Starting /dee2/code/volunteer_pipeline.sh SRR7473372 current disk space = 1542350495744 free memory = 1600032680 SRR7473372 SRAfilesize 05e75131442d45387e4715672a6a7e9d SRR7473372.sra SRR7473372.sra file validated SRR7473372 is paired end SRR7473372 is conventional basespace SRR7473372 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.484 34.0 34.0 34.0 33.0 34.0 2 33.53 34.0 34.0 34.0 33.0 34.0 3 33.53375 34.0 34.0 34.0 33.0 34.0 4 33.5725 34.0 34.0 34.0 33.0 34.0 5 33.623 34.0 34.0 34.0 33.0 34.0 6 37.1925 38.0 38.0 38.0 36.0 38.0 7 37.52375 38.0 38.0 38.0 37.0 38.0 8 37.5635 38.0 38.0 38.0 38.0 38.0 9 37.63925 38.0 38.0 38.0 38.0 38.0 10-14 37.57525 38.0 38.0 38.0 38.0 38.0 15-19 37.5896 38.0 38.0 38.0 38.0 38.0 20-24 37.58624999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.44665 38.0 38.0 38.0 38.0 38.0 30-34 37.3794 38.0 38.0 38.0 37.8 38.0 35-39 37.245000000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.0419 38.0 38.0 38.0 36.6 38.0 45-49 37.002900000000004 38.0 38.0 38.0 36.0 38.0 50-54 37.147000000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.19565 38.0 38.0 38.0 36.6 38.0 60-64 37.08045 38.0 38.0 38.0 36.2 38.0 65-69 36.92979999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.844849999999994 38.0 38.0 38.0 35.4 38.0 75-79 36.71195 38.0 38.0 38.0 35.2 38.0 80-84 36.59845 38.0 38.0 38.0 34.8 38.0 85-89 36.4214 38.0 38.0 38.0 34.0 38.0 90-94 36.05315 38.0 37.6 38.0 33.0 38.0 95-99 35.716150000000006 38.0 37.0 38.0 31.8 38.0 100-104 35.463849999999994 38.0 36.2 38.0 31.0 38.0 105-109 35.19984999999999 38.0 36.0 38.0 29.0 38.0 110-114 34.85145 38.0 35.4 38.0 27.8 38.0 115-119 34.42005 38.0 34.8 38.0 25.8 38.0 120-124 33.847950000000004 38.0 34.0 38.0 23.0 38.0 125-129 33.0453 37.4 33.0 38.0 17.4 38.0 130-134 31.933750000000003 36.6 31.2 38.0 14.4 38.0 135-139 30.9214 36.0 30.2 38.0 13.2 38.0 140-144 30.061200000000003 35.0 28.0 38.0 10.4 38.0 145-149 27.8033 33.0 20.6 38.0 2.0 38.0 150-151 20.902124999999998 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 0.0 11 3.0 12 2.0 13 2.0 14 1.0 15 2.0 16 3.0 17 7.0 18 9.0 19 13.0 20 13.0 21 5.0 22 13.0 23 14.0 24 17.0 25 17.0 26 23.0 27 40.0 28 38.0 29 54.0 30 58.0 31 73.0 32 125.0 33 160.0 34 266.0 35 577.0 36 1295.0 37 1166.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.08016032064128 14.504008016032063 11.097194388777556 34.3186372745491 2 25.7 17.2 31.324999999999996 25.775 3 20.8 24.55 26.174999999999997 28.475 4 23.325000000000003 31.35 21.775 23.549999999999997 5 25.15 31.65 22.525000000000002 20.674999999999997 6 21.125 31.974999999999998 23.9 23.0 7 16.375 21.8 40.150000000000006 21.675 8 20.75 22.725 26.650000000000002 29.875 9 19.775000000000002 22.225 30.099999999999998 27.900000000000002 10-14 23.119999999999997 25.83 24.18 26.87 15-19 22.115000000000002 25.95 25.540000000000003 26.395000000000003 20-24 22.045 25.740000000000002 25.2 27.015 25-29 22.74 25.374999999999996 25.53 26.355 30-34 22.64 24.92 25.965 26.474999999999998 35-39 22.911455727863935 25.97798899449725 24.87743871935968 26.23311655827914 40-44 22.725905124862102 25.814863102998697 25.50396148831612 25.955270283823083 45-49 23.12543798177996 25.422965261787965 25.442987286014617 26.00860947041746 50-54 22.495 25.169999999999998 25.765 26.57 55-59 22.58 24.85 25.55 27.02 60-64 22.75 25.045 25.435000000000002 26.77 65-69 22.73 25.185000000000002 25.224999999999998 26.86 70-74 22.955000000000002 26.035000000000004 25.330000000000002 25.679999999999996 75-79 23.018452767915186 25.2437865679852 25.23878581787268 26.498974846226936 80-84 22.653398009701455 25.443816572485872 25.193779066860028 26.70900635095264 85-89 23.04 25.775 24.759999999999998 26.424999999999997 90-94 23.157736755215367 25.088798839361647 24.948721796988345 26.80474260843464 95-99 22.965859527748535 25.076452599388375 25.56274126435053 26.39494660851256 100-104 23.485 24.95 25.005 26.56 105-109 23.119999999999997 25.085 25.56 26.235000000000003 110-114 23.56 25.645 24.315 26.479999999999997 115-119 23.04 25.505 24.955 26.5 120-124 23.405 25.814999999999998 24.72 26.06 125-129 