Starting /dee2/code/volunteer_pipeline.sh SRR7473371 current disk space = 1542349705216 free memory = 1602366128 SRR7473371 SRAfilesize 42eca00249833ca119fa6790f427ea31 SRR7473371.sra SRR7473371.sra file validated SRR7473371 is paired end SRR7473371 is conventional basespace SRR7473371 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.38775 34.0 33.0 34.0 33.0 34.0 2 33.483 34.0 34.0 34.0 33.0 34.0 3 33.52225 34.0 34.0 34.0 33.0 34.0 4 33.47825 34.0 34.0 34.0 33.0 34.0 5 33.44775 34.0 34.0 34.0 33.0 34.0 6 37.141 38.0 38.0 38.0 36.0 38.0 7 37.367 38.0 38.0 38.0 37.0 38.0 8 37.45975 38.0 38.0 38.0 37.0 38.0 9 37.5115 38.0 38.0 38.0 37.0 38.0 10-14 37.458000000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.40845 38.0 38.0 38.0 37.0 38.0 20-24 37.41925 38.0 38.0 38.0 37.0 38.0 25-29 37.290949999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.07105 38.0 38.0 38.0 36.2 38.0 35-39 36.9 38.0 38.0 38.0 35.8 38.0 40-44 36.8517 38.0 38.0 38.0 35.2 38.0 45-49 36.83919999999999 38.0 38.0 38.0 35.0 38.0 50-54 36.68470000000001 38.0 38.0 38.0 34.4 38.0 55-59 36.74905 38.0 38.0 38.0 34.8 38.0 60-64 36.7322 38.0 38.0 38.0 34.6 38.0 65-69 36.5398 38.0 38.0 38.0 34.0 38.0 70-74 36.3368 38.0 38.0 38.0 33.6 38.0 75-79 36.33669999999999 38.0 38.0 38.0 33.8 38.0 80-84 36.35705 38.0 37.6 38.0 33.6 38.0 85-89 36.177 38.0 37.0 38.0 33.2 38.0 90-94 35.789100000000005 38.0 36.6 38.0 31.6 38.0 95-99 35.5812 38.0 36.0 38.0 31.0 38.0 100-104 35.3191 38.0 36.0 38.0 29.2 38.0 105-109 35.1557 38.0 35.6 38.0 28.8 38.0 110-114 34.89395 38.0 35.0 38.0 28.0 38.0 115-119 34.46635 38.0 35.0 38.0 25.2 38.0 120-124 34.318200000000004 38.0 34.8 38.0 25.0 38.0 125-129 33.76145 38.0 34.0 38.0 23.0 38.0 130-134 33.2043 38.0 34.0 38.0 15.0 38.0 135-139 32.666999999999994 38.0 33.2 38.0 14.4 38.0 140-144 31.90825 36.2 32.2 38.0 13.8 38.0 145-149 30.9403 36.0 31.0 38.0 8.6 38.0 150-151 26.302374999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 2.0 12 1.0 13 1.0 14 5.0 15 4.0 16 2.0 17 4.0 18 6.0 19 4.0 20 9.0 21 11.0 22 11.0 23 10.0 24 15.0 25 21.0 26 29.0 27 33.0 28 51.0 29 63.0 30 60.0 31 89.0 32 107.0 33 163.0 34 249.0 35 399.0 36 1008.0 37 1639.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.070087609511894 11.163954943679599 10.438047559449313 42.3279098873592 2 25.6 15.625 32.025 26.75 3 22.5 20.225 23.599999999999998 33.675 4 28.725 25.424999999999997 19.475 26.375 5 26.05 30.099999999999998 23.225 20.625 6 21.2 32.975 23.375 22.45 7 18.075 21.025 40.25 20.65 8 20.875 21.7 28.975 28.449999999999996 9 20.3 19.3 31.8 28.599999999999998 10-14 23.275000000000002 25.7 24.22 26.805 15-19 23.66 24.68 25.105 26.555 20-24 23.474999999999998 24.89 25.27 26.365 25-29 23.724655819774718 24.625782227784732 25.23654568210263 26.413016270337923 30-34 23.275000000000002 25.069999999999997 24.884999999999998 26.77 35-39 23.272454340755566 24.50838128596447 25.649236927695775 26.56992744558419 40-44 23.5933664011223 25.046345007264893 25.16659151260083 26.193697079011972 45-49 23.755191913126158 24.535855477155582 24.78106390431867 26.92788870539959 50-54 24.03 24.16 25.55 26.26 55-59 24.11 24.9 24.560000000000002 26.43 60-64 23.735 24.605 24.725 26.935 65-69 24.279999999999998 24.34 25.45 25.929999999999996 70-74 24.474999999999998 24.145 24.45 26.93 75-79 24.665 23.97 24.65 26.715 80-84 