Starting /dee2/code/volunteer_pipeline.sh SRR7473362 current disk space = 1542716678144 free memory = 1600081204 SRR7473362 SRAfilesize adec9b4d6622418ab9929e148810ed38 SRR7473362.sra SRR7473362.sra file validated SRR7473362 is paired end SRR7473362 is conventional basespace SRR7473362 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473362_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3515 34.0 33.0 34.0 33.0 34.0 2 33.37175 34.0 34.0 34.0 33.0 34.0 3 33.443 34.0 34.0 34.0 33.0 34.0 4 33.45025 34.0 34.0 34.0 33.0 34.0 5 33.29225 34.0 34.0 34.0 33.0 34.0 6 37.0065 38.0 37.0 38.0 36.0 38.0 7 37.3655 38.0 38.0 38.0 37.0 38.0 8 37.43475 38.0 38.0 38.0 37.0 38.0 9 37.449 38.0 38.0 38.0 37.0 38.0 10-14 37.503750000000004 38.0 38.0 38.0 37.4 38.0 15-19 37.420849999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.43655 38.0 38.0 38.0 37.4 38.0 25-29 37.299299999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.218199999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.10105 38.0 38.0 38.0 36.2 38.0 40-44 36.70085 38.0 38.0 38.0 34.8 38.0 45-49 36.716750000000005 38.0 38.0 38.0 34.6 38.0 50-54 36.84445 38.0 38.0 38.0 35.0 38.0 55-59 36.87855 38.0 38.0 38.0 35.2 38.0 60-64 36.732749999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.54370000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.51395000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.44875 38.0 38.0 38.0 33.8 38.0 80-84 36.4818 38.0 38.0 38.0 34.0 38.0 85-89 36.3483 38.0 37.8 38.0 33.8 38.0 90-94 35.890249999999995 38.0 37.0 38.0 32.0 38.0 95-99 35.67764999999999 38.0 36.8 38.0 31.2 38.0 100-104 35.63465 38.0 36.4 38.0 31.4 38.0 105-109 35.5049 38.0 36.4 38.0 30.6 38.0 110-114 35.1497 38.0 35.6 38.0 29.0 38.0 115-119 34.927400000000006 38.0 35.0 38.0 27.8 38.0 120-124 34.64365 38.0 35.0 38.0 27.4 38.0 125-129 34.055299999999995 38.0 34.6 38.0 23.8 38.0 130-134 33.41595 38.0 34.0 38.0 20.2 38.0 135-139 32.92659999999999 38.0 33.4 38.0 14.8 38.0 140-144 32.366800000000005 38.0 32.6 38.0 13.8 38.0 145-149 31.535500000000003 37.4 32.6 38.0 11.2 38.0 150-151 26.811374999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 3.0 12 1.0 13 1.0 14 4.0 15 3.0 16 3.0 17 9.0 18 7.0 19 6.0 20 8.0 21 6.0 22 13.0 23 11.0 24 21.0 25 18.0 26 25.0 27 36.0 28 46.0 29 47.0 30 60.0 31 74.0 32 102.0 33 139.0 34 189.0 35 392.0 36 856.0 37 1917.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.54062186559679 11.183550651955867 11.158475426278837 39.1173520561685 2 25.532448008018036 14.307191180155348 32.84891004760711 27.31145076421949 3 21.475 19.575 24.325 34.625 4 26.625 25.575 21.349999999999998 26.450000000000003 5 27.491840321365807 30.278684408737135 20.888777303540046 21.340697966357016 6 22.125 31.6 22.525000000000002 23.75 7 17.075000000000003 21.875 39.75 21.3 8 21.825 21.525 27.625 29.025000000000002 9 20.175 21.675 31.374999999999996 26.775 10-14 23.335 25.650000000000002 24.83 26.185000000000002 15-19 23.405 24.79 25.415 26.39 20-24 23.200000000000003 24.610000000000003 26.21 25.979999999999997 25-29 23.11 25.14 25.36 26.39 30-34 22.85 24.735 25.014999999999997 27.400000000000002 35-39 23.35434173669468 24.424769907963185 25.795318127250898 26.42557022809124 40-44 23.583016222711798 24.849789705587824 25.120168235529743 26.44702583617064 45-49 22.979936959023366 24.39085405513584 25.151348376444687 27.47786060939611 50-54 23.095 25.130000000000003 25.255 26.52 55-59 23.23 24.36 25.169999999999998 27.24 60-64 23.055 24.349999999999998 25.66 26.935 65-69 23.97 24.32 25.195 26.515 70-74 23.46 24.255 25.39 26.895000000000003 75-79 23.327332733273327 25.04250425042504 24.552455245524552 27.077707770777078 80-84 23.71 24.915000000000003 24.925 26.450000000000003 85-89 24.349999999999998 24.560000000000002 24.5 26.590000000000003 90-94 23.948592288843326 