Starting /dee2/code/volunteer_pipeline.sh SRR7473366 current disk space = 1542545506304 free memory = 1593967228 SRR7473366 SRAfilesize 7b853c785aed10af9eaa0ad6f7735006 SRR7473366.sra SRR7473366.sra file validated SRR7473366 is paired end SRR7473366 is conventional basespace SRR7473366 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3135 34.0 33.0 34.0 33.0 34.0 2 33.38225 34.0 34.0 34.0 33.0 34.0 3 33.45625 34.0 34.0 34.0 33.0 34.0 4 33.4305 34.0 34.0 34.0 33.0 34.0 5 33.4605 34.0 34.0 34.0 33.0 34.0 6 37.25975 38.0 38.0 38.0 36.0 38.0 7 37.5305 38.0 38.0 38.0 37.0 38.0 8 37.582 38.0 38.0 38.0 38.0 38.0 9 37.6115 38.0 38.0 38.0 38.0 38.0 10-14 37.54565000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.4735 38.0 38.0 38.0 37.8 38.0 20-24 37.52355 38.0 38.0 38.0 38.0 38.0 25-29 37.45354999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.180099999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.1864 38.0 38.0 38.0 37.0 38.0 40-44 37.1739 38.0 38.0 38.0 36.4 38.0 45-49 37.12035 38.0 38.0 38.0 36.2 38.0 50-54 36.95055000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.07305 38.0 38.0 38.0 36.0 38.0 60-64 37.07715 38.0 38.0 38.0 36.0 38.0 65-69 36.875350000000005 38.0 38.0 38.0 35.6 38.0 70-74 36.6707 38.0 38.0 38.0 34.8 38.0 75-79 36.81215 38.0 38.0 38.0 35.0 38.0 80-84 36.7273 38.0 38.0 38.0 35.0 38.0 85-89 36.701 38.0 38.0 38.0 34.8 38.0 90-94 36.423 38.0 38.0 38.0 33.8 38.0 95-99 36.19930000000001 38.0 38.0 38.0 33.8 38.0 100-104 36.06555 38.0 37.0 38.0 33.0 38.0 105-109 36.0079 38.0 37.0 38.0 33.0 38.0 110-114 35.62665 38.0 36.4 38.0 31.0 38.0 115-119 35.1593 38.0 36.0 38.0 28.2 38.0 120-124 35.06565 38.0 35.6 38.0 28.4 38.0 125-129 34.699349999999995 38.0 35.0 38.0 27.4 38.0 130-134 34.228300000000004 38.0 35.0 38.0 24.4 38.0 135-139 33.592999999999996 38.0 34.0 38.0 21.4 38.0 140-144 33.371399999999994 38.0 34.0 38.0 20.2 38.0 145-149 32.45735 38.0 33.4 38.0 14.0 38.0 150-151 28.1435 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 4.0 15 1.0 16 1.0 17 2.0 18 4.0 19 3.0 20 6.0 21 11.0 22 13.0 23 14.0 24 16.0 25 15.0 26 22.0 27 21.0 28 26.0 29 44.0 30 44.0 31 54.0 32 83.0 33 120.0 34 184.0 35 308.0 36 775.0 37 2222.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.738955823293175 10.993975903614457 11.04417670682731 43.22289156626506 2 23.573573573573572 15.665665665665665 34.109109109109106 26.651651651651655 3 21.825 21.45 23.25 33.475 4 27.800000000000004 28.275 19.575 24.349999999999998 5 26.325 30.349999999999998 22.95 20.375 6 21.349999999999998 32.725 23.95 21.975 7 17.2 21.3 41.825 19.675 8 19.85 23.075000000000003 29.9 27.175 9 19.900000000000002 19.650000000000002 33.975 26.474999999999998 10-14 22.66 26.240000000000002 25.82 25.28 15-19 23.145 25.619999999999997 25.929999999999996 25.305 20-24 22.720000000000002 25.919999999999998 25.955000000000002 25.405 25-29 23.215 25.35 25.915 25.52 30-34 23.25 24.8 25.825 26.125 35-39 23.12615630781539 25.231261563078156 25.621281064053203 26.021301065053255 40-44 23.403191116890913 25.238833591757114 25.6489771419997 25.708998149352276 45-49 22.772277227722775 25.377537753775375 25.59255925592559 26.257625762576257 50-54 22.84 25.180000000000003 25.935000000000002 