Starting /dee2/code/volunteer_pipeline.sh SRR7473369 current disk space = 1542328926208 free memory = 1597473644 SRR7473369 SRAfilesize 37739074a363b0dac95cc62b394dbf6f SRR7473369.sra SRR7473369.sra file validated SRR7473369 is paired end SRR7473369 is conventional basespace SRR7473369 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34775 34.0 33.0 34.0 33.0 34.0 2 33.4225 34.0 34.0 34.0 33.0 34.0 3 33.47675 34.0 34.0 34.0 33.0 34.0 4 33.43775 34.0 34.0 34.0 33.0 34.0 5 33.46025 34.0 34.0 34.0 33.0 34.0 6 37.03825 38.0 38.0 38.0 36.0 38.0 7 37.40775 38.0 38.0 38.0 37.0 38.0 8 37.522 38.0 38.0 38.0 37.0 38.0 9 37.50125 38.0 38.0 38.0 38.0 38.0 10-14 37.4654 38.0 38.0 38.0 37.6 38.0 15-19 37.41695 38.0 38.0 38.0 37.2 38.0 20-24 37.4374 38.0 38.0 38.0 37.0 38.0 25-29 37.37695 38.0 38.0 38.0 37.0 38.0 30-34 37.07075 38.0 38.0 38.0 36.2 38.0 35-39 37.0972 38.0 38.0 38.0 36.0 38.0 40-44 36.967699999999994 38.0 38.0 38.0 35.8 38.0 45-49 36.9692 38.0 38.0 38.0 35.8 38.0 50-54 36.8136 38.0 38.0 38.0 35.0 38.0 55-59 36.91525 38.0 38.0 38.0 35.2 38.0 60-64 36.834500000000006 38.0 38.0 38.0 35.2 38.0 65-69 36.67495 38.0 38.0 38.0 34.4 38.0 70-74 36.55385 38.0 38.0 38.0 34.0 38.0 75-79 36.66465000000001 38.0 38.0 38.0 34.0 38.0 80-84 36.44655 38.0 38.0 38.0 34.0 38.0 85-89 36.3489 38.0 38.0 38.0 34.0 38.0 90-94 36.120549999999994 38.0 37.4 38.0 33.4 38.0 95-99 35.85850000000001 38.0 37.0 38.0 32.6 38.0 100-104 35.667899999999996 38.0 36.8 38.0 31.0 38.0 105-109 35.56365 38.0 36.2 38.0 30.6 38.0 110-114 35.19064999999999 38.0 36.0 38.0 28.8 38.0 115-119 34.70145 38.0 35.0 38.0 26.6 38.0 120-124 34.53189999999999 38.0 35.0 38.0 25.8 38.0 125-129 34.26105 38.0 34.8 38.0 24.6 38.0 130-134 33.80695 38.0 34.4 38.0 21.4 38.0 135-139 32.98145 38.0 33.4 38.0 15.0 38.0 140-144 32.69195 38.0 33.0 38.0 14.2 38.0 145-149 31.74045 37.2 32.6 38.0 11.2 38.0 150-151 27.029249999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 1.0 14 5.0 15 1.0 16 4.0 17 2.0 18 3.0 19 5.0 20 9.0 21 13.0 22 17.0 23 15.0 24 21.0 25 22.0 26 21.0 27 28.0 28 39.0 29 36.0 30 64.0 31 74.0 32 97.0 33 144.0 34 214.0 35 353.0 36 912.0 37 1897.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.29290904535205 15.309446254071663 9.29591581057379 34.101728890002505 2 24.780976220275345 18.498122653316646 32.16520650813517 24.55569461827284 3 20.25 25.55 25.974999999999998 28.225 4 25.55 31.6 21.375 21.475 5 23.175 33.425 22.825 20.575 6 21.224999999999998 32.85 23.799999999999997 22.125 7 16.7 21.625 40.050000000000004 21.625 8 19.175 22.075 28.549999999999997 30.2 9 19.6 21.25 31.225 27.925 10-14 22.745 26.855 24.57 25.83 15-19 22.39 25.935000000000002 25.915 25.759999999999998 20-24 22.55 26.31 26.025 25.115 25-29 22.595000000000002 26.455000000000002 25.56 25.39 30-34 22.58 26.314999999999998 25.505 25.6 35-39 22.421121056052804 26.02630131506575 25.456272813640684 26.09630481524076 40-44 23.210802700675167 25.4913728432108 26.111527881970492 25.186296574143537 45-49 22.856142807140355 25.29626481324066 25.681284064203208 26.16630831541577 50-54 22.66 25.974999999999998 25.295 26.07 55-59 22.39 26.340000000000003 25.965 25.305 60-64 22.55 26.200000000000003 25.455 25.795 65-69 22.919999999999998 25.509999999999998 25.585 25.985000000000003 70-74 23.3 25.81 25.119999999999997 25.77 75-79 22.775000000000002 25.230000000000004 25.91 26.085 80-84 23.419999999999998 25.180000000000003 25.81 25.590000000000003 85-89 23.185 25.430000000000003 25.115 26.27 90-94 23.247435576682513 25.339004253189895 25.734300725544156 25.679259444583437 95-99 