24.22863429514427 24.593689053358002 27.229084362654397 95-99 24.028834601521826 24.414297156587907 25.30536643972767 26.251501802162597 100-104 24.415 24.675 24.404999999999998 26.505000000000003 105-109 23.555 24.7 24.87 26.875 110-114 23.98 25.080000000000002 24.305 26.634999999999998 115-119 23.93 24.19 25.330000000000002 26.55 120-124 23.865 24.779999999999998 24.465 26.889999999999997 125-129 24.467818682694716 24.457801152016028 24.74830954169797 26.326070623591285 130-134 24.578191891211283 24.709141274238227 24.583228405943085 26.129438428607404 135-139 24.566081400613772 24.173668058560143 24.727071489661416 26.533179051164662 140-144 24.556746468997297 24.39146549133527 24.491635780827405 26.56015225884003 145-149 24.423221915054032 24.32269414425735 24.689620507665243 26.564463433023374 150-151 24.250440917107582 24.855127236079618 24.401612496850593 26.492819349962204 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 2.0 26 2.5 27 2.0 28 3.5 29 7.5 30 11.0 31 10.5 32 12.0 33 17.0 34 22.5 35 31.5 36 42.5 37 62.0 38 79.0 39 88.0 40 117.5 41 136.5 42 147.0 43 168.0 44 178.0 45 174.5 46 174.5 47 174.0 48 161.0 49 155.0 50 145.5 51 133.0 52 135.0 53 139.5 54 133.5 55 127.0 56 113.0 57 108.0 58 105.0 59 99.5 60 98.0 61 90.5 62 83.5 63 69.0 64 58.0 65 50.5 66 46.0 67 46.0 68 43.0 69 32.5 70 28.5 71 32.0 72 27.0 73 22.0 74 19.5 75 13.0 76 8.0 77 5.0 78 4.5 79 3.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.22499999999999998 3 0.0 4 0.0 5 0.42500000000000004 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.04 40-44 0.13999999999999999 45-49 0.065 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.12 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.17500000000000002 130-134 0.7250000000000001 135-139 0.615 140-144 0.16999999999999998 145-149 0.525 150-151 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.33631942667009 96.05 2 1.2029690299462503 2.35 3 0.3071410289224469 0.8999999999999999 4 0.07678525723061172 0.3 5 0.05119017148707448 0.25 6 0.02559508574353724 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCG 6 0.15 No Hit CCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGC 5 0.125 No Hit CCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.387499999999999 0.0 0.0 0.0 0.0 132-133 4.675000000000001 0.0 0.0 0.0 0.0 134-135 5.075 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473362 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473362_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2535 33.0 33.0 34.0 32.0 34.0 2 32.43075 34.0 33.0 34.0 32.0 34.0 3 32.273 34.0 33.0 34.0 32.0 34.0 4 32.34125 34.0 33.0 34.0 32.0 34.0 5 32.22375 34.0 33.0 34.0 32.0 34.0 6 36.43125 38.0 38.0 38.0 36.0 38.0 7 36.54775 38.0 38.0 38.0 36.0 38.0 8 36.66025 38.0 38.0 38.0 36.0 38.0 9 36.71225 38.0 38.0 38.0 36.0 38.0 10-14 36.8016 38.0 38.0 38.0 36.0 38.0 15-19 36.5753 38.0 38.0 38.0 36.0 38.0 20-24 36.397800000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.42835 38.0 38.0 38.0 35.8 38.0 30-34 36.5175 38.0 38.0 38.0 36.0 38.0 35-39 36.5156 38.0 38.0 38.0 36.0 38.0 40-44 36.48675 38.0 38.0 38.0 36.0 38.0 45-49 36.3934 38.0 38.0 38.0 35.8 38.0 50-54 36.410199999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.414300000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.345349999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.004900000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.2109 38.0 38.0 38.0 34.4 38.0 75-79 36.161449999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.09204999999999 38.0 38.0 38.0 34.2 38.0 85-89 35.9394 38.0 38.0 38.0 33.8 38.0 90-94 35.81135 38.0 38.0 38.0 33.2 38.0 95-99 35.507600000000004 38.0 38.0 38.0 32.2 38.0 100-104 34.724000000000004 38.0 36.8 38.0 27.6 38.0 105-109 34.57625 38.0 36.6 38.0 26.6 38.0 110-114 34.37025 38.0 36.0 38.0 25.2 38.0 115-119 