24.85 24.255 24.68 26.215 85-89 24.34 24.615000000000002 24.025 27.02 90-94 24.24227243124092 24.011823054957166 24.597966033765843 27.14793848003607 95-99 24.42140066125639 24.551648131449756 24.160905720869653 26.866045486424206 100-104 24.315 24.82 24.740000000000002 26.125 105-109 24.34 24.709999999999997 24.86 26.090000000000003 110-114 24.435000000000002 24.555 25.03 25.979999999999997 115-119 24.51 24.34 24.18 26.97 120-124 24.31188069262336 24.46201581423281 24.652186968271444 26.573916524872388 125-129 24.898531843463445 23.956506488951245 25.033822718845517 26.111138948739793 130-134 24.666801292407108 24.146809369951537 24.813206785137318 26.373182552504037 135-139 24.65732638713267 24.389256992564867 24.56628395124172 26.387132669060748 140-144 24.964894684052155 25.110330992978934 23.55566700100301 26.369107321965895 145-149 24.40338334508106 24.650085590574967 24.559460275903735 26.387070788440237 150-151 24.52948557089084 24.755332496863236 23.902132998745294 26.813048933500628 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 2.0 27 4.0 28 4.0 29 4.0 30 6.0 31 11.0 32 13.0 33 15.5 34 20.5 35 32.5 36 50.0 37 64.0 38 73.5 39 83.5 40 107.0 41 134.0 42 155.5 43 165.5 44 170.0 45 186.5 46 192.0 47 175.5 48 160.5 49 155.0 50 143.5 51 133.0 52 125.0 53 115.0 54 115.0 55 103.5 56 92.5 57 95.0 58 100.0 59 102.5 60 96.0 61 85.0 62 77.5 63 74.0 64 78.0 65 75.0 66 67.0 67 67.0 68 57.0 69 47.5 70 38.0 71 29.0 72 27.5 73 22.5 74 17.5 75 13.0 76 8.5 77 4.0 78 2.5 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.125 30-34 0.0 35-39 0.075 40-44 0.20500000000000002 45-49 0.08499999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.19499999999999998 95-99 0.19 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.09 125-129 0.215 130-134 0.96 135-139 1.145 140-144 0.3 145-149 0.69 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57940131912734 97.15 2 1.36986301369863 2.7 3 0.050735667174023336 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0125 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0125 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.1125 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.1875 0.0 0.0 0.025 0.0 84-85 0.2 0.0 0.0 0.025 0.0 86-87 0.275 0.0 0.0 0.025 0.0 88-89 0.325 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.4875 0.0 0.0 0.025 0.0 94-95 0.575 0.0 0.0 0.025 0.0 96-97 0.6 0.0 0.0 0.025 0.0 98-99 0.7625 0.0 0.0 0.025 0.0 100-101 0.8875 0.0 0.0 0.025 0.0 102-103 1.075 0.0 0.0 0.025 0.0 104-105 1.175 0.0 0.0 0.025 0.0 106-107 1.4 0.0 0.0 0.025 0.0 108-109 1.6375 0.0 0.0 0.025 0.0 110-111 1.825 0.0 0.0 0.025 0.0 112-113 1.9625 0.0 0.0 0.025 0.0 114-115 2.3 0.0 0.0 0.025 0.0 116-117 2.5999999999999996 0.0 0.0 0.025 0.0 118-119 2.8 0.0 0.0 0.025 0.0 120-121 3.0375 0.0 0.0 0.025 0.0 122-123 3.2 0.0 0.0 0.025 0.0 124-125 3.575 0.0 0.0 0.025 0.0 126-127 3.95 0.0 0.0 0.025 0.0 128-129 4.275 0.0 0.0 0.025 0.0 130-131 4.762499999999999 0.0 0.0 0.025 0.0 132-133 5.300000000000001 0.0 0.0 0.025 0.0 134-135 5.9 0.0 0.0 0.025 0.0 136-137 6.475 0.0 0.0 0.025 0.0 138-139 6.85 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGTGA 10 0.006830828 145.0 1 >>END_MODULE SRR7473371 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3055 33.0 33.0 34.0 32.0 34.0 2 32.273 33.0 33.0 34.0 32.0 34.0 3 32.27225 34.0 