26.045 55-59 23.205000000000002 25.36 25.900000000000002 25.535000000000004 60-64 23.25 24.505 25.724999999999998 26.52 65-69 22.96 25.2 25.595000000000002 26.245 70-74 23.135 25.624999999999996 25.61 25.629999999999995 75-79 23.44 25.474999999999998 25.290000000000003 25.795 80-84 22.975 25.53 25.89 25.605 85-89 23.255 24.925 25.745 26.075 90-94 23.08231173380035 25.559169377032774 25.038779084313234 26.319739804853644 95-99 23.3056361998198 24.792271498648514 25.613174491941137 26.28891780959055 100-104 23.77 24.81 25.605 25.814999999999998 105-109 23.39 24.93 25.8 25.88 110-114 23.51 25.324999999999996 25.119999999999997 26.045 115-119 23.635 24.755 25.965 25.645 120-124 23.669999999999998 24.875 25.45 26.005 125-129 23.325000000000003 25.290000000000003 25.6 25.785000000000004 130-134 23.642556601883392 25.38068523342016 25.43578441194149 25.540973752754958 135-139 23.209269662921347 25.88282504012841 25.095304975922954 25.812600321027286 140-144 24.00980196039208 24.96999399879976 25.33506701340268 25.68513702740548 145-149 24.158316633266534 25.005010020040082 25.260521042084168 25.576152304609217 150-151 23.56559949780289 25.28562460765851 24.670433145009415 26.478342749529187 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 2.0 27 1.5 28 2.5 29 3.5 30 6.0 31 10.0 32 13.0 33 20.0 34 28.0 35 32.5 36 46.0 37 60.0 38 79.5 39 108.0 40 136.5 41 146.5 42 155.0 43 171.5 44 181.5 45 197.0 46 196.5 47 200.5 48 203.0 49 181.0 50 165.0 51 153.0 52 148.0 53 138.0 54 131.0 55 117.5 56 100.5 57 104.5 58 91.5 59 81.0 60 73.5 61 68.5 62 60.5 63 55.0 64 57.5 65 49.0 66 35.0 67 33.5 68 35.5 69 26.0 70 25.0 71 21.5 72 15.0 73 10.5 74 7.5 75 5.0 76 1.5 77 1.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.034999999999999996 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.075 95-99 0.11 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.18 135-139 0.32 140-144 0.02 145-149 0.2 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0125 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.025 0.025 0.0 66-67 0.0 0.0 0.025 0.025 0.0 68-69 0.0 0.0 0.025 0.025 0.0 70-71 0.0125 0.0 0.025 0.025 0.0 72-73 0.037500000000000006 0.0 0.025 0.025 0.0 74-75 0.05 0.0 0.025 0.025 0.0 76-77 0.05 0.0 0.025 0.025 0.0 78-79 0.075 0.0 0.025 0.025 0.0 80-81 0.075 0.0 0.025 0.025 0.0 82-83 0.075 0.0 0.025 0.025 0.0 84-85 0.0875 0.0 0.025 0.025 0.0 86-87 0.16249999999999998 0.0 0.025 0.025 0.0 88-89 0.175 0.0 0.025 0.025 0.0 90-91 0.1875 0.0 0.025 0.025 0.0 92-93 0.225 0.0 0.025 0.025 0.0 94-95 0.3125 0.0 0.025 0.025 0.0 96-97 0.425 0.0 0.025 0.025 0.0 98-99 0.675 0.0 0.025 0.025 0.0 100-101 0.8374999999999999 0.0 0.025 0.025 0.0 102-103 0.9625 0.0 0.025 0.025 0.0 104-105 1.1124999999999998 0.0 0.025 0.025 0.0 106-107 1.275 0.0 0.025 0.025 0.0 108-109 1.425 0.0 0.025 0.025 0.0 110-111 1.575 0.0 0.025 0.025 0.0 112-113 1.85 0.0 0.025 0.025 0.0 114-115 2.0625 0.0 0.025 0.025 0.0 116-117 2.3625 0.0 0.025 0.025 0.0 118-119 2.625 0.0 0.025 0.025 0.0 120-121 2.9 0.0 0.025 0.025 0.0 122-123 3.225 0.0 0.025 0.025 0.0 124-125 3.5875 0.0 0.025 0.025 0.0 126-127 3.9375 0.0 0.025 0.025 0.0 128-129 4.2875 0.0 0.025 0.025 0.0 130-131 4.6 0.0 0.025 0.025 0.0 132-133 5.0 