34.10625 38.0 35.4 38.0 23.8 38.0 120-124 33.8361 38.0 35.0 38.0 20.6 38.0 125-129 33.697050000000004 38.0 35.0 38.0 19.0 38.0 130-134 33.0028 38.0 34.2 38.0 14.2 38.0 135-139 32.62675 38.0 33.4 38.0 13.4 38.0 140-144 32.02034999999999 38.0 32.4 38.0 13.0 38.0 145-149 30.976100000000002 38.0 31.0 38.0 4.2 38.0 150-151 26.063375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 20.0 4 11.0 5 0.0 6 0.0 7 2.0 8 1.0 9 0.0 10 3.0 11 2.0 12 2.0 13 8.0 14 1.0 15 8.0 16 5.0 17 7.0 18 6.0 19 16.0 20 6.0 21 20.0 22 24.0 23 22.0 24 29.0 25 34.0 26 22.0 27 27.0 28 42.0 29 46.0 30 43.0 31 63.0 32 96.0 33 84.0 34 138.0 35 308.0 36 630.0 37 2239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.045627376425855 17.566539923954373 13.536121673003803 32.85171102661597 2 31.683168316831683 20.76669205382077 26.047220106626046 21.502919522721502 3 25.08942258559019 23.684210526315788 26.41798671435871 24.80838017373531 4 27.752409944190763 29.908675799086758 19.15271435819381 23.186199898528663 5 29.755226925038247 32.48342682304946 17.440081591024985 20.3212646608873 6 23.235144743524632 35.06856272219401 18.76587100050787 22.93042153377349 7 23.709514170040485 17.78846153846154 33.98279352226721 24.519230769230766 8 24.39516129032258 23.059475806451612 23.286290322580644 29.259072580645164 9 24.064305450891734 22.532027128862094 25.596583772921377 27.80708364732479 10-14 26.629534848712932 24.828139896633047 22.725676150333683 25.816649104320337 15-19 25.992213964305577 24.637241518782545 24.04064917336569 25.329895343546184 20-24 26.482814559464668 25.46385481090946 23.096420967251344 24.95690966237453 25-29 26.381082586460074 25.24178439414654 23.059395412425946 25.317737606967437 30-34 26.06757509751279 25.287472772402612 23.74753052023707 24.897421609847527 35-39 26.578747146842506 24.823738270352525 23.251331473497334 25.346183109307635 40-44 26.93631669535284 24.729168775944114 23.281360737065913 25.05315379163714 45-49 27.299989834299076 24.885635864592864 23.43702348276914 24.377350818338925 50-54 26.73883352723962 24.89250847286155 23.460974252617735 24.907683747281098 55-59 26.906533070188754 24.877283538282477 23.728556247153485 24.487627144375285 60-64 26.547148789628277 24.967081940646207 23.630102299199837 24.855666970525675 65-69 26.706488997804666 24.363097973145454 24.204829734007248 24.72558329504263 70-74 27.343987053706886 24.62324264185294 23.84444219682411 24.188328107616062 75-79 26.35760919074852 25.051875094893468 23.84229971152386 24.748216002834152 80-84 27.11214292924195 24.634097103058444 23.841728071060867 24.412031896638737 85-89 26.131159092052947 24.6112033821531 23.826060697569076 25.431576828224873 90-94 26.925017660712484 24.901604601877082 23.887375113533153 24.286002623877284 95-99 26.55605883251056 24.673011349178076 24.255687312331418 24.51524250597995 100-104 27.101838463127454 24.79859533154307 23.765750877917785 24.333815327411692 105-109 26.750476583028494 25.184192900200937 23.386058014323254 24.67927250244732 110-114 26.94351302553521 25.0657725045138 23.755481042042817 24.235233427908177 115-119 27.405771798295163 25.16175413371675 23.677724145013865 23.754749922974224 120-124 27.40957665433621 25.010275380189068 23.01685162351007 24.56329634196465 125-129 27.243754497789656 25.352112676056336 23.676364757890408 23.727768068263597 130-134 27.912483912483914 25.33848133848134 23.72200772200772 23.027027027027028 135-139 27.745782579888896 25.467611232862748 23.510524438102035 23.276081749146325 140-144 27.386716958050872 25.928946429481627 23.523115347367348 23.161221265100156 145-149 28.04420457465947 25.417630429195583 23.490105371369825 23.04805962477512 150-151 28.01561483409239 25.19193233571893 23.344176968119715 23.448275862068964 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 3.5 2 5.0 3 6.5 4 