33.0 34.0 32.0 34.0 4 32.19275 33.0 33.0 34.0 32.0 34.0 5 32.41825 34.0 33.0 34.0 32.0 34.0 6 36.41725 38.0 38.0 38.0 35.0 38.0 7 36.597 38.0 38.0 38.0 36.0 38.0 8 36.7725 38.0 38.0 38.0 36.0 38.0 9 36.74125 38.0 38.0 38.0 36.0 38.0 10-14 36.79145 38.0 38.0 38.0 36.0 38.0 15-19 36.4692 38.0 38.0 38.0 35.8 38.0 20-24 36.2803 38.0 38.0 38.0 35.2 38.0 25-29 36.3681 38.0 38.0 38.0 35.2 38.0 30-34 36.3875 38.0 38.0 38.0 36.0 38.0 35-39 36.2589 38.0 38.0 38.0 35.4 38.0 40-44 36.28869999999999 38.0 38.0 38.0 35.4 38.0 45-49 36.0817 38.0 38.0 38.0 34.4 38.0 50-54 36.1669 38.0 38.0 38.0 34.4 38.0 55-59 36.15865 38.0 38.0 38.0 34.2 38.0 60-64 36.0204 38.0 38.0 38.0 34.0 38.0 65-69 35.662400000000005 38.0 38.0 38.0 33.4 38.0 70-74 35.8615 38.0 38.0 38.0 33.6 38.0 75-79 35.7787 38.0 38.0 38.0 33.0 38.0 80-84 35.7297 38.0 38.0 38.0 32.8 38.0 85-89 35.58395 38.0 38.0 38.0 32.4 38.0 90-94 35.4656 38.0 37.8 38.0 32.0 38.0 95-99 34.963800000000006 38.0 36.8 38.0 29.4 38.0 100-104 34.29905000000001 38.0 36.0 38.0 24.4 38.0 105-109 34.142399999999995 38.0 36.0 38.0 23.8 38.0 110-114 33.81419999999999 38.0 35.0 38.0 19.4 38.0 115-119 33.451150000000005 38.0 35.0 38.0 15.0 38.0 120-124 33.2729 38.0 34.6 38.0 14.8 38.0 125-129 33.031549999999996 38.0 34.2 38.0 14.4 38.0 130-134 32.6376 38.0 34.0 38.0 14.0 38.0 135-139 32.31725 38.0 33.2 38.0 13.2 38.0 140-144 31.536649999999998 38.0 31.6 38.0 10.8 38.0 145-149 30.546700000000005 37.6 31.0 38.0 2.0 38.0 150-151 25.203875 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 22.0 4 19.0 5 5.0 6 1.0 7 2.0 8 2.0 9 1.0 10 0.0 11 2.0 12 1.0 13 6.0 14 4.0 15 9.0 16 10.0 17 7.0 18 7.0 19 16.0 20 16.0 21 19.0 22 18.0 23 20.0 24 26.0 25 33.0 26 27.0 27 29.0 28 48.0 29 39.0 30 59.0 31 72.0 32 89.0 33 134.0 34 168.0 35 315.0 36 717.0 37 2020.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.960844139333844 16.323417238749048 12.306127637935418 33.40961098398169 2 30.16359918200409 23.108384458077712 27.223926380368095 19.504089979550102 3 23.59263050153531 25.127942681678604 26.381780962128964 24.897645854657114 4 27.011788826242956 30.0871348026653 19.11840082009226 23.78267555099949 5 29.02160101651842 31.029224904701397 19.771283354510803 20.177890724269375 6 23.029839326702373 35.093088497832184 19.867380770211682 22.00969140525376 7 23.047667342799187 18.052738336713997 33.97565922920893 24.92393509127789 8 23.874213836477985 22.163522012578614 24.20125786163522 29.761006289308177 9 24.106693507800706 22.29491696024157 26.472068444891793 27.12632108706593 10-14 26.273188879392688 25.192298024232063 22.44733799205671 26.08717510431854 15-19 25.69165947510026 24.315955124625617 24.22965632773237 25.762729072541752 20-24 25.806122968773877 25.016555448015893 24.120014263155216 25.057307320055017 25-29 25.590131478755268 24.945428701964566 23.554495152038175 25.90994466724199 30-34 26.32542062725563 24.6378284959081 23.234890459004728 25.801860417831545 35-39 26.006223537213693 25.32265469570984 23.292353211243178 25.378768555833293 40-44 26.77864609763524 24.495077641327516 23.870902263270068 24.855373997767177 45-49 26.73171230077646 23.738250919493257 24.19799754801798 25.3320392317123 50-54 26.57364025259727 24.551843552658383 23.604603788959054 25.269912405785295 55-59 26.89318909035502 24.40448981664889 23.454720910152876 25.24760018284321 