23.50055071593071 25.377991388805448 25.79353159106839 25.327926304195454 100-104 22.900000000000002 25.729999999999997 25.679999999999996 25.69 105-109 23.485 25.330000000000002 25.255 25.929999999999996 110-114 23.03 25.95 25.295 25.724999999999998 115-119 23.03 26.015 24.985 25.97 120-124 23.565 25.52 24.845 26.07 125-129 23.315 25.474999999999998 25.085 26.125 130-134 24.039473025096427 25.44206782547713 24.695687020988828 25.82277212843761 135-139 23.423152190275477 25.86682723669025 25.164333383511465 25.545687189522802 140-144 23.39935974389756 25.610244097639058 24.884953981592638 26.105442176870746 145-149 23.566847063539786 26.458208057727 24.473842453397474 25.501102425335738 150-151 23.865778559758702 24.16739977378409 25.235641573457336 26.731180092999875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 3.0 28 5.0 29 3.5 30 4.5 31 12.0 32 17.5 33 25.5 34 34.5 35 37.0 36 45.0 37 69.5 38 94.0 39 111.0 40 126.0 41 139.5 42 163.5 43 176.5 44 193.0 45 199.5 46 189.0 47 210.0 48 206.5 49 188.5 50 191.5 51 180.5 52 146.0 53 129.5 54 130.0 55 119.0 56 103.0 57 84.5 58 82.0 59 76.5 60 59.5 61 56.0 62 58.0 63 46.5 64 36.5 65 38.0 66 34.5 67 34.0 68 34.0 69 21.0 70 16.0 71 18.5 72 15.0 73 10.0 74 8.0 75 5.0 76 3.0 77 2.0 78 1.5 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.025 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.075 95-99 0.13 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.185 135-139 0.35500000000000004 140-144 0.04 145-149 0.22 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 4.175000000000001 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.8625 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473369 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.861 33.0 33.0 34.0 31.0 34.0 2 31.8885 33.0 33.0 34.0 31.0 34.0 3 31.99975 33.0 33.0 34.0 31.0 34.0 4 31.79625 34.0 33.0 34.0 31.0 34.0 5 31.90725 34.0 33.0 34.0 31.0 34.0 6 36.413 38.0 38.0 38.0 34.0 38.0 7 36.59275 38.0 38.0 38.0 34.0 38.0 8 36.596 38.0 38.0 38.0 35.0 38.0 9 36.676 38.0 38.0 38.0 36.0 38.0 10-14 36.687 38.0 38.0 38.0 36.0 38.0 15-19 36.5623 38.0 38.0 38.0 35.8 38.0 20-24 36.36255 38.0 38.0 38.0 35.2 38.0 25-29 36.44025 38.0 38.0 38.0 35.4 38.0 30-34 36.5368 38.0 38.0 38.0 36.0 38.0 35-39 36.2728 38.0 38.0 38.0 35.2 38.0 40-44 36.405150000000006 38.0 38.0 38.0 35.2 38.0 45-49 36.10045 38.0 38.0 38.0 34.4 38.0 50-54 36.186400000000006 38.0 38.0 38.0 34.2 38.0 55-59 36.22795 38.0 38.0 38.0 34.6 38.0 60-64 36.08195 38.0 38.0 38.0 34.0 38.0 65-69 35.712849999999996 38.0 38.0 38.0 33.2 38.0 70-74 35.87425 38.0 38.0 38.0 33.0 38.0 75-79 35.98505 38.0 38.0 38.0 34.0 38.0 80-84 35.777 38.0 38.0 38.0 32.8 38.0 85-89 35.69845 38.0 38.0 38.0 32.8 38.0 90-94 35.5292 38.0 38.0 38.0 32.0 38.0 95-99 35.096050000000005 38.0 37.2 38.0 30.2 38.0 100-104 34.53635 38.0 36.6 38.0 26.2 38.0 105-109 34.39695 38.0 36.0 38.0 25.2 38.0 110-114 34.10915000000001 38.0 36.0 38.0 23.0 38.0 115-119 33.55525 38.0 35.0 38.0 16.2 38.0 120-124 33.54605 38.0 35.0 38.0 17.4 38.0 125-129 33.29285 38.0 34.6 38.0 15.8 38.0 130-134 32.8825 38.0 34.2 38.0 13.8 38.0 135-139 32.511700000000005 38.0 33.8 38.0 13.6 38.0 140-144 31.74645 38.0 32.4 38.0 10.8 38.0 145-149 30.771800000000002 38.0 31.0 38.0 2.0 38.0 150-151 25.776125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 13.0 4 19.0 5 4.0 6 4.0 7 2.0 8 3.0 9 3.0 10 0.0 11 6.0 12 5.0 13 10.0 14 5.0 15 9.0 16 11.0 17 12.0 18 16.0 19 18.0 20 20.0 21 18.0 22 18.0 23 31.0 24 22.0 25 20.0 26 22.0 27 31.0 28 29.0 29 49.0 30 57.0 31 60.0 32 96.0 33 116.0 34 152.0 