5.5 5 3.0 6 1.5 7 1.0 8 0.5 9 1.0 10 1.5 11 1.0 12 1.0 13 1.5 14 1.5 15 1.0 16 1.5 17 2.0 18 2.5 19 3.0 20 3.0 21 2.0 22 1.0 23 1.0 24 2.0 25 3.5 26 3.0 27 4.0 28 5.0 29 3.5 30 7.5 31 10.0 32 12.0 33 17.0 34 19.0 35 26.0 36 32.5 37 32.5 38 51.0 39 77.0 40 93.0 41 100.5 42 128.5 43 150.0 44 149.0 45 161.0 46 161.0 47 152.5 48 153.5 49 153.0 50 150.0 51 155.0 52 146.0 53 139.5 54 141.5 55 132.0 56 118.0 57 117.5 58 118.0 59 113.5 60 108.5 61 97.5 62 96.0 63 90.0 64 72.5 65 62.0 66 61.0 67 57.0 68 49.5 69 48.5 70 43.0 71 31.5 72 25.5 73 21.0 74 18.5 75 13.0 76 5.5 77 2.0 78 3.0 79 2.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 1.525 3 2.15 4 1.4500000000000002 5 1.95 6 1.55 7 1.2 8 0.8 9 0.475 10-14 0.35500000000000004 15-19 1.105 20-24 1.37 25-29 1.2550000000000001 30-34 1.295 35-39 1.425 40-44 1.23 45-49 1.63 50-54 1.155 55-59 1.195 60-64 1.27 65-69 2.0650000000000004 70-74 1.13 75-79 1.205 80-84 0.9299999999999999 85-89 0.655 90-94 0.91 95-99 1.755 100-104 3.18 105-109 2.955 110-114 3.075 115-119 2.63 120-124 2.68 125-129 2.73 130-134 2.875 135-139 1.8950000000000002 140-144 1.905 145-149 2.725 150-151 3.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.25819672131148 95.89999999999999 2 1.331967213114754 2.6 3 0.25614754098360654 0.75 4 0.05122950819672131 0.2 5 0.05122950819672131 0.25 6 0.05122950819672131 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GCGACTTATATTCTGTAGCAAGGTTAACCGAATAGGGGAGCCGAAGGGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.4749999999999996 0.0 0.0 0.0 0.0 128-129 3.8625 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.762499999999999 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963404 spots for SRR7473362.sra Written 963404 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra Read 963385 spots for SRR7473362.sra Written 963385 spots for SRR7473362.sra SRR ids: ['SRR7473362.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u3gwj4os SRR7473362.sra spots: 19267719 blocks: [[1, 963385], [963386, 1926770], [1926771, 2890155], [2890156, 3853540], [3853541, 4816925], [4816926, 5780310], [5780311, 6743695], [6743696, 7707080], [7707081, 8670465], [8670466, 9633850], [9633851, 10597235], [10597236, 11560620], [11560621, 12524005], [12524006, 13487390], [13487391, 14450775], [14450776, 15414160], [15414161, 16377545], [16377546, 17340930], [17340931, 18304315], [18304316, 19267719]] SRR7473362 file size 6507497 SRR7473362 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473362 SRR7473362_1.fastq SRR7473362_2.fastq Input file: SRR7473362_1.fastq Paired file: SRR7473362_2.fastq trimmed: SRR7473362-trimmed-pair1.fastq, SRR7473362-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:05:34 2024 >> started Sat Dec 7 15:06:04 2024 >> done (29.770s) 19267719 read pairs processed; of these: 36999 ( 0.19%) short read pairs filtered out after trimming by size control 65128 ( 0.34%) empty read pairs filtered out after trimming by size control 19165592 (99.47%) read pairs available; of these: 10686154 (55.76%) trimmed read pairs available after processing 8479438 (44.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 15 0.00% 20 12 0.00% 21 15 0.00% 22 14 0.00% 23 20 0.00% 24 11 0.00% 25 19 0.00% 26 25 0.00% 27 20 0.00% 28 24 0.00% 29 30 0.00% 30 25 0.00% 31 32 0.00% 32 32 0.00% 33 32 0.00% 34 34 0.00% 35 29 0.00% 36 41 0.00% 37 50 0.00% 38 40 0.00% 39 50 0.00% 40 56 0.00% 41 55 0.00% 42 56 0.00% 43 65 0.00% 44 73 0.00% 45 88 0.00% 46 100 0.00% 47 121 0.00% 48 129 0.00% 49 143 0.00% 50 157 0.00% 51 183 0.00% 52 182 0.00% 53 205 0.00% 54 216 0.00% 55 228 0.00% 56 246 0.00% 57 318 0.00% 58 304 0.00% 59 366 0.00% 60 430 0.00% 61 451 0.00% 62 497 0.00% 63 583 0.00% 64 659 0.00% 65 750 0.00% 66 807 0.00% 67 974 0.01% 68 1258 0.01% 69 2162 0.01% 70 2180 0.01% 71 1621 0.01% 72 1576 0.01% 73 