60-64 26.14389075715887 25.03311933149903 23.682869662692347 25.14012024864975 65-69 26.38610554442218 24.608190740455267 23.960741996814143 25.04496171830841 70-74 27.049388355921018 24.902289223897263 23.110502004974368 24.93782041520735 75-79 26.40304182509506 23.918884664131813 23.878326996197718 25.79974651457541 80-84 26.719764610389614 24.304991883116884 23.64549512987013 25.329748376623378 85-89 26.51266238689784 24.03578830308851 23.85381388060456 25.59773542940909 90-94 26.305638735217983 23.884687611023704 24.417601380500432 25.39207227325788 95-99 26.88807773379261 24.70310009768135 23.422960259112642 24.985861909413398 100-104 26.872634907469806 24.72137266082629 23.809030117671455 24.59696231403245 105-109 27.043306677744315 24.78450514072074 23.205940388410013 24.966247793124936 110-114 27.583160083160084 24.443866943866944 22.962577962577964 25.01039501039501 115-119 26.836231507915908 25.247858811315858 23.41552037373475 24.50038930703348 120-124 26.98207068089957 24.76940615607835 23.77448440252876 24.474038760493315 125-129 27.685309624728628 24.987077432027295 22.85743823012509 24.470174713118993 130-134 28.14497834605073 24.8092390183543 23.546091977727365 23.499690657867603 135-139 27.35940944276414 25.037166145486232 23.66842671861383 23.9349976931358 140-144 27.67179487179487 25.215384615384618 23.348717948717947 23.76410256410256 145-149 28.005796801407794 25.09186895088246 23.751358625329953 23.150975622379793 150-151 28.29748639543923 25.239699403990674 23.477584866545737 22.98522933402436 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 9.5 2 5.5 3 4.5 4 3.0 5 4.0 6 3.5 7 1.5 8 1.0 9 1.0 10 1.5 11 1.0 12 3.5 13 3.5 14 1.0 15 1.0 16 3.0 17 3.5 18 1.5 19 1.0 20 1.0 21 1.5 22 1.5 23 1.0 24 1.0 25 2.5 26 4.5 27 4.5 28 6.0 29 9.0 30 8.0 31 8.0 32 10.5 33 12.5 34 17.0 35 19.5 36 31.5 37 48.5 38 60.0 39 79.5 40 106.5 41 126.0 42 146.5 43 158.5 44 158.5 45 158.5 46 159.5 47 150.0 48 131.5 49 137.5 50 137.5 51 128.0 52 118.5 53 113.5 54 126.0 55 124.5 56 111.5 57 107.0 58 95.5 59 101.0 60 101.0 61 92.0 62 97.5 63 95.5 64 92.0 65 88.5 66 80.0 67 71.5 68 62.0 69 52.5 70 52.5 71 42.0 72 30.5 73 19.5 74 10.0 75 7.0 76 5.0 77 7.0 78 4.0 79 1.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 2.1999999999999997 3 2.3 4 2.45 5 1.625 6 1.975 7 1.4000000000000001 8 0.625 9 0.65 10-14 0.545 15-19 1.505 20-24 1.8450000000000002 25-29 1.505 30-34 1.635 35-39 1.9849999999999999 40-44 1.47 45-49 2.12 50-54 1.82 55-59 1.555 60-64 1.87 65-69 2.6950000000000003 70-74 1.4949999999999999 75-79 1.375 80-84 1.44 85-89 1.085 90-94 1.485 95-99 2.7449999999999997 100-104 3.5450000000000004 105-109 3.71 110-114 3.8 115-119 3.675 120-124 3.51 125-129 3.27 130-134 3.02 135-139 2.465 140-144 2.5 145-149 3.395 150-151 3.5249999999999995 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23031546550396 95.75 2 1.2567324955116697 2.45 3 0.4103616311874839 1.2 4 0.025647601949217745 0.1 5 0.025647601949217745 0.125 6 0.025647601949217745 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025647601949217745 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit GCTCGATCGATCAGTAGTGTGATCTCAGAGCTCCCATCGCGATCGAGCAG 6 0.15 No Hit CAGCTCGATCGATCAGTAGTGTGATCTCAGAGCTCCCATCGCGATCGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.45 