0.0 0.025 0.025 0.0 134-135 5.262499999999999 0.0 0.025 0.025 0.0 136-137 5.5625 0.0 0.025 0.025 0.0 138-139 5.9 0.0 0.025 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473366 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.17175 33.0 33.0 34.0 32.0 34.0 2 32.08225 33.0 33.0 34.0 32.0 34.0 3 32.2715 34.0 33.0 34.0 32.0 34.0 4 32.06 34.0 33.0 34.0 32.0 34.0 5 32.119 34.0 33.0 34.0 32.0 34.0 6 36.772 38.0 38.0 38.0 35.0 38.0 7 36.98175 38.0 38.0 38.0 36.0 38.0 8 36.97225 38.0 38.0 38.0 36.0 38.0 9 37.031 38.0 38.0 38.0 36.0 38.0 10-14 37.061 38.0 38.0 38.0 36.8 38.0 15-19 36.94945 38.0 38.0 38.0 36.2 38.0 20-24 36.78830000000001 38.0 38.0 38.0 36.4 38.0 25-29 36.79785 38.0 38.0 38.0 36.0 38.0 30-34 36.89265 38.0 38.0 38.0 36.6 38.0 35-39 36.74565 38.0 38.0 38.0 36.2 38.0 40-44 36.81325 38.0 38.0 38.0 36.0 38.0 45-49 36.6511 38.0 38.0 38.0 36.0 38.0 50-54 36.6572 38.0 38.0 38.0 36.0 38.0 55-59 36.748999999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.581599999999995 38.0 38.0 38.0 35.6 38.0 65-69 36.16565 38.0 38.0 38.0 34.2 38.0 70-74 36.4105 38.0 38.0 38.0 34.8 38.0 75-79 36.49105000000001 38.0 38.0 38.0 35.0 38.0 80-84 36.34465 38.0 38.0 38.0 34.2 38.0 85-89 36.25975 38.0 38.0 38.0 34.0 38.0 90-94 36.11875 38.0 38.0 38.0 34.0 38.0 95-99 35.706950000000006 38.0 38.0 38.0 32.6 38.0 100-104 35.1502 38.0 37.0 38.0 29.6 38.0 105-109 35.020599999999995 38.0 37.0 38.0 29.0 38.0 110-114 34.725649999999995 38.0 36.2 38.0 27.6 38.0 115-119 34.21634999999999 38.0 36.0 38.0 23.4 38.0 120-124 34.2725 38.0 35.6 38.0 24.0 38.0 125-129 34.020799999999994 38.0 35.0 38.0 22.8 38.0 130-134 33.729749999999996 38.0 34.6 38.0 21.0 38.0 135-139 33.43275 38.0 34.4 38.0 19.8 38.0 140-144 32.82190000000001 38.0 33.0 38.0 13.0 38.0 145-149 31.827350000000003 38.0 32.8 38.0 8.6 38.0 150-151 26.347625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 8.0 4 14.0 5 1.0 6 3.0 7 2.0 8 3.0 9 2.0 10 5.0 11 1.0 12 2.0 13 6.0 14 2.0 15 6.0 16 9.0 17 12.0 18 8.0 19 7.0 20 12.0 21 17.0 22 18.0 23 35.0 24 24.0 25 16.0 26 21.0 27 25.0 28 36.0 29 49.0 30 54.0 31 49.0 32 73.0 33 114.0 34 149.0 35 244.0 36 643.0 37 2325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.6412876852325 15.99386816555953 14.741951967296881 33.62289218191109 2 31.47482014388489 21.145940390544705 26.515930113052416 20.863309352517987 3 23.311156601842377 26.74002047082907 25.204708290685772 24.744114636642784 4 27.095115681233935 30.925449871465293 19.10025706940874 22.87917737789203 5 27.966101694915253 33.05084745762712 18.284540318438623 20.698510529019003 6 23.668341708542716 35.47738693467337 20.552763819095475 20.301507537688444 7 23.13656828414207 17.83391695847924 35.66783391695848 23.36168084042021 8 24.68734367183592 22.11105552776388 23.761880940470235 29.439719859929962 9 25.11255627813907 21.335667833916958 26.388194097048522 27.163581790895446 10-14 26.241808813966284 25.421439647841527 23.11540193086889 25.221349607323297 15-19 26.350401606425706 25.76305220883534 23.70983935742972 24.176706827309236 20-24 25.119629275172517 26.016219211202333 24.31370573716819 24.550445776456957 25-29 25.601365941847032 25.425601365941848 24.129965349269323 24.843067342941797 30-34 