Starting /dee2/code/volunteer_pipeline.sh SRR7473370 current disk space = 1542465019904 free memory = 1597423984 SRR7473370 SRAfilesize 692dce89cab5eef498c7df6e65bd8f0e SRR7473370.sra SRR7473370.sra file validated SRR7473370 is paired end SRR7473370 is conventional basespace SRR7473370 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35475 34.0 33.0 34.0 33.0 34.0 2 33.39775 34.0 34.0 34.0 33.0 34.0 3 33.50025 34.0 34.0 34.0 33.0 34.0 4 33.43125 34.0 34.0 34.0 33.0 34.0 5 33.399 34.0 34.0 34.0 33.0 34.0 6 37.09975 38.0 37.0 38.0 36.0 38.0 7 37.38525 38.0 38.0 38.0 37.0 38.0 8 37.494 38.0 38.0 38.0 38.0 38.0 9 37.5265 38.0 38.0 38.0 38.0 38.0 10-14 37.50085 38.0 38.0 38.0 38.0 38.0 15-19 37.44745 38.0 38.0 38.0 37.0 38.0 20-24 37.48035000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.400099999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.07165 38.0 38.0 38.0 36.4 38.0 35-39 37.097249999999995 38.0 38.0 38.0 36.0 38.0 40-44 37.01415000000001 38.0 38.0 38.0 35.8 38.0 45-49 37.00365 38.0 38.0 38.0 35.8 38.0 50-54 36.8239 38.0 38.0 38.0 35.0 38.0 55-59 36.97595 38.0 38.0 38.0 35.2 38.0 60-64 36.9052 38.0 38.0 38.0 35.0 38.0 65-69 36.6903 38.0 38.0 38.0 34.4 38.0 70-74 36.584050000000005 38.0 38.0 38.0 34.0 38.0 75-79 36.67765 38.0 38.0 38.0 34.2 38.0 80-84 36.5586 38.0 38.0 38.0 34.0 38.0 85-89 36.4556 38.0 38.0 38.0 34.0 38.0 90-94 36.08255 38.0 37.0 38.0 32.6 38.0 95-99 35.8683 38.0 36.6 38.0 31.6 38.0 100-104 35.8207 38.0 36.2 38.0 32.0 38.0 105-109 35.6478 38.0 36.0 38.0 31.2 38.0 110-114 35.20354999999999 38.0 35.8 38.0 28.8 38.0 115-119 34.7474 38.0 35.0 38.0 27.0 38.0 120-124 34.70065 38.0 35.0 38.0 27.2 38.0 125-129 34.39665 38.0 34.8 38.0 25.2 38.0 130-134 33.8156 38.0 34.0 38.0 22.6 38.0 135-139 33.17975 38.0 33.4 38.0 18.6 38.0 140-144 32.71205 38.0 33.0 38.0 15.4 38.0 145-149 31.563849999999995 36.4 32.4 38.0 11.4 38.0 150-151 26.730625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 4.0 14 1.0 15 1.0 16 1.0 17 2.0 18 3.0 19 9.0 20 7.0 21 6.0 22 7.0 23 9.0 24 22.0 25 15.0 26 17.0 27 27.0 28 41.0 29 53.0 30 55.0 31 70.0 32 102.0 33 157.0 34 235.0 35 378.0 36 972.0 37 1804.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.96992481203007 11.604010025062657 9.874686716791981 40.55137844611529 2 25.19408965689958 14.575507137490609 33.433508640120216 26.79689456548961 3 21.55 20.125 25.074999999999996 33.25 4 27.0 26.224999999999998 20.925 25.85 5 25.974999999999998 30.575000000000003 22.725 20.724999999999998 6 22.400000000000002 31.4 24.375 21.825 7 17.2 21.325 40.275 21.2 8 19.75 22.675 28.575 28.999999999999996 9 20.3 19.650000000000002 32.275 27.775 10-14 22.975 25.509999999999998 24.805 26.71 15-19 23.035 24.85 25.16 26.955000000000002 20-24 23.669999999999998 25.22 25.2 25.91 25-29 23.305 24.935 25.480000000000004 26.279999999999998 30-34 23.005 25.435000000000002 25.240000000000002 26.32 35-39 23.566178308915443 24.251212560628034 25.5812790639532 26.601330066503326 40-44 23.63854578186728 24.658698804820723 25.38380757113567 26.31894784217633 45-49 23.705000000000002 24.455 25.615 26.224999999999998 50-54 24.055 23.849999999999998 25.380000000000003 26.715 55-59 24.104999999999997 24.36 24.485 27.05 60-64 23.919999999999998 24.535 25.185000000000002 26.36 65-69 23.75 24.415 25.314999999999998 26.52 70-74 24.295 24.83 24.785 26.090000000000003 75-79 23.7 24.404999999999998 25.009999999999998 26.884999999999998 80-84 23.885 24.779999999999998 25.014999999999997 26.32 85-89 24.54 24.060000000000002 24.58 26.82 90-94 24.83107262625757 23.810000500525554 25.171430001501577 26.1874968717153 95-99 24.649298597194388 24.739478957915832 