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 2.9749999999999996 0.0 0.0 0.0 0.0 124-125 3.3375000000000004 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.6375 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140376 spots for SRR7473371.sra Written 1140376 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra Read 1140370 spots for SRR7473371.sra Written 1140370 spots for SRR7473371.sra SRR ids: ['SRR7473371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_14fozc2v SRR7473371.sra spots: 22807406 blocks: [[1, 1140370], [1140371, 2280740], [2280741, 3421110], [3421111, 4561480], [4561481, 5701850], [5701851, 6842220], [6842221, 7982590], [7982591, 9122960], [9122961, 10263330], [10263331, 11403700], [11403701, 12544070], [12544071, 13684440], [13684441, 14824810], [14824811, 15965180], [15965181, 17105550], [17105551, 18245920], [18245921, 19386290], [19386291, 20526660], [20526661, 21667030], [21667031, 22807406]] SRR7473371 file size 7706981 SRR7473371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473371 SRR7473371_1.fastq SRR7473371_2.fastq Input file: SRR7473371_1.fastq Paired file: SRR7473371_2.fastq trimmed: SRR7473371-trimmed-pair1.fastq, SRR7473371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:37:41 2024 >> started Sat Dec 7 15:38:07 2024 >> done (26.523s) 22807406 read pairs processed; of these: 38522 ( 0.17%) short read pairs filtered out after trimming by size control 62987 ( 0.28%) empty read pairs filtered out after trimming by size control 22705897 (99.55%) read pairs available; of these: 12926063 (56.93%) trimmed read pairs available after processing 9779834 (43.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 25 0.00% 20 18 0.00% 21 25 0.00% 22 20 0.00% 23 17 0.00% 24 23 0.00% 25 19 0.00% 26 29 0.00% 27 25 0.00% 28 27 0.00% 29 36 0.00% 30 29 0.00% 31 35 0.00% 32 47 0.00% 33 36 0.00% 34 48 0.00% 35 51 0.00% 36 60 0.00% 37 58 0.00% 38 65 0.00% 39 69 0.00% 40 67 0.00% 41 89 0.00% 42 72 0.00% 43 112 0.00% 44 127 0.00% 45 151 0.00% 46 123 0.00% 47 131 0.00% 48 164 0.00% 49 190 0.00% 50 206 0.00% 51 253 0.00% 52 254 0.00% 53 267 0.00% 54 270 0.00% 55 287 0.00% 56 328 0.00% 57 378 0.00% 58 436 0.00% 59 512 0.00% 60 503 0.00% 61 606 0.00% 62 671 0.00% 63 833 0.00% 64 843 0.00% 65 921 0.00% 66 1053 0.00% 67 1210 0.01% 68 1462 0.01% 69 2026 0.01% 70 2253 0.01% 71 1889 0.01% 72 1975 0.01% 73 2180 0.01% 74 2364 0.01% 75 2677 0.01% 76 2960 0.01% 77 3184 0.01% 78 3648 0.02% 79 4057 0.02% 80 4595 0.02% 81 5012 0.02% 82 5573 0.02% 83 6080 0.03% 84 7786 0.03% 85 8895 0.04% 86 9537 0.04% 87 10013 0.04% 88 11100 0.05% 89 11588 0.05% 90 12474 0.05% 91 13438 0.06% 92 13840 0.06% 93 15524 0.07% 94 16408 0.07% 95 17805 0.08% 96 18592 0.08% 97 19440 0.09% 98 20517 0.09% 99 21776 0.10% 100 23171 0.10% 101 23474 0.10% 102 24981 0.11% 103 26417 0.12% 104 27845 0.12% 105 29712 0.13% 106 31039 0.14% 107 32232 0.14% 108 34400 0.15% 109 36037 0.16% 110 37380 0.16% 111 38354 0.17% 112 40385 0.18% 113 42734 0.19% 114 44026 0.19% 115 46602 0.21% 116 48471 0.21% 117 49810 0.22% 118 51550 0.23% 119 53466 0.24% 120 56145 0.25% 121 58386 0.26% 122 60918 0.27% 123 63643 0.28% 124 66368 0.29% 125 67438 0.30% 126 70595 0.31% 127 73817 0.33% 128 76915 0.34% 129 80766 0.36% 130 83676 0.37% 131 87018 0.38% 132 91337 0.40% 133 95988 0.42% 134 100601 0.44% 135 106595 0.47% 