35 274.0 36 631.0 37 2190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.389031266017426 18.247052793439263 10.994361865709893 29.36955407483342 2 28.666837914204983 22.73311071153352 28.84664782943745 19.753403544824046 3 22.416004103616313 25.852782764811487 28.57142857142857 23.159784560143628 4 26.267043992796502 32.77591973244147 20.118343195266274 20.838693079495755 5 27.331107115335218 33.77857693295659 18.648856922681738 20.24145902902646 6 22.831279859190346 34.448076439527284 21.171737490570784 21.54890621071159 7 23.042281711283465 18.038528896672503 34.75106329747311 24.168126094570926 8 22.992244183137352 23.167375531648737 22.76707530647986 31.07330497873405 9 24.137068534267133 22.236118059029515 24.912456228114056 28.714357178589296 10-14 25.72830113124437 25.40794874361798 23.540894984482932 25.32285514065472 15-19 25.953469674890712 24.84297271493895 24.631928043816895 24.57162956635345 20-24 26.091339852807742 25.667910071579797 24.755519709648148 23.48523036596431 25-29 25.503895451118368 26.021613470721288 24.362905252576024 24.111585825584317 30-34 25.460199628830814 25.294678236444803 24.707829663439835 24.537292471284548 35-39 25.856587778170258 24.605137003582783 24.746429832971693 24.79184538527527 40-44 25.892095357590968 24.672521957340024 24.496863237139273 24.938519447929735 45-49 25.62275781921075 25.006316002223233 24.975999191551715 24.394926987014298 50-54 26.059994958406858 25.32392235946559 24.77438870683136 23.841693975296195 55-59 26.236408277797263 25.15408127474069 24.808337926542066 23.801172520919977 60-64 25.98068799034399 25.377187688593843 24.64292898813116 23.999195332931002 65-69 26.541174082906288 24.633416205794305 25.191536861332388 23.63387284996702 70-74 26.477981097928815 25.573094711441787 24.562638246531268 23.386285944098127 75-79 25.57207951529718 25.131440588853838 25.246607580992443 24.04987231485654 80-84 25.75681635926223 25.88712910986367 24.714314354450682 23.64174017642342 85-89 26.34241634942897 25.76137046684031 24.49408936084953 23.402123822881187 90-94 26.50354217957092 25.518766015173593 24.98618298748932 22.991508817766164 95-99 25.890459542990325 25.221664893347516 25.130465622941685 23.757409940720475 100-104 26.041719793951142 24.832967817616158 25.261386239608303 23.863926148824397 105-109 25.711366538952745 25.81353767560664 24.745849297573436 23.72924648786718 110-114 25.575918910617386 25.478652605713116 25.238046483055186 23.707382000614313 115-119 26.385251373696917 26.30308632465465 24.264366045293485 23.047296256354954 120-124 26.725456213681316 25.655010704455094 24.742583341828933 22.876949740034664 125-129 26.590330788804074 25.57760814249364 25.099236641221374 22.732824427480917 130-134 26.463520629889054 25.502326294800348 25.067743749680453 22.966409325630146 135-139 26.749721462574698 26.52182720550998 24.668287248050238 22.060164083865086 140-144 26.827913552817613 26.10583720460513 24.59099171884468 22.475257523732576 145-149 26.295692902963037 26.550249465431218 24.46288565319214 22.691171978413603 150-151 27.519280205655527 26.028277634961437 24.832904884318765 21.619537275064268 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 0.5 11 0.5 12 1.5 13 1.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 2.5 21 3.0 22 2.0 23 3.0 24 2.5 25 2.0 26 3.0 27 4.5 28 5.5 29 7.0 30 8.5 31 10.5 32 15.0 33 17.0 34 24.5 35 33.0 36 45.0 37 57.0 38 72.0 39 87.0 40 102.5 41 130.5 42 144.0 43 148.0 44 166.5 45 183.0 46 194.5 47 209.5 48 197.5 49 164.5 50 165.0 51 165.5 52 150.0 53 138.5 54 132.5 55 132.0 56 104.5 57 79.0 58 93.0 59 99.5 60 73.0 61 57.0 62 73.0 63 72.5 64 57.5 65 57.5 66 52.0 67 51.5 68 48.0 69 34.0 70 26.5 71 23.0 72 17.5 73 14.0 74 9.0 75 6.0 76 4.5 77 2.5 78 2.0 79 2.