Starting /dee2/code/volunteer_pipeline.sh SRR7473365 current disk space = 1542512857088 free memory = 1602363284 SRR7473365 SRAfilesize 39dcbb732c02ba725ede3d7974da26cd SRR7473365.sra SRR7473365.sra file validated SRR7473365 is paired end SRR7473365 is conventional basespace SRR7473365 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.938 34.0 33.0 34.0 32.0 34.0 2 33.2335 34.0 33.0 34.0 32.0 34.0 3 33.27175 34.0 33.0 34.0 32.0 34.0 4 33.30525 34.0 33.0 34.0 33.0 34.0 5 33.1405 34.0 33.0 34.0 32.0 34.0 6 36.753 38.0 37.0 38.0 35.0 38.0 7 37.20075 38.0 38.0 38.0 36.0 38.0 8 37.28975 38.0 38.0 38.0 37.0 38.0 9 37.331 38.0 38.0 38.0 37.0 38.0 10-14 37.34055 38.0 38.0 38.0 37.0 38.0 15-19 37.308949999999996 38.0 38.0 38.0 36.8 38.0 20-24 37.364549999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.169050000000006 38.0 38.0 38.0 36.6 38.0 30-34 37.0028 38.0 38.0 38.0 36.0 38.0 35-39 36.9571 38.0 38.0 38.0 36.0 38.0 40-44 36.63295000000001 38.0 38.0 38.0 34.8 38.0 45-49 36.66180000000001 38.0 38.0 38.0 34.2 38.0 50-54 36.58389999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.70235 38.0 38.0 38.0 34.0 38.0 60-64 36.537 38.0 38.0 38.0 34.2 38.0 65-69 36.29575 38.0 37.8 38.0 33.6 38.0 70-74 36.173500000000004 38.0 37.4 38.0 33.2 38.0 75-79 36.25805 38.0 37.6 38.0 33.2 38.0 80-84 36.08055 38.0 37.0 38.0 33.0 38.0 85-89 35.93275 38.0 37.0 38.0 32.4 38.0 90-94 35.5959 38.0 36.4 38.0 30.6 38.0 95-99 35.27755 38.0 36.0 38.0 29.0 38.0 100-104 35.08725 38.0 35.6 38.0 28.2 38.0 105-109 34.8579 38.0 35.0 38.0 27.6 38.0 110-114 34.60065000000001 38.0 35.0 38.0 26.6 38.0 115-119 34.056149999999995 38.0 34.2 38.0 22.6 38.0 120-124 33.75645 38.0 34.0 38.0 22.2 38.0 125-129 32.990050000000004 38.0 33.2 38.0 15.0 38.0 130-134 32.59955 38.0 33.0 38.0 14.8 38.0 135-139 31.8388 36.6 31.8 38.0 13.8 38.0 140-144 31.262099999999997 36.0 31.0 38.0 13.2 38.0 145-149 29.479449999999996 35.8 27.4 38.0 4.2 38.0 150-151 24.503 32.0 14.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 4.0 13 2.0 14 1.0 15 4.0 16 5.0 17 11.0 18 10.0 19 6.0 20 12.0 21 12.0 22 14.0 23 12.0 24 21.0 25 29.0 26 36.0 27 49.0 28 51.0 29 70.0 30 94.0 31 102.0 32 118.0 33 180.0 34 224.0 35 467.0 36 955.0 37 1507.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.91001267427123 13.967046894803548 10.646387832699618 36.4765525982256 2 25.47051442910916 17.314930991217064 31.794228356336262 25.420326223337515 3 22.475 22.725 26.1 28.7 4 26.525 28.749999999999996 20.8 23.925 5 24.849246231155778 32.914572864321606 22.01005025125628 20.22613065326633 6 23.05 31.45 23.200000000000003 22.3 7 18.05 20.625 38.550000000000004 22.775000000000002 8 21.675 22.225 26.900000000000002 29.2 9 22.525000000000002 19.85 29.549999999999997 28.075 10-14 23.865 24.685000000000002 24.29 27.16 15-19 23.605 24.279999999999998 25.245 26.87 20-24 23.505000000000003 24.84 25.345000000000002 26.31 25-29 23.485 24.785 25.130000000000003 26.6 30-34 23.87 24.845 24.715 26.57 35-39 23.88216464939482 24.21226367910373 25.497649294788438 26.407922376713017 40-44 23.6092333884132 25.076360723048417 25.196534975714783 26.117870912823594 45-49 24.297148574287146 24.497248624312157 