24.844689378757515 25.766533066132265 100-104 24.165 25.005 24.69 26.14 105-109 24.785 24.715 24.27 26.229999999999997 110-114 24.985 24.255 24.385 26.375 115-119 24.985 24.610000000000003 23.51 26.895000000000003 120-124 25.2 24.46 24.09 26.25 125-129 25.355 24.265 24.62 25.759999999999998 130-134 25.330992978936813 24.749247743229688 23.77632898696088 26.143430290872615 135-139 25.1193407366464 24.978644289231696 23.184764584694236 26.717250389427665 140-144 25.25262631315658 24.497248624312157 24.01700850425213 26.23311655827914 145-149 24.757987661132567 25.0137934493655 24.060791493203592 26.167427396298336 150-151 25.097447504086507 24.330441342889475 24.091537784483844 26.48057336854017 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 2.5 28 4.5 29 4.5 30 7.5 31 11.0 32 17.0 33 23.0 34 27.0 35 37.5 36 42.5 37 49.5 38 69.5 39 86.0 40 104.0 41 127.0 42 153.5 43 159.5 44 175.0 45 188.5 46 189.0 47 189.5 48 168.5 49 160.5 50 155.0 51 141.0 52 129.5 53 118.0 54 106.0 55 103.5 56 97.5 57 116.5 58 124.5 59 106.5 60 97.5 61 87.5 62 79.5 63 65.5 64 57.5 65 63.5 66 62.0 67 49.5 68 46.0 69 41.0 70 41.0 71 33.0 72 21.5 73 19.0 74 12.0 75 6.0 76 3.0 77 4.5 78 5.0 79 3.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.105 95-99 0.2 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.3 135-139 0.49500000000000005 140-144 0.05 145-149 0.315 150-151 0.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41997961264016 96.55 2 1.2996941896024465 2.55 3 0.20387359836901123 0.6 4 0.0764525993883792 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.225 0.0 0.0 0.0 0.0 130-131 4.7 0.0 0.0 0.0 0.0 132-133 5.137499999999999 0.0 0.0 0.0 0.0 134-135 5.575 0.0 0.0 0.0 0.0 136-137 5.9875 0.0 0.0 0.0 0.0 138-139 6.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473370 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.04025 33.0 33.0 34.0 32.0 34.0 2 32.103 33.0 33.0 34.0 32.0 34.0 3 32.218 34.0 33.0 34.0 32.0 34.0 4 32.0355 34.0 33.0 34.0 32.0 34.0 5 32.00275 34.0 33.0 34.0 32.0 34.0 6 36.665 38.0 38.0 38.0 35.0 38.0 7 36.83225 38.0 38.0 38.0 35.0 38.0 8 36.91075 38.0 38.0 38.0 36.0 38.0 9 36.96075 38.0 38.0 38.0 36.0 38.0 10-14 37.07809999999999 38.0 38.0 38.0 37.0 38.0 15-19 36.911150000000006 38.0 38.0 38.0 37.0 38.0 20-24 36.6895 38.0 38.0 38.0 36.2 38.0 25-29 36.732150000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.79815 38.0 38.0 38.0 36.8 38.0 35-39 36.67465 38.0 38.0 38.0 36.2 38.0 40-44 36.7787 38.0 38.0 38.0 36.2 38.0 45-49 36.56965 38.0 38.0 38.0 36.0 38.0 50-54 36.6563 38.0 38.0 38.0 36.0 38.0 55-59 36.6909 38.0 38.0 38.0 36.0 38.0 60-64 36.5237 38.0 38.0 38.0 35.4 38.0 65-69 36.08355 38.0 38.0 38.0 34.2 38.0 70-74 36.3504 38.0 38.0 38.0 35.0 38.0 75-79 36.333949999999994 38.0 38.0 38.0 34.4 38.0 80-84 36.317949999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.11794999999999 38.0 38.0 38.0 34.0 38.0 90-94 35.99185 38.0 38.0 38.0 33.6 38.0 95-99 35.548700000000004 38.0 38.0 38.0 32.8 38.0 100-104 34.922450000000005 38.0 37.0 38.0 28.6 38.0 105-109 34.87835 38.0 37.0 38.0 28.2 38.0 110-114 34.67695 38.0 36.2 38.0 28.0 38.0 115-119 34.07645 38.0 35.2 38.0 23.0 38.0 120-124 34.083200000000005 38.0 35.2 38.0 23.0 38.0 125-129 33.88075 38.0 35.0 38.0 22.0 38.0 130-134 33.5868 38.0 34.6 38.0 19.8 38.0 135-139 33.16915 38.0 34.0 38.0 15.2 38.0 140-144 32.4816 38.0 33.0 38.0 13.0 38.0 145-149 31.5473 38.0 32.2 38.0 6.4 38.0 150-151 26.48725 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 5.0 4 26.0 5 1.0 6 1.0 7 2.0 8 1.0 9 5.0 10 5.0 11 1.0 12 5.0 13 5.0 14 5.0 15 7.0 16 4.0 17 12.0 18 12.0 19 14.0 20 6.0 21 20.0 22 19.0 23 33.0 24 19.0 25 14.0 26 16.0 27 23.0 28 34.0 29 41.0 30 55.0 31 57.0 32 81.0 33 100.0 34 158.0 35 248.0 36 639.0 37 2315.