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 2.675 3 2.5250000000000004 4 2.825 5 2.675 6 0.575 7 0.075 8 0.075 9 0.05 10-14 0.11 15-19 0.49500000000000005 20-24 0.8099999999999999 25-29 0.525 30-34 0.315 35-39 0.915 40-44 0.375 45-49 1.045 50-54 0.8250000000000001 55-59 0.215 60-64 0.58 65-69 1.455 70-74 0.54 75-79 0.145 80-84 0.24 85-89 0.18 90-94 0.485 95-99 1.315 100-104 1.965 105-109 2.125 110-114 2.33 115-119 2.635 120-124 1.91 125-129 1.7500000000000002 130-134 2.205 135-139 1.27 140-144 0.98 145-149 1.79 150-151 2.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49685534591195 98.875 2 0.4025157232704402 0.8 3 0.07547169811320754 0.22499999999999998 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.1875 0.0 0.0 0.0 0.0 138-139 5.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGTGC 10 0.0063698506 148.32895 2 AGGTGCT 10 0.0063698506 148.32895 3 CCCAGGT 10 0.007440521 140.91249 6 GGAGGGA 10 0.007440521 140.91249 8 >>END_MODULE Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164681 spots for SRR7473369.sra Written 1164681 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra Read 1164672 spots for SRR7473369.sra Written 1164672 spots for SRR7473369.sra SRR ids: ['SRR7473369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_34l0seox SRR7473369.sra spots: 23293449 blocks: [[1, 1164672], [1164673, 2329344], [2329345, 3494016], [3494017, 4658688], [4658689, 5823360], [5823361, 6988032], [6988033, 8152704], [8152705, 9317376], [9317377, 10482048], [10482049, 11646720], [11646721, 12811392], [12811393, 13976064], [13976065, 15140736], [15140737, 16305408], [16305409, 17470080], [17470081, 18634752], [18634753, 19799424], [19799425, 20964096], [20964097, 22128768], [22128769, 23293449]] SRR7473369 file size 7871685 SRR7473369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473369 SRR7473369_1.fastq SRR7473369_2.fastq Input file: SRR7473369_1.fastq Paired file: SRR7473369_2.fastq trimmed: SRR7473369-trimmed-pair1.fastq, SRR7473369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:26:48 2024 >> started Sat Dec 7 15:27:25 2024 >> done (37.011s) 23293449 read pairs processed; of these: 58479 ( 0.25%) short read pairs filtered out after trimming by size control 97817 ( 0.42%) empty read pairs filtered out after trimming by size control 23137153 (99.33%) read pairs available; of these: 12945971 (55.95%) trimmed read pairs available after processing 10191182 (44.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 29 0.00% 20 24 0.00% 21 28 0.00% 22 18 0.00% 23 31 0.00% 24 36 0.00% 25 33 0.00% 26 31 0.00% 27 29 0.00% 28 22 0.00% 29 32 0.00% 30 50 0.00% 31 43 0.00% 32 40 0.00% 33 43 0.00% 34 49 0.00% 35 61 0.00% 36 43 0.00% 37 47 0.00% 38 55 0.00% 39 58 0.00% 40 76 0.00% 41 88 0.00% 42 97 0.00% 43 99 0.00% 44 116 0.00% 45 112 0.00% 46 133 0.00% 47 157 0.00% 48 136 0.00% 49 177 0.00% 50 193 0.00% 51 234 0.00% 52 250 0.00% 53 279 0.00% 54 305 0.00% 55 306 0.00% 56 325 0.00% 57 348 0.00% 58 373 0.00% 59 428 0.00% 60 473 0.00% 61 633 0.00% 62 670 0.00% 63 840 0.00% 64 870 0.00% 65 1009 0.00% 66 1027 0.00% 67 1225 0.01% 68 1496 0.01% 69 2222 0.01% 70 2824 0.01% 71 2293 0.01% 72 2292 0.01% 73 2317 0.01% 74 2486 0.01% 75 2631 0.01% 76 2820 0.01% 77 3055 0.01% 78 3339 0.01% 79 3686 0.02% 80 4293 0.02% 81 4996 0.02% 82 5728 0.02% 83 6741 0.03% 84 9099 0.04% 85 10268 0.04% 86 10604 0.05% 87 10705 