24.32216108054027 26.88344172086043 50-54 23.919999999999998 24.915000000000003 24.465 26.700000000000003 55-59 23.674999999999997 24.705 24.705 26.915 60-64 24.490000000000002 24.415 24.65 26.445 65-69 24.175 24.8 24.465 26.56 70-74 24.245 24.08 24.865000000000002 26.810000000000002 75-79 24.075 23.990000000000002 25.035 26.900000000000002 80-84 24.441222061103055 24.39121956097805 24.23621181059053 26.93134656732837 85-89 24.395 24.365000000000002 24.404999999999998 26.834999999999997 90-94 24.71477181745396 24.514611689351483 24.419535628502803 26.351080864691756 95-99 25.04888443218852 23.830533968413135 24.41213336675859 26.70844823263976 100-104 25.330000000000002 24.575 23.61 26.484999999999996 105-109 24.685000000000002 24.0 24.26 27.055 110-114 24.98 23.990000000000002 24.42 26.61 115-119 24.5 24.01 24.3 27.189999999999998 120-124 25.30518310986592 24.244546728036823 23.969381628977388 26.480888533119874 125-129 24.82319305813312 23.92034909966394 24.557355670361638 26.6991021718413 130-134 25.266346882100482 23.983842464024235 23.83236556425145 26.917445089623833 135-139 24.913006203035955 24.191840234000704 23.889253114125776 27.00590044883756 140-144 25.126483995391474 24.259880779441968 23.914241346491007 26.699393878675547 145-149 25.07941309937982 24.323097867191045 24.126455906821963 26.471033126607168 150-151 25.335527981767537 23.74018738921246 23.448974423904787 27.475310205115218 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 2.0 28 3.5 29 6.5 30 8.0 31 11.0 32 16.5 33 19.5 34 23.0 35 30.5 36 40.5 37 57.0 38 72.5 39 91.5 40 116.5 41 137.5 42 146.5 43 139.0 44 151.0 45 170.0 46 174.0 47 175.5 48 168.5 49 150.0 50 132.0 51 121.5 52 131.5 53 142.0 54 140.5 55 128.5 56 113.5 57 123.5 58 117.5 59 100.5 60 83.5 61 79.0 62 84.0 63 73.0 64 70.5 65 71.0 66 60.5 67 51.0 68 53.5 69 49.5 70 38.5 71 27.5 72 20.0 73 18.0 74 17.0 75 15.0 76 8.5 77 5.0 78 4.5 79 3.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.375 3 0.0 4 0.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.145 45-49 0.05 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.08 95-99 0.27499999999999997 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.06 125-129 0.315 130-134 0.975 135-139 0.855 140-144 0.185 145-149 0.835 150-151 1.275 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57506361323155 96.85000000000001 2 1.1450381679389312 2.25 3 0.2035623409669211 0.6 4 0.07633587786259542 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.9 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.7125000000000004 0.0 0.0 0.0 0.0 128-129 4.175000000000001 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473365 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473365_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.863 33.0 33.0 34.0 31.0 34.0 2 32.1285 33.0 33.0 34.0 32.0 34.0 3 32.08125 34.0 33.0 34.0 31.0 34.0 4 32.064 34.0 33.0 34.0 31.0 34.0 5 31.9495 34.0 33.0 34.0 31.0 34.0 6 36.083 38.0 38.0 38.0 34.0 38.0 7 36.24575 38.0 38.0 38.0 34.0 38.0 8 36.426 38.0 38.0 38.0 34.0 38.0 9 36.498 38.0 38.0 38.0 35.0 38.0 10-14 36.54035 38.0 38.0 38.0 35.6 38.0 15-19 36.32235 38.0 38.0 38.0 