136 112520 0.50% 137 120045 0.53% 138 127356 0.56% 139 137341 0.60% 140 148569 0.65% 141 164169 0.72% 142 182438 0.80% 143 205903 0.91% 144 237436 1.05% 145 285145 1.26% 146 354926 1.56% 147 480185 2.11% 148 732540 3.23% 149 1428449 6.29% 150 5934253 26.14% 151 9779834 43.07% 22705897 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=14 prefix-density=0.98 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=30.14 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.3 sequence=GTTCCAACAAGTAATTCACATATACAATTCCATTTCTTTGTATTCAGAAACTTACAATTCAAATCGTTTACCTGTGCGGCGATGAATCAAAAAAGGTACGGAATTTTCCAAACATGCATATATAGTGACGGCATTCTTAATTACTAGAATCAAGTGGCCTTGGCGTAGAAGGACCCGGTCTTCATGGCGTCGTCGTTGGCTTCACCCAGTGCAGCCTCACTGAGGTACTTGTCTGCAAGCTGCACCCTCTTCACGTTCTCCTGCTCCTGGACAAGCATGTGCCCATACTCCATGAGCTTACTGATTGTCATCTTCGGCTGCTCGAACTTGGGCGGGCCCTCCTTCGAGTTCACCAGCCTCTTGGAAATGTTCTCCACACCGATTTCCCCGACCCATTTCCGCACCTCGTCATCGTAAACCCTGGCACGCAGCGCGCCGAAGAAGTCGATGCTCTGCCCCGGGAACATGTCGACGAGCCTAACCACCGCCTCGTCGGGGACGCCATCGGTGC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=34 prefix-density=1.14 prefix-fanout=2.2 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=76.92 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.8 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGCTGGTTCTCGGCATGGCGCCGGAGAAG SRR7473371 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:38:56 Started mapping on | Dec 07 15:38:56 Finished on | Dec 07 15:42:36 Mapping speed, Million of reads per hour | 371.55 Number of input reads | 22705897 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21603561 Uniquely mapped reads % | 95.15% Average mapped length | 292.82 Number of splices: Total | 22071717 Number of splices: Annotated (sjdb) | 20713179 Number of splices: GT/AG | 21796129 Number of splices: GC/AG | 241987 Number of splices: AT/AC | 12303 Number of splices: Non-canonical | 21298 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169259 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 17103 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 950529 950529 950529 N_multimapping 169259 169259 169259 N_noFeature 772713 20858210 1079444 N_ambiguous 525214 3029 89208 UnstrandedReadsAssigned:20305634 PositiveStrandReadsAssigned:742322 NegativeStrandReadsAssigned:20434909 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7473371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473371-trimmed-pair1.fastq SRR7473371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,705,897 reads, 20,458,602 reads pseudoaligned [quant] estimated average fragment length: 271.26 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR7473371.ke.tsv 35125 SRR7473371.se.tsv 88098 total ==> SRR7473371.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 666.39 49.1171 4.57277 PNS24247 1044 773.74 21.9178 1.75743 PNS24249 1928 1657.74 41.3288 1.54672 PNS24246 1044 773.74 21.9178 1.75743 PNS24248 1044 773.74 21.9178 1.75743 PNS24244 1471 1200.74 49.8007 2.57313 PNS24243 293 92.5445 0 0 KQK14069 1603 1332.74 671 31.2357 KQK14071 474 228.996 24.8743 6.73905 ==> SRR7473371.se.tsv <== BRADI_1g14170v3 782 BRADI_1g53295v3 3626 BRADI_1g59795v3 827 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 449 BRADI_1g74790v3 124 BRADI_1g09890v3 5 BRADI_1g77505v3 192 BRADI_1g48960v3 0 SRR7473371 completed mapping pipeline successfully