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.826755509994875 16.09431060994362 11.840082009226037 34.23885187083547 2 30.02315410342166 21.867764342680733 27.65629019809622 20.452791355801388 3 22.909184197024114 25.73114417650077 26.2955361723961 25.064135454079018 4 26.687274600721278 29.984544049459043 20.22153529108707 23.106646058732615 5 27.35460627895008 32.321152856407615 19.788986103962944 20.53525476067936 6 23.865927419354836 34.09778225806452 19.304435483870968 22.73185483870968 7 23.81190595297649 17.55877938969485 33.66683341670835 24.96248124062031 8 24.487243621810904 22.28614307153577 22.136068034017008 31.090545272636316 9 23.80595148787197 22.18054513628407 26.881720430107524 27.131782945736433 10-14 26.62064825930372 24.98999599839936 22.348939575830332 26.040416166466585 15-19 26.76587401337288 24.37283193404052 23.593585038459604 25.267709014126993 20-24 26.034456626079926 24.87748193805891 23.750820997322286 25.337240438538878 25-29 26.123949050999347 24.563258319488497 23.264360871973015 26.04843175753914 30-34 26.088266305166442 25.335140834463022 23.000451875282423 25.576140985088113 35-39 27.00434738651299 24.689111313315134 22.72267718127591 25.583864118895967 40-44 26.797287113790503 24.898266767143934 22.994222557146447 25.310223561919116 45-49 26.513157894736842 24.296558704453442 23.365384615384617 25.8248987854251 50-54 26.645451331009752 24.21579027125322 24.064252159418093 25.07450623831894 55-59 26.96629213483146 23.926565008025683 23.44502407704655 25.66211878009631 60-64 26.409106935979448 24.0366695209792 24.03163249886667 25.522591044174685 65-69 26.78562350668497 24.2438106857811 23.18641655228509 25.784149255248845 70-74 26.68243821412392 23.914028288115972 23.778124528111945 25.625408969648163 75-79 26.352434381887395 24.118413143658586 24.18353035463835 25.34562211981567 80-84 27.098165045623183 24.55128847889301 23.07730873358067 25.273237741903138 85-89 27.133259801463954 23.403188609244964 23.653865436679034 25.809686152612056 90-94 26.82595573440644 25.090543259557347 23.068410462776658 25.015090543259554 95-99 27.263959390862947 24.81218274111675 23.126903553299492 24.79695431472081 100-104 27.01845886383392 24.190826813928517 23.9453903973002 24.84532392493736 105-109 26.569949248987545 24.678320602860513 23.69918490798175 25.052545240170193 110-114 27.27552749114431 24.667590738744288 23.625442784537192 24.431438985574207 115-119 27.176821737340468 24.72725401399753 23.456154796212434 24.639769452449567 120-124 27.137451421558602 24.943751278380034 23.70116588259358 24.217631417467786 125-129 27.832474621231444 24.639085854205987 23.603530071927768 23.9249094526348 130-134 27.45922658734229 25.16155503128526 23.39214278387527 23.987075597497178 135-139 27.856453987107255 24.744936805238314 23.714532257245825 23.68407695040861 140-144 27.688960841849642 25.40220580795305 23.661843569766265 23.246989780431043 145-149 28.205520689831115 25.603347109546405 22.934843614470125 23.256288586152355 150-151 28.106508875739642 25.85541548752251 23.347054283509134 22.69102135322871 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 1.5 14 2.0 15 2.5 16 2.5 17 2.5 18 1.5 19 1.0 20 3.0 21 5.0 22 3.5 23 2.5 24 2.5 25 3.5 26 5.0 27 6.0 28 6.0 29 6.0 30 7.0 31 8.0 32 13.0 33 15.5 34 16.0 35 23.0 36 29.0 37 41.5 38 56.0 39 70.5 40 90.5 41 107.0 42 119.5 43 141.0 44 145.5 45 146.0 46 157.5 47 166.5 48 171.0 49 151.0 50 140.0 51 134.5 52 119.5 53 117.5 54 121.0 55 126.5 56 112.5 57 100.5 58 116.5 59 116.5 60 110.0 61 110.5 62 113.5 63 102.5 64 81.5 65 72.0 66 71.0 67 73.0 68 63.0 69 57.0 70 62.5 71 52.5 72 36.0 73 21.5 74 13.5 75 10.5 76 3.5 77 1.5 78 1.