35.0 38.0 20-24 35.84160000000001 38.0 38.0 38.0 33.6 38.0 25-29 36.0894 38.0 38.0 38.0 34.6 38.0 30-34 36.12375 38.0 38.0 38.0 34.6 38.0 35-39 36.064099999999996 38.0 38.0 38.0 34.6 38.0 40-44 36.09654999999999 38.0 38.0 38.0 34.8 38.0 45-49 35.9637 38.0 38.0 38.0 34.0 38.0 50-54 35.95605 38.0 38.0 38.0 34.0 38.0 55-59 35.903549999999996 38.0 38.0 38.0 34.2 38.0 60-64 35.84015 38.0 38.0 38.0 33.6 38.0 65-69 35.533699999999996 38.0 38.0 38.0 32.2 38.0 70-74 35.5411 38.0 38.0 38.0 31.8 38.0 75-79 35.487899999999996 38.0 38.0 38.0 31.8 38.0 80-84 35.454950000000004 38.0 38.0 38.0 31.6 38.0 85-89 35.25635 38.0 37.8 38.0 30.8 38.0 90-94 35.07710000000001 38.0 37.4 38.0 29.4 38.0 95-99 34.5398 38.0 36.8 38.0 26.6 38.0 100-104 33.739850000000004 38.0 35.8 38.0 18.6 38.0 105-109 33.7432 38.0 35.6 38.0 18.6 38.0 110-114 33.363299999999995 38.0 35.0 38.0 15.0 38.0 115-119 33.0081 38.0 34.2 38.0 14.2 38.0 120-124 32.8837 38.0 34.0 38.0 14.0 38.0 125-129 32.4054 38.0 34.0 38.0 13.2 38.0 130-134 31.9137 38.0 32.8 38.0 13.0 38.0 135-139 31.3899 38.0 31.2 38.0 8.6 38.0 140-144 30.619850000000003 37.8 30.2 38.0 2.0 38.0 145-149 29.09955 36.4 27.4 38.0 2.0 38.0 150-151 23.56075 31.0 2.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 41.0 3 25.0 4 24.0 5 5.0 6 2.0 7 2.0 8 3.0 9 4.0 10 3.0 11 4.0 12 6.0 13 7.0 14 7.0 15 9.0 16 10.0 17 15.0 18 10.0 19 18.0 20 15.0 21 18.0 22 14.0 23 28.0 24 52.0 25 21.0 26 27.0 27 42.0 28 50.0 29 48.0 30 55.0 31 78.0 32 102.0 33 134.0 34 178.0 35 293.0 36 698.0 37 1952.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.87682832948422 17.449319989735695 13.189633051064922 29.484218629715166 2 31.0617662072486 20.82695252679939 26.56967840735069 21.541602858601326 3 23.417883679221113 25.493210351012042 26.953625416346398 24.135280553420447 4 25.810569313249935 31.937707429154965 19.17283635435282 23.078886903242278 5 26.79989751473226 31.92416090187036 18.6010760953113 22.674865488086088 6 24.680306905370845 33.96419437340153 18.286445012787723 23.0690537084399 7 22.76649746192893 18.299492385786802 33.07106598984772 25.862944162436545 8 23.43592330978809 21.46821392532795 23.41069626639758 31.685166498486378 9 23.383458646616543 22.431077694235587 26.36591478696742 27.819548872180448 10-14 26.518421845196265 24.66619817287421 22.211625338821403 26.603754643108125 15-19 26.501999291390394 24.219264058308447 23.485346965632434 25.79338968466873 20-24 27.178359582736753 24.887502556760076 22.94947842094498 24.98465943955819 25-29 26.427663361301807 25.095347063310452 23.3257055682685 25.151284007119244 30-34 26.373012244068484 24.437331707564905 23.17736117461769 26.01229487374892 35-39 26.704978894370136 24.518130498906576 22.885622743223312 25.891267863499973 40-44 27.00796590390177 24.247805571058905 23.05545689786392 25.6887716271754 45-49 26.62182133211028 24.70060643122866 23.136115782500127 25.541456454160933 50-54 26.59633818532231 24.892224983516762 22.970025866003958 25.54141096515697 55-59 27.311009639776763 24.008117706747846 23.0441400304414 25.636732623033993 60-64 26.965948999847306 23.845879778083166 23.479411615004835 25.708759607064692 65-69 26.924847802731875 