0.05% 88 11277 0.05% 89 11562 0.05% 90 12687 0.05% 91 13575 0.06% 92 14777 0.06% 93 16548 0.07% 94 17675 0.08% 95 18588 0.08% 96 19155 0.08% 97 19228 0.08% 98 19935 0.09% 99 20783 0.09% 100 22305 0.10% 101 23048 0.10% 102 25843 0.11% 103 27434 0.12% 104 29513 0.13% 105 31745 0.14% 106 32476 0.14% 107 32696 0.14% 108 33892 0.15% 109 35266 0.15% 110 36652 0.16% 111 37851 0.16% 112 40858 0.18% 113 43910 0.19% 114 46104 0.20% 115 49399 0.21% 116 50834 0.22% 117 51093 0.22% 118 52317 0.23% 119 52876 0.23% 120 55561 0.24% 121 57106 0.25% 122 61456 0.27% 123 64998 0.28% 124 69629 0.30% 125 72066 0.31% 126 73724 0.32% 127 76132 0.33% 128 77782 0.34% 129 80446 0.35% 130 83548 0.36% 131 86449 0.37% 132 92674 0.40% 133 97631 0.42% 134 104887 0.45% 135 111527 0.48% 136 118656 0.51% 137 124961 0.54% 138 132483 0.57% 139 140633 0.61% 140 151701 0.66% 141 165646 0.72% 142 182849 0.79% 143 207841 0.90% 144 242202 1.05% 145 288561 1.25% 146 362520 1.57% 147 484933 2.10% 148 739394 3.20% 149 1398760 6.05% 150 5881615 25.42% 151 10191182 44.05% 23137153 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=30 prefix-density=0.28 prefix-fanout=3.5 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=325.29 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=20.4 sequence=TTCTTCTTGTCGTCCGC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=32 prefix-density=0.60 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=275.86 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=17.4 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7473369 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:28:37 Started mapping on | Dec 07 15:28:37 Finished on | Dec 07 15:34:30 Mapping speed, Million of reads per hour | 235.96 Number of input reads | 23137153 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21500914 Uniquely mapped reads % | 92.93% Average mapped length | 292.78 Number of splices: Total | 22408632 Number of splices: Annotated (sjdb) | 20961907 Number of splices: GT/AG | 22124689 Number of splices: GC/AG | 248354 Number of splices: AT/AC | 16041 Number of splices: Non-canonical | 19548 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250779 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 17036 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.43% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1416715 1416715 1416715 N_multimapping 250779 250779 250779 N_noFeature 761305 20847060 1026003 N_ambiguous 451775 3288 62980 UnstrandedReadsAssigned:20287834 PositiveStrandReadsAssigned:650566 NegativeStrandReadsAssigned:20411931 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473369-trimmed-pair1.fastq SRR7473369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,137,153 reads, 20,601,419 reads pseudoaligned [quant] estimated average fragment length: 276.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR7473369.ke.tsv 35125 SRR7473369.se.tsv 88098 total ==> SRR7473369.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 661.323 0 0 PNS24247 1044 768.391 80.293 7.13662 PNS24249 1928 1652.39 83.7784 3.46271 PNS24246 1044 768.391 80.293 7.13662 PNS24248 1044 768.391 80.293 7.13662 PNS24244 1471 1195.39 213.343 12.1889 PNS24243 293 91.3665 0 0 KQK14069 1603 1327.39 7138.33 367.278 KQK14071 474 226.412 84.6534 25.5353 ==> SRR7473369.se.tsv <== BRADI_1g14170v3 7816 BRADI_1g53295v3 95 BRADI_1g59795v3 719 BRADI_1g07683v3 0 BRADI_1g00485v3 118 BRADI_1g20270v3 1737 BRADI_1g74790v3 67 BRADI_1g09890v3 2 BRADI_1g77505v3 362 BRADI_1g48960v3 2 SRR7473369 completed mapping pipeline successfully