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 2.825 3 2.55 4 2.9499999999999997 5 2.85 6 0.8 7 0.05 8 0.05 9 0.025 10-14 0.04 15-19 0.545 20-24 1.035 25-29 0.685 30-34 0.415 35-39 1.09 40-44 0.475 45-49 1.2 50-54 1.015 55-59 0.32 60-64 0.735 65-69 1.645 70-74 0.6649999999999999 75-79 0.18 80-84 0.27 85-89 0.27 90-94 0.6 95-99 1.5 100-104 2.215 105-109 2.465 110-114 2.605 115-119 2.8400000000000003 120-124 2.22 125-129 1.9849999999999999 130-134 2.5100000000000002 135-139 1.4949999999999999 140-144 1.17 145-149 2.005 150-151 2.825 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2051282051282 95.75 2 1.282051282051282 2.5 3 0.41025641025641024 1.2 4 0.05128205128205128 0.2 5 0.02564102564102564 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02564102564102564 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 9 0.22499999999999998 No Hit CGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 2.975 0.0 0.0 0.0 0.0 124-125 3.3375 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.112500000000001 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 4.95 0.0 0.0 0.0 0.0 134-135 5.3875 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGACAC 20 0.005905929 29.02564 115-119 >>END_MODULE Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175961 spots for SRR7473370.sra Written 1175961 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra Read 1175951 spots for SRR7473370.sra Written 1175951 spots for SRR7473370.sra SRR ids: ['SRR7473370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_us472w_s SRR7473370.sra spots: 23519030 blocks: [[1, 1175951], [1175952, 2351902], [2351903, 3527853], [3527854, 4703804], [4703805, 5879755], [5879756, 7055706], [7055707, 8231657], [8231658, 9407608], [9407609, 10583559], [10583560, 11759510], [11759511, 12935461], [12935462, 14111412], [14111413, 15287363], [15287364, 16463314], [16463315, 17639265], [17639266, 18815216], [18815217, 19991167], [19991168, 21167118], [21167119, 22343069], [22343070, 23519030]] SRR7473370 file size 7948127 SRR7473370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473370 SRR7473370_1.fastq SRR7473370_2.fastq Input file: SRR7473370_1.fastq Paired file: SRR7473370_2.fastq trimmed: SRR7473370-trimmed-pair1.fastq, SRR7473370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:31:29 2024 >> started Sat Dec 7 15:31:57 2024 >> done (27.887s) 23519030 read pairs processed; of these: 28498 ( 0.12%) short read pairs filtered out after trimming by size control 55276 ( 0.24%) empty read pairs filtered out after trimming by size control 23435256 (99.64%) read pairs available; of these: 13174658 (56.22%) trimmed read pairs available after processing 10260598 (43.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 24 0.00% 20 21 0.00% 21 21 0.00% 22 13 0.00% 23 15 0.00% 24 27 0.00% 25 33 0.00% 26 18 0.00% 27 36 0.00% 28 30 0.00% 29 35 0.00% 30 45 0.00% 31 34 0.00% 32 34 0.00% 33 51 0.00% 34 42 0.00% 35 37 0.00% 36 54 0.00% 37 54 0.00% 38 76 0.00% 39 66 0.00% 40 84 0.00% 41 83 0.00% 42 81 0.00% 43 109 0.00% 44 105 0.00% 45 107 0.00% 46 107 0.00% 47 139 0.00% 48 134 0.00% 49 171 0.00% 50 193 0.00% 51 193 0.00% 52 252 0.00% 53 256 0.00% 54 255 0.00% 55 255 0.00% 56 309 0.00% 57 355 0.00% 58 360 0.00% 59 388 0.00% 60 525 0.00% 61 555 0.00% 62 588 0.00% 63 651 0.00% 64 718 0.00% 65 790 0.00% 66 882 0.00% 67 946 0.00% 68 1170 0.00% 69 1557 0.01% 70 1994 0.01% 71 2247 0.01% 72 2041 0.01% 73 2030 0.01% 74 2145 0.01% 75 2411 0.01% 76 2524 0.01% 77 2711 0.01% 78 3063 0.01% 79 