24.484575638205353 23.062362510871235 25.52821404819154 70-74 27.416814833629665 23.66268732537465 23.114046228092455 25.806451612903224 75-79 26.22859458911744 23.89806464687405 23.69034349984801 26.1829972641605 80-84 26.936690938511326 24.246561488673137 23.538632686084142 25.27811488673139 85-89 27.187894073139972 23.62673392181589 23.308953341740228 25.87641866330391 90-94 26.455214412585637 23.643745242324282 24.034509007866024 25.866531337224053 95-99 27.339421301046585 24.117586702236814 23.301867432792942 25.241124563923663 100-104 26.734216679657052 24.416731618602235 23.107300597557806 25.741751104182903 105-109 27.429312581063552 24.269779507133592 23.30998702983139 24.990920881971466 110-114 27.514378983367017 24.477952225503913 23.20327478107674 24.804394010052334 115-119 27.124961176105188 24.588466714980846 23.13904130862408 25.147530800289886 120-124 27.590305410573094 24.737739651697588 23.15642602449486 24.51552891323446 125-129 27.90902497150554 25.126929851828827 22.821469277795046 24.142575898870582 130-134 27.362643053182122 25.203252032520325 23.02832582465952 24.40577908963803 135-139 27.394802931679564 25.26267233868074 23.099789862129054 24.242734867510634 140-144 27.92843594607064 24.816732455016147 22.750807402470908 24.504024196442302 145-149 27.765202181294374 25.095174400658504 23.35631237781665 23.783311040230476 150-151 29.0077336479224 25.075370297548826 22.34893170795648 23.56796434657229 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 3.0 2 4.0 3 6.5 4 7.0 5 5.5 6 3.5 7 2.5 8 1.0 9 2.0 10 2.5 11 2.0 12 2.5 13 2.5 14 2.0 15 2.5 16 2.0 17 1.0 18 1.0 19 1.5 20 3.0 21 2.5 22 0.5 23 1.5 24 3.0 25 2.5 26 3.0 27 3.0 28 6.5 29 9.0 30 4.0 31 6.5 32 8.0 33 9.0 34 18.5 35 29.0 36 34.5 37 39.5 38 46.5 39 59.0 40 77.0 41 105.0 42 127.0 43 131.0 44 134.0 45 148.0 46 164.0 47 161.5 48 150.0 49 139.0 50 152.5 51 145.0 52 116.0 53 119.5 54 130.0 55 138.0 56 127.0 57 114.5 58 117.0 59 112.0 60 97.5 61 102.0 62 105.5 63 88.0 64 78.5 65 71.5 66 71.0 67 72.5 68 70.0 69 65.5 70 54.0 71 45.0 72 40.0 73 30.5 74 18.5 75 11.0 76 8.5 77 5.0 78 2.5 79 2.0 80 2.5 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 2.0500000000000003 3 2.4250000000000003 4 2.075 5 2.4250000000000003 6 2.25 7 1.5 8 0.8999999999999999 9 0.25 10-14 0.38999999999999996 15-19 1.2149999999999999 20-24 2.22 25-29 1.675 30-34 1.585 35-39 1.685 40-44 1.455 45-49 1.8849999999999998 50-54 1.415 55-59 1.4500000000000002 60-64 1.765 65-69 2.265 70-74 1.575 75-79 1.31 80-84 1.1199999999999999 85-89 0.8750000000000001 90-94 1.4749999999999999 95-99 2.54 100-104 3.775 105-109 3.6249999999999996 110-114 3.505 115-119 3.4099999999999997 120-124 3.245 125-129 3.49 130-134 3.4450000000000003 135-139 2.445 140-144 2.465 145-149 2.81 150-151 4.6375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.38792221084954 96.125 2 1.2538382804503583 2.45 3 0.2047082906857728 0.6 4 0.0511770726714432 0.2 5 0.0511770726714432 0.25 6 0.0255885363357216 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0255885363357216 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 9 0.22499999999999998 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8875000000000002 