Starting /dee2/code/volunteer_pipeline.sh SRR7473363 current disk space = 1542673821696 free memory = 1597512980 SRR7473363 SRAfilesize 675f56c31fc69f022aac011754dd2fd2 SRR7473363.sra SRR7473363.sra file validated SRR7473363 is paired end SRR7473363 is conventional basespace SRR7473363 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473363_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29825 34.0 33.0 34.0 33.0 34.0 2 33.416 34.0 33.0 34.0 33.0 34.0 3 33.464 34.0 34.0 34.0 33.0 34.0 4 33.45975 34.0 34.0 34.0 33.0 34.0 5 33.48175 34.0 34.0 34.0 33.0 34.0 6 37.147 38.0 38.0 38.0 36.0 38.0 7 37.4635 38.0 38.0 38.0 37.0 38.0 8 37.57575 38.0 38.0 38.0 38.0 38.0 9 37.5385 38.0 38.0 38.0 38.0 38.0 10-14 37.5422 38.0 38.0 38.0 38.0 38.0 15-19 37.44775 38.0 38.0 38.0 38.0 38.0 20-24 37.557 38.0 38.0 38.0 38.0 38.0 25-29 37.501 38.0 38.0 38.0 37.8 38.0 30-34 37.243700000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.20005 38.0 38.0 38.0 37.0 38.0 40-44 37.083800000000004 38.0 38.0 38.0 36.2 38.0 45-49 37.0963 38.0 38.0 38.0 36.0 38.0 50-54 37.034000000000006 38.0 38.0 38.0 36.0 38.0 55-59 37.0101 38.0 38.0 38.0 36.0 38.0 60-64 37.0089 38.0 38.0 38.0 35.8 38.0 65-69 36.823249999999994 38.0 38.0 38.0 35.2 38.0 70-74 36.6733 38.0 38.0 38.0 34.6 38.0 75-79 36.71465 38.0 38.0 38.0 34.6 38.0 80-84 36.7063 38.0 38.0 38.0 34.8 38.0 85-89 36.523 38.0 38.0 38.0 34.0 38.0 90-94 36.227149999999995 38.0 38.0 38.0 33.4 38.0 95-99 36.02865 38.0 37.4 38.0 33.0 38.0 100-104 35.83755 38.0 37.2 38.0 32.2 38.0 105-109 35.7915 38.0 37.0 38.0 31.4 38.0 110-114 35.561699999999995 38.0 36.2 38.0 31.2 38.0 115-119 35.3178 38.0 36.0 38.0 30.2 38.0 120-124 34.9674 38.0 35.4 38.0 28.4 38.0 125-129 34.668949999999995 38.0 35.0 38.0 27.2 38.0 130-134 34.148999999999994 38.0 34.8 38.0 24.0 38.0 135-139 33.7883 38.0 33.8 38.0 23.0 38.0 140-144 33.09955 38.0 33.6 38.0 18.4 38.0 145-149 31.9592 38.0 32.2 38.0 11.2 38.0 150-151 27.105375000000002 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 0.0 14 3.0 15 2.0 16 2.0 17 4.0 18 8.0 19 4.0 20 12.0 21 8.0 22 5.0 23 8.0 24 17.0 25 12.0 26 19.0 27 29.0 28 24.0 29 38.0 30 65.0 31 89.0 32 81.0 33 133.0 34 175.0 35 333.0 36 798.0 37 2127.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.43129866867621 12.735493594574226 9.721175584024115 34.11203215272545 2 26.424999999999997 15.875 31.125000000000004 26.575 3 23.200000000000003 21.475 25.124999999999996 30.2 4 26.75 28.775000000000002 21.075 23.400000000000002 5 25.69427070302727 31.34851138353765 22.241681260945708 20.715536652489366 6 21.675 31.95 23.5 22.875 7 17.875 20.549999999999997 40.2 21.375 8 21.875 21.95 26.924999999999997 29.25 9 20.025000000000002 20.925 31.35 27.700000000000003 10-14 24.025 25.06 24.035 26.88 15-19 24.224999999999998 24.735 24.77 26.27 20-24 23.794999999999998 24.91 25.03 26.265 25-29 23.849999999999998 25.03 24.79 26.33 30-34 23.64 24.795 25.095 26.47 35-39 24.368655298294744 24.638695804370656 24.833725058758812 26.158923838575788 40-44 24.240000000000002 24.709999999999997 24.959999999999997 26.090000000000003 45-49 24.265 24.08 25.3 26.355 50-54 24.02 24.66 24.64 26.68 55-59 24.26 24.46 24.545 26.735 60-64 24.25 24.02 24.75 26.979999999999997 65-69 24.435000000000002 24.46 24.775 26.33 70-74 24.075 24.25 25.019999999999996 26.655 75-79 24.765 24.39 24.135 26.71 80-84 24.154999999999998 24.515 24.42 26.91 85-89 24.884999999999998 24.67 24.265 26.179999999999996 90-94 25.085 24.08 24.005000000000003 26.83 95-99 24.605993896032423 24.610997148146296 24.305798769199978 26.477210186621303 100-104 25.1 24.33 24.505 26.064999999999998 105-109 24.555 23.805 24.535 27.105 