26.230576441102755 25.112781954887218 24.49624060150376 24.160401002506266 35-39 25.61479540415239 25.776053215077603 24.66740576496674 23.941745615803264 40-44 25.583028236120164 25.753548322383267 24.113546316264607 24.54987712523196 45-49 26.574803149606304 25.348273773470627 24.550777306682818 23.52614577024026 50-54 25.760475423045932 25.498589846897662 24.27477840451249 24.466156325543917 55-59 25.899208496142673 25.293056807935077 24.601743312293358 24.205991383628895 60-64 25.841793145039706 25.55533219419037 24.10795054779375 24.49492411297618 65-69 26.055017984700342 25.39135721161153 24.484523025482545 24.06910177820558 70-74 26.42921732141063 25.645534009846276 24.364513212096856 23.56073545664624 75-79 26.155078340091105 25.619462381738998 24.458126845872755 23.76733243229714 80-84 26.303400611008165 25.391896629438577 24.300095157009068 24.004607602544198 85-89 26.270974204858504 25.835211620335585 24.187327823691458 23.70648635111445 90-94 26.27271814439201 25.710412692037355 24.82678983833718 23.190079325233455 95-99 26.203614640814056 25.889738267604923 24.178605781400293 23.728041310180732 100-104 26.345045642307102 25.39140190728747 24.509153959916365 23.754398490489063 105-109 26.416347381864625 25.97701149425287 24.408684546615582 23.197956577266922 110-114 26.700445263319516 25.983929576743947 23.808792671068122 23.50683248886842 115-119 26.55953175540381 26.600605842788934 23.550854854443703 23.289007547363557 120-124 26.9587366276108 26.031584309730004 24.070300560366785 22.93937850229241 125-129 26.952410006101278 25.97620500305064 24.110229814927802 22.961155175920275 130-134 27.55148975315582 25.77809577349619 24.060918894056318 22.609495579291664 135-139 26.87851034761929 25.800738754237717 24.561048423822292 22.7597024743207 140-144 27.073244552058114 25.918079096045197 24.460250201775626 22.548426150121063 145-149 27.302313755403002 26.137808288838038 23.696923468090517 22.862954487668446 150-151 27.353395061728396 26.080246913580247 24.074074074074073 22.492283950617285 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 1.5 15 1.5 16 0.5 17 1.5 18 1.5 19 1.0 20 1.5 21 2.5 22 2.5 23 1.0 24 1.5 25 2.5 26 3.5 27 3.5 28 3.5 29 4.0 30 5.5 31 7.5 32 6.5 33 9.0 34 22.0 35 30.5 36 37.0 37 58.0 38 70.0 39 81.0 40 103.0 41 122.0 42 149.0 43 173.0 44 183.0 45 193.5 46 182.5 47 180.5 48 196.5 49 181.5 50 166.0 51 159.0 52 146.5 53 137.5 54 132.0 55 122.0 56 108.5 57 99.5 58 96.0 59 86.0 60 81.0 61 82.5 62 78.0 63 67.5 64 60.5 65 50.5 66 48.0 67 55.5 68 45.5 69 39.0 70 32.5 71 22.5 72 21.0 73 14.5 74 7.0 75 3.0 76 1.0 77 3.5 78 3.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 2.7 3 2.3 4 2.75 5 2.65 6 0.5 7 0.05 8 0.05 9 0.05 10-14 0.045 15-19 0.4 20-24 0.735 25-29 0.43499999999999994 30-34 0.25 35-39 0.7799999999999999 40-44 0.305 45-49 0.9400000000000001 50-54 0.72 55-59 0.19 60-64 0.51 65-69 1.3050000000000002 70-74 0.47000000000000003 75-79 0.11499999999999999 80-84 0.165 85-89 0.17500000000000002 90-94 0.41000000000000003 95-99 1.2349999999999999 100-104 1.955 105-109 2.125 110-114 2.305 115-119 2.6149999999999998 120-124 1.8499999999999999 125-129 1.66 130-134 2.165 135-139 1.185 140-144 0.88 145-149 1.675 150-151 