 1.5 11 2.0 12 1.0 13 0.5 14 1.5 15 2.5 16 2.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.5 23 3.0 24 2.0 25 2.0 26 3.0 27 3.5 28 4.0 29 3.5 30 6.5 31 11.5 32 13.0 33 13.0 34 16.5 35 24.5 36 30.5 37 37.5 38 57.0 39 70.5 40 90.5 41 117.0 42 125.5 43 142.5 44 152.0 45 153.5 46 161.0 47 168.5 48 162.5 49 145.0 50 151.5 51 154.5 52 139.5 53 143.0 54 153.5 55 137.5 56 120.0 57 115.0 58 115.0 59 113.0 60 99.0 61 96.0 62 97.0 63 87.5 64 80.5 65 72.5 66 60.5 67 50.5 68 45.5 69 51.5 70 49.5 71 37.0 72 24.0 73 12.5 74 8.0 75 6.0 76 5.0 77 2.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 1.875 3 2.4 4 1.95 5 2.45 6 2.225 7 1.275 8 0.775 9 0.125 10-14 0.26 15-19 1.05 20-24 2.025 25-29 1.46 30-34 1.3 35-39 1.39 40-44 1.275 45-49 1.6549999999999998 50-54 1.165 55-59 1.27 60-64 1.4749999999999999 65-69 2.17 70-74 1.315 75-79 1.135 80-84 0.9299999999999999 85-89 0.74 90-94 1.29 95-99 2.39 100-104 3.5450000000000004 105-109 3.35 110-114 3.2849999999999997 115-119 3.2399999999999998 120-124 3.06 125-129 3.26 130-134 3.195 135-139 2.25 140-144 2.41 145-149 2.7199999999999998 150-151 4.0875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.231222763394 95.8 2 1.384260446039477 2.7 3 0.20507562163547807 0.6 4 0.12817226352217378 0.5 5 0.0 0.0 6 0.02563445270443476 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02563445270443476 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.65 0.0 0.0 0.0 0.0 114-115 2.9625 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 4.05 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.8875 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.525 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.6375 0.0 0.0 0.0 0.0 138-139 8.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257639 spots for SRR7473361.sra Written 1257639 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra Read 1257622 spots for SRR7473361.sra Written 1257622 spots for SRR7473361.sra SRR ids: ['SRR7473361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tgjqmwfl SRR7473361.sra spots: 25152457 blocks: [[1, 1257622], [1257623, 2515244], [2515245, 3772866], [3772867, 5030488], [5030489, 6288110], [6288111, 7545732], [7545733, 8803354], [8803355, 10060976], [10060977, 11318598], [11318599, 12576220], [12576221, 13833842], [13833843, 15091464], [15091465, 16349086], [16349087, 17606708], [17606709, 18864330], [18864331, 20121952], [20121953, 21379574], [21379575, 22637196], [22637197, 23894818], [23894819, 25152457]] SRR7473361 file size 8501641 SRR7473361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473361 SRR7473361_1.fastq SRR7473361_2.fastq Input file: SRR7473361_1.fastq Paired file: SRR7473361_2.fastq trimmed: SRR7473361-trimmed-pair1.fastq, SRR7473361-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:02:44 2024 >> started Sat Dec 7 15:03:11 2024 >> done (26.931s) 25152457 read pairs processed; of these: 56521 ( 0.22%) short read pairs filtered out after trimming by size control 127018 ( 0.50%) empty read pairs filtered out after trimming by size control 24968918 (99.27%) read pairs available; of these: 14755625 (59.10%) trimmed read pairs available after processing 10213293 (40.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 38 0.00% 19 44 0.00% 20 30 0.00% 21 23 0.00% 22 24 0.00% 23 35 0.00% 24 36 0.00% 25 41 0.00% 26 38 0.00% 27 37 0.00% 28 46 0.00% 29 47 0.00% 30 49 0.00% 31 50 0.00% 32 45 0.00% 33 53 0.00% 34 60 0.00% 35 70 0.00% 36 80 0.00% 37 95 0.00% 38 101 0.00% 39 118 0.00% 40 99 0.00% 41 112 0.00% 42 117 0.00% 43 109 0.00% 44 146 0.00% 45 167 0.00% 46 167 0.00% 47 191 0.00% 48 225 0.00% 49 288 0.00% 50 339 0.00% 51 376 0.00% 52 365 0.00% 53 417 0.00% 54 448 0.00% 55 471 0.00% 56 509 0.00% 57 595 0.00% 58 681 0.00% 59 767 0.00% 60 894 0.00% 61 1065 0.00% 62 1086 0.00% 63 1267 0.01% 64 1428 0.01% 65 1551 0.01% 66 1960 0.01% 67 