110-114 24.959999999999997 24.42 24.51 26.11 115-119 25.055 24.415 23.965 26.565 120-124 24.565 24.605 24.185000000000002 26.645000000000003 125-129 25.21 24.54 24.125 26.125 130-134 25.331258783376832 24.08652880947601 23.945994780164625 26.636217626982532 135-139 25.57766527993584 24.1291163350208 23.652949726830734 26.640268658212623 140-144 25.365 24.125 23.974999999999998 26.534999999999997 145-149 25.18151319413149 24.390366030744577 24.30524260177257 26.12287817335136 150-151 25.740577335182152 24.127064162359762 23.648052439178116 26.484306063279973 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 1.5 27 0.5 28 3.0 29 7.5 30 7.0 31 5.5 32 10.0 33 19.5 34 26.0 35 25.5 36 37.5 37 61.0 38 70.5 39 86.5 40 109.5 41 116.5 42 148.0 43 164.5 44 159.0 45 169.5 46 173.0 47 187.5 48 183.0 49 165.0 50 149.5 51 132.0 52 136.0 53 126.0 54 113.5 55 114.5 56 107.0 57 110.5 58 107.5 59 99.0 60 94.0 61 84.5 62 83.5 63 75.0 64 71.0 65 69.5 66 62.5 67 52.0 68 47.0 69 49.0 70 39.5 71 33.0 72 33.5 73 26.0 74 15.5 75 10.0 76 4.5 77 4.0 78 5.0 79 3.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.065 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.38 135-139 0.245 140-144 0.0 145-149 0.145 150-151 0.8375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.37150127226462 96.65 2 1.5012722646310432 2.9499999999999997 3 0.10178117048346055 0.3 4 0.02544529262086514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.9000000000000004 0.0 0.0 0.0 0.0 118-119 3.0999999999999996 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.7249999999999996 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.762499999999999 0.0 0.0 0.0 0.0 130-131 5.25 0.0 0.0 0.0 0.0 132-133 5.6 0.0 0.0 0.0 0.0 134-135 6.05 0.0 0.0 0.0 0.0 136-137 6.387499999999999 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473363 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473363_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7655 33.0 33.0 34.0 31.0 34.0 2 32.1635 33.0 33.0 34.0 31.0 34.0 3 32.076 34.0 33.0 34.0 31.0 34.0 4 32.0065 34.0 33.0 34.0 32.0 34.0 5 32.029 34.0 33.0 34.0 32.0 34.0 6 36.30075 38.0 38.0 38.0 34.0 38.0 7 36.42375 38.0 38.0 38.0 34.0 38.0 8 36.56875 38.0 38.0 38.0 35.0 38.0 9 36.70775 38.0 38.0 38.0 36.0 38.0 10-14 36.8112 38.0 38.0 38.0 36.0 38.0 15-19 36.623000000000005 38.0 38.0 38.0 35.8 38.0 20-24 36.1366 38.0 38.0 38.0 34.6 38.0 25-29 36.34065 38.0 38.0 38.0 35.2 38.0 30-34 36.4506 38.0 38.0 38.0 35.4 38.0 35-39 36.372400000000006 38.0 38.0 38.0 35.4 38.0 40-44 36.44255 38.0 38.0 38.0 35.8 38.0 45-49 36.29725 38.0 38.0 38.0 35.0 38.0 50-54 36.30105 38.0 38.0 38.0 34.6 38.0 55-59 36.28505 38.0 38.0 38.0 34.8 38.0 60-64 36.113550000000004 38.0 38.0 38.0 33.8 38.0 65-69 35.761399999999995 38.0 38.0 38.0 32.6 38.0 70-74 35.9431 38.0 38.0 38.0 33.8 38.0 75-79 35.92915 38.0 38.0 38.0 33.6 38.0 80-84 35.82045 38.0 38.0 38.0 33.4 38.0 85-89 35.6314 38.0 38.0 38.0 32.8 38.0 90-94 35.37335 38.0 37.6 38.0 31.0 38.0 95-99 34.86465 38.0 37.2 38.0 27.8 38.0 100-104 34.3566 38.0 36.6 38.0 24.4 38.0 105-109 34.28305 38.0 36.0 38.0 24.0 38.0 110-114 33.99614999999999 38.0 35.8 38.0 22.0 38.0 115-119 33.46615 38.0 35.0 38.0 15.0 38.0 120-124 33.4752 38.0 35.0 38.0 15.0 38.0 125-129 33.33395 38.0 34.8 38.0 14.8 38.0 130-134 32.5087 38.0 33.6 38.0 13.0 38.0 135-139 32.1023 38.0 33.2 38.0 13.0 38.0 140-144 31.61455 38.0 31.8 38.0 8.6 38.0 145-149 30.33545 37.6 30.4 38.0 2.0 38.0 150-151 24.583750000000002 32.0 14.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 14.0 4 25.0 5 3.0 6 5.0 7 2.0 8 1.0 9 8.0 10 4.0 11 2.0 12 9.0 13 8.0 14 9.0 15 7.0 16 10.0 17 10.0 18 10.0 19 13.0 20 12.0 21 22.0 22 23.0 23 37.0 24 28.0 25 26.0 26 29.0 27 25.0 28 40.0 29 54.0 30 60.0 31 65.0 32 77.0 33 126.0 34 165.0 35 300.0 36 620.0 37 2136.