2.8000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.7061790668348046 1.4000000000000001 3 0.05044136191677175 0.15 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.5374999999999996 0.0 0.0 0.0 0.0 120-121 2.775 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.1875 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.175000000000001 0.0 0.0 0.0 0.0 136-137 5.4875 0.0 0.0 0.0 0.0 138-139 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060191 spots for SRR7473366.sra Written 1060191 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra Read 1060190 spots for SRR7473366.sra Written 1060190 spots for SRR7473366.sra SRR ids: ['SRR7473366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mk6p17ma SRR7473366.sra spots: 21203801 blocks: [[1, 1060190], [1060191, 2120380], [2120381, 3180570], [3180571, 4240760], [4240761, 5300950], [5300951, 6361140], [6361141, 7421330], [7421331, 8481520], [8481521, 9541710], [9541711, 10601900], [10601901, 11662090], [11662091, 12722280], [12722281, 13782470], [13782471, 14842660], [14842661, 15902850], [15902851, 16963040], [16963041, 18023230], [18023231, 19083420], [19083421, 20143610], [20143611, 21203801]] SRR7473366 file size 7163572 SRR7473366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473366 SRR7473366_1.fastq SRR7473366_2.fastq Input file: SRR7473366_1.fastq Paired file: SRR7473366_2.fastq trimmed: SRR7473366-trimmed-pair1.fastq, SRR7473366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:19:15 2024 >> started Sat Dec 7 15:19:40 2024 >> done (24.841s) 21203801 read pairs processed; of these: 24837 ( 0.12%) short read pairs filtered out after trimming by size control 48734 ( 0.23%) empty read pairs filtered out after trimming by size control 21130230 (99.65%) read pairs available; of these: 11273556 (53.35%) trimmed read pairs available after processing 9856674 (46.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 19 0.00% 20 18 0.00% 21 30 0.00% 22 21 0.00% 23 18 0.00% 24 20 0.00% 25 24 0.00% 26 22 0.00% 27 18 0.00% 28 34 0.00% 29 38 0.00% 30 37 0.00% 31 22 0.00% 32 19 0.00% 33 36 0.00% 34 31 0.00% 35 37 0.00% 36 37 0.00% 37 39 0.00% 38 36 0.00% 39 62 0.00% 40 56 0.00% 41 58 0.00% 42 60 0.00% 43 68 0.00% 44 65 0.00% 45 84 0.00% 46 99 0.00% 47 131 0.00% 48 125 0.00% 49 120 0.00% 50 138 0.00% 51 156 0.00% 52 170 0.00% 53 180 0.00% 54 220 0.00% 55 225 0.00% 56 272 0.00% 57 280 0.00% 58 330 0.00% 59 342 0.00% 60 396 0.00% 61 490 0.00% 62 534 0.00% 63 608 0.00% 64 606 0.00% 65 696 0.00% 66 789 0.00% 67 958 0.00% 68 1050 0.00% 69 1516 0.01% 70 1952 0.01% 71 1586 0.01% 72 1712 0.01% 73 1874 0.01% 74 1990 0.01% 75 2313 0.01% 76 2478 0.01% 77 2795 0.01% 78 3061 0.01% 79 3423 0.02% 80 3895 0.02% 81 4383 0.02% 82 4827 0.02% 83 5540 0.03% 84 6842 0.03% 85 7638 0.04% 86 8123 0.04% 87 8867 0.04% 88 9896 0.05% 89 10306 0.05% 90 10932 0.05% 91 11388 0.05% 92 12341 0.06% 93 13644 0.06% 94 14239 0.07% 95 15481 0.07% 96 15768 0.07% 97 17210 0.08% 98 17791 0.08% 99 19162 0.09% 100 20149 0.10% 101 20733 0.10% 102 21388 0.10% 103 22556 0.11% 104 24061 0.11% 105 25594 0.12% 106 26774 0.13% 107 27811 0.13% 108 29447 0.14% 109 31240 0.15% 110 32456 0.15% 111 32887 0.16% 112 34129 0.16% 