2630 0.01% 68 3214 0.01% 69 7023 0.03% 70 7194 0.03% 71 3957 0.02% 72 3864 0.02% 73 4172 0.02% 74 4499 0.02% 75 4964 0.02% 76 5133 0.02% 77 5744 0.02% 78 6159 0.02% 79 7095 0.03% 80 7879 0.03% 81 8722 0.03% 82 10020 0.04% 83 11667 0.05% 84 14494 0.06% 85 15674 0.06% 86 16433 0.07% 87 16820 0.07% 88 18075 0.07% 89 18730 0.08% 90 19735 0.08% 91 21574 0.09% 92 22298 0.09% 93 25062 0.10% 94 26516 0.11% 95 28319 0.11% 96 29203 0.12% 97 29733 0.12% 98 29934 0.12% 99 31784 0.13% 100 33575 0.13% 101 33612 0.13% 102 35969 0.14% 103 37841 0.15% 104 40339 0.16% 105 43875 0.18% 106 44420 0.18% 107 44892 0.18% 108 46727 0.19% 109 49354 0.20% 110 51398 0.21% 111 50509 0.20% 112 53268 0.21% 113 58117 0.23% 114 59304 0.24% 115 62527 0.25% 116 64603 0.26% 117 65077 0.26% 118 66387 0.27% 119 68200 0.27% 120 70845 0.28% 121 72621 0.29% 122 75641 0.30% 123 78646 0.31% 124 85561 0.34% 125 86723 0.35% 126 89827 0.36% 127 92601 0.37% 128 95306 0.38% 129 98123 0.39% 130 101672 0.41% 131 105045 0.42% 132 110858 0.44% 133 116713 0.47% 134 123448 0.49% 135 130475 0.52% 136 137352 0.55% 137 145930 0.58% 138 154666 0.62% 139 164911 0.66% 140 175643 0.70% 141 194316 0.78% 142 211321 0.85% 143 240113 0.96% 144 276498 1.11% 145 328117 1.31% 146 410349 1.64% 147 548638 2.20% 148 815092 3.26% 149 1562728 6.26% 150 6360532 25.47% 151 10213293 40.90% 24968918 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=24 prefix-density=1.18 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=13.49 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.7 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=12 prefix-density=0.91 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=69.75 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=8.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473361 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:03:56 Started mapping on | Dec 07 15:03:57 Finished on | Dec 07 15:09:15 Mapping speed, Million of reads per hour | 282.67 Number of input reads | 24968918 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 22856558 Uniquely mapped reads % | 91.54% Average mapped length | 291.26 Number of splices: Total | 23805112 Number of splices: Annotated (sjdb) | 22449129 Number of splices: GT/AG | 23512547 Number of splices: GC/AG | 259100 Number of splices: AT/AC | 10174 Number of splices: Non-canonical | 23291 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218518 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 22067 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.70% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1925102 1925102 1925102 N_multimapping 218518 218518 218518 N_noFeature 688454 22044135 1050584 N_ambiguous 518407 3323 68597 UnstrandedReadsAssigned:21649697 PositiveStrandReadsAssigned:809100 NegativeStrandReadsAssigned:21737377 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473361 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473361-trimmed-pair1.fastq SRR7473361-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,968,918 reads, 21,858,264 reads pseudoaligned [quant] estimated average fragment length: 266.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR7473361.ke.tsv 35125 SRR7473361.se.tsv 88098 total ==> SRR7473361.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.175 0 0 PNS24247 1044 778.405 56.6749 4.4205 PNS24249 1928 1662.4 32.9976 1.20512 PNS24246 1044 778.405 56.6749 4.4205 PNS24248 1044 778.405 56.6749 4.4205 PNS24244 1471 1205.4 133.978 6.74818 PNS24243 293 96.4377 0 0 KQK14069 1603 1337.4 1320.09 59.9275 KQK14071 474 233.838 64.8437 16.836 ==> SRR7473361.se.tsv <== BRADI_1g14170v3 1812 BRADI_1g53295v3 13 BRADI_1g59795v3 319 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 2286 BRADI_1g74790v3 407 BRADI_1g09890v3 0 BRADI_1g77505v3 237 BRADI_1g48960v3 0 SRR7473361 completed mapping pipeline successfully