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.99948466889977 18.11388817315125 11.826848750322082 28.0597784076269 2 30.483460559796438 22.290076335877863 25.08905852417303 22.137404580152673 3 24.257932446264075 24.590583418628455 26.228249744114635 24.923234390992835 4 27.470558115719406 31.618023553507424 19.63645673323093 21.274961597542244 5 27.763561924257935 31.422722620266118 18.526100307062435 22.28761514841351 6 23.07497467071935 33.38399189463019 20.0354609929078 23.505572441742654 7 23.444976076555022 16.973054646184842 34.97859481238982 24.60337446487031 8 23.622244488977955 21.56813627254509 22.695390781563127 32.11422845691383 9 24.6 21.275 25.624999999999996 28.499999999999996 10-14 26.375 24.255 22.245 27.125 15-19 25.94135957425444 25.02259262978211 23.220202831609598 25.81584496435385 20-24 26.694441621786403 24.372523117569354 22.84828777563256 26.084747485011682 25-29 26.32827085120339 24.572380039356172 23.063726726878247 26.03562238256219 30-34 26.820925553319917 24.572434607645878 23.249496981891348 25.357142857142854 35-39 26.673397274103987 24.35638566380616 22.81675921251893 26.15345784957092 40-44 26.335054906483478 24.299252870681443 23.12089454946598 26.244797673369103 45-49 26.50164182874463 24.182874463248293 23.152311189694366 26.163172518312706 50-54 26.84817070102159 24.34703839766494 23.42609833425595 25.37869256705752 55-59 26.659984966173887 23.863693309947383 23.30243046855425 26.173891255324477 60-64 26.596226415094335 24.332075471698115 22.71698113207547 26.354716981132075 65-69 26.65315429440081 23.851026095768937 23.63313909298201 25.86268051684824 70-74 26.609657947686117 23.687122736418512 23.284708249496983 26.41851106639839 75-79 26.986356340288925 23.96669341894061 23.374799357945424 25.67215088282504 80-84 26.853988961364777 23.79327646763673 23.447064726542898 25.90566984445559 85-89 27.0320413177556 24.449681592538735 23.3716090858948 25.146668003810863 90-94 26.9442064412076 24.15704853586009 22.907111536716897 25.991633486215417 95-99 27.00514335183582 25.039466313591692 23.257116667515405 24.698273667057087 100-104 27.1013152486642 24.624948623099055 23.23777229757501 25.035963830661736 105-109 27.43780456527315 24.22159528084124 23.27776352911003 25.06283662477558 110-114 26.96479054227705 24.903623747108714 22.94525828835775 25.18632742225649 115-119 27.535262019973235 24.549572737568205 22.825079789972204 25.09008545248636 120-124 27.24942322481415 24.901307357087926 23.173545244809024 24.675724173288902 125-129 27.681731903760326 24.275380905966244 23.275021802698404 24.76786538757503 130-134 27.538319102972945 25.02314576689641 22.960600761238556 24.47793436889209 135-139 27.517290480065093 25.167819365337674 23.621847030105776 23.693043124491457 140-144 28.073375899462853 25.174825174825177 22.8387554474511 23.91304347826087 145-149 27.783160793513183 25.161915446988626 23.203630985771838 23.85129277372635 150-151 28.619485056281533 26.290593867253204 21.995083451934274 23.094837624530985 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 2.0 8 1.0 9 1.5 10 1.5 11 1.0 12 1.0 13 0.5 14 0.0 15 2.0 16 3.0 17 2.5 18 2.0 19 2.0 20 2.0 21 2.5 22 2.5 23 0.5 24 1.5 25 3.0 26 3.0 27 3.0 28 3.5 29 4.0 30 4.5 31 6.0 32 10.0 33 13.0 34 15.5 35 24.0 36 33.0 37 46.5 38 57.5 39 72.5 40 90.5 41 101.0 42 123.0 43 138.5 44 139.5 45 147.5 46 151.5 47 143.5 48 149.0 49 158.0 50 148.0 51 136.5 52 122.5 53 123.5 54 129.0 55 116.5 56 95.0 57 104.5 58 126.0 59 119.5 60 110.5 61 103.5 62 101.0 63 107.5 64 100.0 65 75.5 66 71.0 67 71.0 68 67.5 69 66.5 70 60.5 71 48.5 72 34.5 73 28.5 74 23.5 75 13.0 76 7.0 77 6.5 78 6.5 79 3.