3357 0.01% 80 3967 0.02% 81 4293 0.02% 82 4918 0.02% 83 5582 0.02% 84 6940 0.03% 85 7741 0.03% 86 8033 0.03% 87 8671 0.04% 88 9580 0.04% 89 10143 0.04% 90 11077 0.05% 91 11621 0.05% 92 12388 0.05% 93 14073 0.06% 94 14684 0.06% 95 16046 0.07% 96 16535 0.07% 97 17851 0.08% 98 18514 0.08% 99 19605 0.08% 100 20967 0.09% 101 21778 0.09% 102 23272 0.10% 103 24924 0.11% 104 26355 0.11% 105 28207 0.12% 106 29477 0.13% 107 30431 0.13% 108 32251 0.14% 109 34215 0.15% 110 35879 0.15% 111 36836 0.16% 112 38839 0.17% 113 41294 0.18% 114 42922 0.18% 115 45965 0.20% 116 47397 0.20% 117 48628 0.21% 118 50237 0.21% 119 52142 0.22% 120 54523 0.23% 121 57003 0.24% 122 59708 0.25% 123 63344 0.27% 124 66084 0.28% 125 68337 0.29% 126 70530 0.30% 127 73879 0.32% 128 76911 0.33% 129 79738 0.34% 130 83479 0.36% 131 87154 0.37% 132 91447 0.39% 133 96423 0.41% 134 102151 0.44% 135 107752 0.46% 136 114321 0.49% 137 120620 0.51% 138 128402 0.55% 139 139613 0.60% 140 150182 0.64% 141 165353 0.71% 142 183355 0.78% 143 207297 0.88% 144 240634 1.03% 145 288685 1.23% 146 361898 1.54% 147 492801 2.10% 148 757761 3.23% 149 1458360 6.22% 150 6155005 26.26% 151 10260598 43.78% 23435256 reads passed initial QC criterion=sequence-density sequence-density=1.35 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=11 prefix-density=1.41 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=12.91 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.0 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=8 prefix-density=1.08 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=54.83 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=6.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7473370 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:32:42 Started mapping on | Dec 07 15:32:42 Finished on | Dec 07 15:37:07 Mapping speed, Million of reads per hour | 318.37 Number of input reads | 23435256 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 22102752 Uniquely mapped reads % | 94.31% Average mapped length | 293.40 Number of splices: Total | 23449742 Number of splices: Annotated (sjdb) | 22136002 Number of splices: GT/AG | 23161794 Number of splices: GC/AG | 258269 Number of splices: AT/AC | 8987 Number of splices: Non-canonical | 20692 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 172306 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 17198 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1174687 1174687 1174687 N_multimapping 172306 172306 172306 N_noFeature 665650 21414089 901154 N_ambiguous 530028 2787 77869 UnstrandedReadsAssigned:20907074 PositiveStrandReadsAssigned:685876 NegativeStrandReadsAssigned:21123729 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473370-trimmed-pair1.fastq SRR7473370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,435,256 reads, 21,173,266 reads pseudoaligned [quant] estimated average fragment length: 267.764 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR7473370.ke.tsv 35125 SRR7473370.se.tsv 88098 total ==> SRR7473370.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.979 0 0 PNS24247 1044 777.236 41.2107 3.29625 PNS24249 1928 1661.24 58.15 2.17611 PNS24246 1044 777.236 41.2107 3.29625 PNS24248 1044 777.236 41.2107 3.29625 PNS24244 1471 1204.24 84.2178 4.34766 PNS24243 293 90.9206 0 0 KQK14069 1603 1336.24 456.097 21.2196 KQK14071 474 229.949 51.9309 14.0397 ==> SRR7473370.se.tsv <== BRADI_1g14170v3 799 BRADI_1g53295v3 51 BRADI_1g59795v3 220 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 1329 BRADI_1g74790v3 241 BRADI_1g09890v3 13 BRADI_1g77505v3 328 BRADI_1g48960v3 0 SRR7473370 completed mapping pipeline successfully