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.4625000000000004 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.925 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCCT 10 0.006931967 144.26582 6 TCCCTGG 10 0.0072010965 142.4625 8 >>END_MODULE Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285375 spots for SRR7473365.sra Written 1285375 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra Read 1285374 spots for SRR7473365.sra Written 1285374 spots for SRR7473365.sra SRR ids: ['SRR7473365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ljyulcrn SRR7473365.sra spots: 25707481 blocks: [[1, 1285374], [1285375, 2570748], [2570749, 3856122], [3856123, 5141496], [5141497, 6426870], [6426871, 7712244], [7712245, 8997618], [8997619, 10282992], [10282993, 11568366], [11568367, 12853740], [12853741, 14139114], [14139115, 15424488], [15424489, 16709862], [16709863, 17995236], [17995237, 19280610], [19280611, 20565984], [20565985, 21851358], [21851359, 23136732], [23136733, 24422106], [24422107, 25707481]] SRR7473365 file size 8689721 SRR7473365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473365 SRR7473365_1.fastq SRR7473365_2.fastq Input file: SRR7473365_1.fastq Paired file: SRR7473365_2.fastq trimmed: SRR7473365-trimmed-pair1.fastq, SRR7473365-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:18:09 2024 >> started Sat Dec 7 15:18:40 2024 >> done (31.680s) 25707481 read pairs processed; of these: 51455 ( 0.20%) short read pairs filtered out after trimming by size control 96489 ( 0.38%) empty read pairs filtered out after trimming by size control 25559537 (99.42%) read pairs available; of these: 15415420 (60.31%) trimmed read pairs available after processing 10144117 (39.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 15 0.00% 20 12 0.00% 21 14 0.00% 22 19 0.00% 23 17 0.00% 24 32 0.00% 25 20 0.00% 26 30 0.00% 27 30 0.00% 28 37 0.00% 29 34 0.00% 30 38 0.00% 31 36 0.00% 32 48 0.00% 33 50 0.00% 34 30 0.00% 35 52 0.00% 36 60 0.00% 37 77 0.00% 38 72 0.00% 39 72 0.00% 40 88 0.00% 41 94 0.00% 42 118 0.00% 43 114 0.00% 44 136 0.00% 45 117 0.00% 46 191 0.00% 47 198 0.00% 48 210 0.00% 49 255 0.00% 50 302 0.00% 51 360 0.00% 52 442 0.00% 53 379 0.00% 54 350 0.00% 55 408 0.00% 56 446 0.00% 57 489 0.00% 58 549 0.00% 59 618 0.00% 60 693 0.00% 61 780 0.00% 62 908 0.00% 63 977 0.00% 64 1097 0.00% 65 1235 0.00% 66 1521 0.01% 67 2307 0.01% 68 4110 0.02% 69 7294 0.03% 70 5456 0.02% 71 2884 0.01% 72 2904 0.01% 73 2982 0.01% 74 3204 0.01% 75 3503 0.01% 76 3714 0.01% 77 4002 0.02% 78 4330 0.02% 79 4796 0.02% 80 5304 0.02% 81 5983 0.02% 82 6879 0.03% 83 8121 0.03% 84 10377 0.04% 85 11237 0.04% 86 11724 0.05% 87 12135 0.05% 88 12897 0.05% 89 13410 0.05% 90 14779 0.06% 91 15649 0.06% 92 17057 0.07% 93 19137 0.07% 94 20564 0.08% 95 21684 0.08% 96 22692 0.09% 97 23415 0.09% 98 23775 0.09% 99 25145 0.10% 100 26263 0.10% 101 27460 0.11% 102 29714 0.12% 103 32074 0.13% 104 34406 0.13% 105 37447 0.15% 106 38071 0.15% 107 38776 0.15% 108 40134 0.16% 109 42031 0.16% 110 43501 0.17% 111 44420 0.17% 112 47538 0.19% 113 52007 0.20% 114 53407 0.21% 115 56895 0.22% 116 