1717 0.01% 74 1820 0.01% 75 2082 0.01% 76 2174 0.01% 77 2415 0.01% 78 2668 0.01% 79 3068 0.02% 80 3400 0.02% 81 3639 0.02% 82 4230 0.02% 83 4932 0.03% 84 6424 0.03% 85 7221 0.04% 86 7711 0.04% 87 8143 0.04% 88 8935 0.05% 89 9266 0.05% 90 10062 0.05% 91 10361 0.05% 92 10642 0.06% 93 12138 0.06% 94 12978 0.07% 95 14185 0.07% 96 14468 0.08% 97 15220 0.08% 98 15961 0.08% 99 16991 0.09% 100 18203 0.09% 101 18206 0.09% 102 19317 0.10% 103 20249 0.11% 104 21401 0.11% 105 23059 0.12% 106 23757 0.12% 107 24589 0.13% 108 26482 0.14% 109 28450 0.15% 110 29260 0.15% 111 29196 0.15% 112 30383 0.16% 113 33143 0.17% 114 33341 0.17% 115 35790 0.19% 116 37591 0.20% 117 37819 0.20% 118 39685 0.21% 119 41114 0.21% 120 43133 0.23% 121 44053 0.23% 122 46738 0.24% 123 48579 0.25% 124 51821 0.27% 125 52144 0.27% 126 54374 0.28% 127 56571 0.30% 128 58695 0.31% 129 61474 0.32% 130 64592 0.34% 131 67457 0.35% 132 70270 0.37% 133 74963 0.39% 134 78947 0.41% 135 83821 0.44% 136 89110 0.46% 137 95737 0.50% 138 102830 0.54% 139 109507 0.57% 140 117923 0.62% 141 130628 0.68% 142 142954 0.75% 143 163832 0.85% 144 189307 0.99% 145 227599 1.19% 146 286690 1.50% 147 389407 2.03% 148 599447 3.13% 149 1182460 6.17% 150 5099382 26.61% 151 8479438 44.24% 19165592 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=16 prefix-density=1.02 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=129.32 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=14.9 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=28 prefix-density=0.74 prefix-fanout=2.0 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=28.17 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.2 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7473362 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:07:30 Started mapping on | Dec 07 15:07:30 Finished on | Dec 07 15:14:01 Mapping speed, Million of reads per hour | 176.46 Number of input reads | 19165592 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17306890 Uniquely mapped reads % | 90.30% Average mapped length | 293.74 Number of splices: Total | 18188430 Number of splices: Annotated (sjdb) | 17129388 Number of splices: GT/AG | 17966473 Number of splices: GC/AG | 197867 Number of splices: AT/AC | 6873 Number of splices: Non-canonical | 17217 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 137123 % of reads mapped to multiple loci | 0.72% Number of reads mapped to too many loci | 16778 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.94% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1738907 1738907 1738907 N_multimapping 137123 137123 137123 N_noFeature 567199 16758459 771202 N_ambiguous 395011 2161 50977 UnstrandedReadsAssigned:16344680 PositiveStrandReadsAssigned:546270 NegativeStrandReadsAssigned:16484711 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7473362 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473362-trimmed-pair1.fastq SRR7473362-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,165,592 reads, 16,547,213 reads pseudoaligned [quant] estimated average fragment length: 273.084 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR7473362.ke.tsv 35125 SRR7473362.se.tsv 88098 total ==> SRR7473362.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.544 0 0 PNS24247 1044 771.916 55.0934 5.48226 PNS24249 1928 1655.92 79.5812 3.6915 PNS24246 1044 771.916 55.0934 5.48226 PNS24248 1044 771.916 55.0934 5.48226 PNS24244 1471 1198.92 121.139 7.76111 PNS24243 293 88.5388 0 0 KQK14069 1603 1330.92 19942.3 1150.94 KQK14071 474 224.294 360.446 123.439 ==> SRR7473362.se.tsv <== BRADI_1g14170v3 22991 BRADI_1g53295v3 7 BRADI_1g59795v3 133 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1107 BRADI_1g74790v3 502 BRADI_1g09890v3 14 BRADI_1g77505v3 135 BRADI_1g48960v3 0 SRR7473362 completed mapping pipeline successfully