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9749999999999996 2 1.7500000000000002 3 2.3 4 2.35 5 2.3 6 1.3 7 0.7250000000000001 8 0.2 9 0.0 10-14 0.0 15-19 0.41000000000000003 20-24 1.59 25-29 0.905 30-34 0.6 35-39 0.95 40-44 0.28500000000000003 45-49 1.0250000000000001 50-54 0.645 55-59 0.22499999999999998 60-64 0.625 65-69 1.325 70-74 0.6 75-79 0.32 80-84 0.35000000000000003 85-89 0.28500000000000003 90-94 0.795 95-99 1.815 100-104 2.68 105-109 2.5250000000000004 110-114 2.725 115-119 2.87 120-124 2.475 125-129 2.535 130-134 2.79 135-139 1.68 140-144 1.3299999999999998 145-149 1.955 150-151 3.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2051282051282 95.75 2 1.4102564102564104 2.75 3 0.3076923076923077 0.8999999999999999 4 0.02564102564102564 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02564102564102564 0.22499999999999998 >10 0.02564102564102564 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 11 0.27499999999999997 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.2249999999999996 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.7750000000000004 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.375 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041972 spots for SRR7473363.sra Written 1041972 spots for SRR7473363.sra Read 1041976 spots for SRR7473363.sra Written 1041976 spots for SRR7473363.sra SRR ids: ['SRR7473363.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k806juvj SRR7473363.sra spots: 20839444 blocks: [[1, 1041972], [1041973, 2083944], [2083945, 3125916], [3125917, 4167888], [4167889, 5209860], [5209861, 6251832], [6251833, 7293804], [7293805, 8335776], [8335777, 9377748], [9377749, 10419720], [10419721, 11461692], [11461693, 12503664], [12503665, 13545636], [13545637, 14587608], [14587609, 15629580], [15629581, 16671552], [16671553, 17713524], [17713525, 18755496], [18755497, 19797468], [19797469, 20839444]] SRR7473363 file size 7040103 SRR7473363 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473363 SRR7473363_1.fastq SRR7473363_2.fastq Input file: SRR7473363_1.fastq Paired file: SRR7473363_2.fastq trimmed: SRR7473363-trimmed-pair1.fastq, SRR7473363-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:07:12 2024 >> started Sat Dec 7 15:07:33 2024 >> done (21.368s) 20839444 read pairs processed; of these: 50259 ( 0.24%) short read pairs filtered out after trimming by size control 73711 ( 0.35%) empty read pairs filtered out after trimming by size control 20715474 (99.41%) read pairs available; of these: 12040620 (58.12%) trimmed read pairs available after processing 8674854 (41.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 20 0.00% 20 24 0.00% 21 25 0.00% 22 20 0.00% 23 37 0.00% 24 27 0.00% 25 23 0.00% 26 27 0.00% 27 36 0.00% 28 42 0.00% 29 39 0.00% 30 32 0.00% 31 31 0.00% 32 54 0.00% 33 41 0.00% 34 40 0.00% 35 59 0.00% 36 62 0.00% 37 66 0.00% 38 69 0.00% 39 69 0.00% 40 88 0.00% 41 91 0.00% 42 88 0.00% 43 113 0.00% 44 122 0.00% 45 136 0.00% 46 143 0.00% 47 148 0.00% 48 204 0.00% 49 213 0.00% 50 239 0.00% 51 280 0.00% 52 283 0.00% 53 280 0.00% 54 336 0.00% 55 365 0.00% 56 352 0.00% 57 416 0.00% 58 504 0.00% 59 562 0.00% 60 611 0.00% 61 738 0.00% 62 763 0.00% 63 908 0.00% 64 1018 0.00% 65 1107 0.01% 66 1397 0.01% 67 1835 0.01% 68 2296 0.01% 69 6369 0.03% 70 6774 0.03% 71 3286 0.02% 72 2711 0.01% 73 2726 0.01% 74 2892 0.01% 75 3144 0.02% 76 3344 0.02% 77 3786 0.02% 78 4118 0.02% 79 4592 0.02% 80 5084 0.02% 81 5701 0.03% 82 6256 0.03% 83 7565 0.04% 84 9946 0.05% 