113 36375 0.17% 114 37205 0.18% 115 39416 0.19% 116 40683 0.19% 117 42155 0.20% 118 44120 0.21% 119 45460 0.22% 120 47899 0.23% 121 49377 0.23% 122 52157 0.25% 123 54033 0.26% 124 56332 0.27% 125 57356 0.27% 126 59409 0.28% 127 62492 0.30% 128 65334 0.31% 129 68070 0.32% 130 71627 0.34% 131 73773 0.35% 132 78461 0.37% 133 81863 0.39% 134 86608 0.41% 135 90795 0.43% 136 96198 0.46% 137 101603 0.48% 138 109023 0.52% 139 117771 0.56% 140 127377 0.60% 141 140276 0.66% 142 155097 0.73% 143 174946 0.83% 144 200213 0.95% 145 238419 1.13% 146 298949 1.41% 147 403400 1.91% 148 619056 2.93% 149 1189857 5.63% 150 5358234 25.36% 151 9856674 46.65% 21130230 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=19 prefix-density=0.46 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=30.16 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.9 sequence=TTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=21 prefix-density=0.40 prefix-fanout=2.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=70.67 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.6 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473366 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:20:27 Started mapping on | Dec 07 15:20:27 Finished on | Dec 07 15:25:09 Mapping speed, Million of reads per hour | 269.75 Number of input reads | 21130230 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 19567578 Uniquely mapped reads % | 92.60% Average mapped length | 293.59 Number of splices: Total | 20894645 Number of splices: Annotated (sjdb) | 19687026 Number of splices: GT/AG | 20637795 Number of splices: GC/AG | 230062 Number of splices: AT/AC | 9211 Number of splices: Non-canonical | 17577 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 184645 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 22259 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.67% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1391291 1391291 1391291 N_multimapping 184645 184645 184645 N_noFeature 618866 18848615 926732 N_ambiguous 473782 3025 63541 UnstrandedReadsAssigned:18474930 PositiveStrandReadsAssigned:715938 NegativeStrandReadsAssigned:18577305 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7473366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473366-trimmed-pair1.fastq SRR7473366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,130,230 reads, 18,650,110 reads pseudoaligned [quant] estimated average fragment length: 279.578 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR7473366.ke.tsv 35125 SRR7473366.se.tsv 88098 total ==> SRR7473366.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.417 68.205 7.79841 PNS24247 1044 765.422 45.2322 4.44875 PNS24249 1928 1649.42 70.236 3.20567 PNS24246 1044 765.422 45.2322 4.44875 PNS24248 1044 765.422 45.2322 4.44875 PNS24244 1471 1192.42 164.862 10.4084 PNS24243 293 89.4257 0 0 KQK14069 1603 1324.42 1490.89 84.7443 KQK14071 474 223.04 10.097 3.40802 ==> SRR7473366.se.tsv <== BRADI_1g14170v3 1594 BRADI_1g53295v3 134 BRADI_1g59795v3 131 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 1026 BRADI_1g74790v3 611 BRADI_1g09890v3 1 BRADI_1g77505v3 179 BRADI_1g48960v3 0 SRR7473366 completed mapping pipeline successfully