58673 0.23% 117 59461 0.23% 118 60351 0.24% 119 61667 0.24% 120 64895 0.25% 121 67268 0.26% 122 71212 0.28% 123 74855 0.29% 124 80737 0.32% 125 82731 0.32% 126 85828 0.34% 127 88924 0.35% 128 90869 0.36% 129 94114 0.37% 130 98066 0.38% 131 102042 0.40% 132 108007 0.42% 133 115531 0.45% 134 122688 0.48% 135 131354 0.51% 136 140195 0.55% 137 149730 0.59% 138 157804 0.62% 139 169701 0.66% 140 183162 0.72% 141 203098 0.79% 142 226837 0.89% 143 259042 1.01% 144 304746 1.19% 145 366484 1.43% 146 463039 1.81% 147 626503 2.45% 148 938757 3.67% 149 1781301 6.97% 150 6714275 26.27% 151 10144117 39.69% 25559537 reads passed initial QC criterion=sequence-density sequence-density=1.28 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=12 prefix-density=1.33 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=64.77 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.4 sequence=GCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=10 prefix-density=1.05 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=87.58 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473365 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:19:50 Started mapping on | Dec 07 15:19:50 Finished on | Dec 07 15:24:30 Mapping speed, Million of reads per hour | 328.62 Number of input reads | 25559537 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 23799786 Uniquely mapped reads % | 93.12% Average mapped length | 292.28 Number of splices: Total | 25369166 Number of splices: Annotated (sjdb) | 23945345 Number of splices: GT/AG | 25056580 Number of splices: GC/AG | 279351 Number of splices: AT/AC | 11114 Number of splices: Non-canonical | 22121 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205801 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 32516 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.08% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1580349 1580349 1580349 N_multimapping 205801 205801 205801 N_noFeature 696146 23068814 952153 N_ambiguous 557574 3119 83886 UnstrandedReadsAssigned:22546066 PositiveStrandReadsAssigned:727853 NegativeStrandReadsAssigned:22763747 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7473365 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473365-trimmed-pair1.fastq SRR7473365-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,559,537 reads, 22,845,413 reads pseudoaligned [quant] estimated average fragment length: 272.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR7473365.ke.tsv 35125 SRR7473365.se.tsv 88098 total ==> SRR7473365.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.726 5.90381 0.498371 PNS24247 1044 772.102 34.897 2.53616 PNS24249 1928 1656.1 55.7762 1.88984 PNS24246 1044 772.102 34.897 2.53616 PNS24248 1044 772.102 34.897 2.53616 PNS24244 1471 1199.1 87.6291 4.10068 PNS24243 293 90.6635 0 0 KQK14069 1603 1331.1 268.132 11.3032 KQK14071 474 226.697 10.7712 2.66613 ==> SRR7473365.se.tsv <== BRADI_1g14170v3 359 BRADI_1g53295v3 36 BRADI_1g59795v3 253 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2367 BRADI_1g74790v3 229 BRADI_1g09890v3 9 BRADI_1g77505v3 350 BRADI_1g48960v3 0 SRR7473365 completed mapping pipeline successfully