85 10896 0.05% 86 11194 0.05% 87 11525 0.06% 88 12464 0.06% 89 13042 0.06% 90 13681 0.07% 91 14694 0.07% 92 15521 0.07% 93 17395 0.08% 94 18538 0.09% 95 19388 0.09% 96 19913 0.10% 97 20705 0.10% 98 21117 0.10% 99 22242 0.11% 100 23792 0.11% 101 24641 0.12% 102 26124 0.13% 103 27728 0.13% 104 29880 0.14% 105 31460 0.15% 106 32841 0.16% 107 33028 0.16% 108 34518 0.17% 109 36540 0.18% 110 38007 0.18% 111 38525 0.19% 112 40510 0.20% 113 43737 0.21% 114 44558 0.22% 115 46641 0.23% 116 48670 0.23% 117 49296 0.24% 118 50767 0.25% 119 51932 0.25% 120 54789 0.26% 121 56305 0.27% 122 58812 0.28% 123 61411 0.30% 124 65904 0.32% 125 66704 0.32% 126 69234 0.33% 127 71854 0.35% 128 73385 0.35% 129 76942 0.37% 130 79280 0.38% 131 82849 0.40% 132 87366 0.42% 133 91207 0.44% 134 96221 0.46% 135 102417 0.49% 136 108582 0.52% 137 114034 0.55% 138 121595 0.59% 139 130626 0.63% 140 139602 0.67% 141 153522 0.74% 142 171818 0.83% 143 194486 0.94% 144 227218 1.10% 145 274181 1.32% 146 341957 1.65% 147 461320 2.23% 148 702129 3.39% 149 1300435 6.28% 150 5314127 25.65% 151 8674854 41.88% 20715474 reads passed initial QC criterion=sequence-density sequence-density=1.38 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=10 prefix-density=1.43 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=12.41 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.2 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=14 prefix-density=1.06 prefix-fanout=3.1 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=54.53 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473363 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:08:14 Started mapping on | Dec 07 15:08:14 Finished on | Dec 07 15:11:28 Mapping speed, Million of reads per hour | 384.41 Number of input reads | 20715474 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19444497 Uniquely mapped reads % | 93.86% Average mapped length | 291.99 Number of splices: Total | 20502648 Number of splices: Annotated (sjdb) | 19337381 Number of splices: GT/AG | 20244421 Number of splices: GC/AG | 229198 Number of splices: AT/AC | 8362 Number of splices: Non-canonical | 20667 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 163468 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 22309 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.52% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1135788 1135788 1135788 N_multimapping 163468 163468 163468 N_noFeature 592638 18818685 827948 N_ambiguous 457458 2532 67858 UnstrandedReadsAssigned:18394401 PositiveStrandReadsAssigned:623280 NegativeStrandReadsAssigned:18548691 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473363 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473363-trimmed-pair1.fastq SRR7473363-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,715,474 reads, 18,610,634 reads pseudoaligned [quant] estimated average fragment length: 270.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR7473363.ke.tsv 35125 SRR7473363.se.tsv 88098 total ==> SRR7473363.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.723 0 0 PNS24247 1044 774.909 36.4512 3.31555 PNS24249 1928 1658.91 49.5246 2.10422 PNS24246 1044 774.909 36.4512 3.31555 PNS24248 1044 774.909 36.4512 3.31555 PNS24244 1471 1201.91 76.1218 4.46407 PNS24243 293 92.731 0 0 KQK14069 1603 1333.91 209.13 11.0506 KQK14071 474 229.229 41.1986 12.6679 ==> SRR7473363.se.tsv <== BRADI_1g14170v3 553 BRADI_1g53295v3 36 BRADI_1g59795v3 223 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 1419 BRADI_1g74790v3 246 BRADI_1g09890v3 8 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR7473363 completed mapping pipeline successfully