23.59759157049674 25.102860010035123 24.856999498243855 26.442548921224287 130-134 23.132444982838685 25.651120533010296 24.68705834847567 26.52937613567535 135-139 23.634528016153457 24.68955073195356 25.113579000504792 26.562342251388188 140-144 23.52793282043546 25.544325438728816 24.744808166138686 26.18293357469704 145-149 23.563537305150582 25.939565151591587 24.330323361751503 26.16657418150633 150-151 23.221493440968718 25.90817356205853 24.495459132189705 26.374873864783048 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.0 26 3.0 27 4.5 28 5.0 29 3.0 30 4.0 31 15.0 32 23.0 33 25.0 34 34.0 35 40.5 36 47.5 37 60.5 38 80.5 39 102.0 40 120.5 41 141.5 42 161.0 43 161.5 44 179.5 45 193.0 46 185.0 47 183.5 48 165.5 49 155.0 50 160.5 51 158.0 52 145.0 53 145.0 54 146.0 55 137.5 56 114.0 57 103.5 58 101.5 59 87.5 60 77.5 61 65.0 62 59.0 63 57.0 64 52.5 65 46.0 66 39.5 67 31.0 68 27.5 69 29.0 70 23.0 71 19.0 72 18.0 73 15.0 74 11.5 75 7.0 76 6.5 77 7.0 78 3.5 79 2.0 80 2.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.05 40-44 0.29 45-49 0.11 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.015 85-89 0.0 90-94 0.055 95-99 0.265 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.35000000000000003 130-134 0.9400000000000001 135-139 0.95 140-144 0.565 145-149 0.885 150-151 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15005138746146 95.5 2 1.4902363823227132 2.9000000000000004 3 0.1541623843782117 0.44999999999999996 4 0.12846865364850976 0.5 5 0.025693730729701953 0.125 6 0.025693730729701953 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025693730729701953 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGATCTCGTATGC 15 0.375 TruSeq Adapter, Index 22 (98% over 50bp) GGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCA 6 0.15 No Hit GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.7125 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.4375 0.0 0.0 0.0 0.0 128-129 5.824999999999999 0.0 0.0 0.0 0.0 130-131 6.3125 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.300000000000001 0.0 0.0 0.0 0.0 136-137 7.7125 0.0 0.0 0.0 0.0 138-139 8.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCTTC 10 0.00692859 144.3125 5 GTGAAGA 10 0.00692859 144.3125 1 AAAAAAA 35 1.2359198E-4 24.739286 50-54 >>END_MODULE SRR7473372 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13225 33.0 33.0 34.0 31.0 34.0 2 32.2325 33.0 33.0 34.0 32.0 34.0 3 32.30825 34.0 33.0 34.0 32.0 34.0 4 32.27975 34.0 33.0 34.0 32.0 34.0 5 32.2745 34.0 33.0 34.0 32.0 34.0 6 36.123 38.0 38.0 38.0 35.0 38.0 7 36.19375 38.0 38.0 38.0 34.0 38.0 8 36.36025 38.0 38.0 38.0 35.0 38.0 9 36.41825 38.0 38.0 38.0 35.0 38.0 10-14 36.4886 38.0 38.0 38.0 35.8 38.0 15-19 36.3136 38.0 38.0 38.0 35.6 38.0 20-24 36.11925 38.0 38.0 38.0 35.0 38.0 25-29 36.155499999999996 38.0 38.0 38.0 35.2 38.0 30-34 36.20219999999999 38.0 38.0 38.0 35.4 38.0 35-39 36.1597 38.0 38.0 38.0 35.4 38.0 40-44 36.2327 38.0 38.0 38.0 35.8 38.0 45-49 36.068200000000004 38.0 38.0 38.0 35.2 38.0 50-54 36.1254 38.0 38.0 38.0 35.0 38.0 55-59 36.12945 38.0 38.0 38.0 34.8 38.0 60-64 35.94155 38.0 38.0 38.0 34.2 38.0 65-69 35.6167 38.0 38.0 38.0 33.6 38.0 70-74 35.7232 38.0 38.0 38.0 33.6 38.0 75-79 35.69565 38.0 38.0 38.0 34.0 38.0 80-84 35.6338 38.0 38.0 38.0 34.0 38.0 85-89 35.51475000000001 38.0 38.0 38.0 33.4 38.0 90-94 35.31995 38.0 38.0 38.0 32.6 38.0 95-99 35.01989999999999 38.0 38.0 38.0 30.2 38.0 100-104 34.2995 38.0 37.0 38.0 25.0 38.0 105-109 34.251400000000004 38.0 36.8 38.0 24.2 38.0 110-114 33.942949999999996 38.0 36.0 38.0 20.6 38.0 115-119 33.674150000000004 38.0 35.0 38.0 18.6 38.0 120-124 33.57295 38.0 35.0 38.0 15.0 38.0 125-129 33.203649999999996 38.0 34.0 38.0 14.2 38.0 130-134 32.5669 38.0 33.0 38.0 13.0 38.0 135-139 32.027100000000004 38.0 33.0 38.0 11.8 38.0 140-144 31.4161 38.0 32.6 38.0 2.0 38.0 145-149 30.000699999999995 38.0 28.8 38.0 2.0 38.0 150-151 23.991999999999997 30.5 14.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 57.0 3 29.0 4 11.0 5 2.0 6 1.0 7 2.0 8 4.0 9 3.0 10 3.0 11 5.0 12 3.0 13 5.0 14 11.0 15 10.0 16 6.0 17 28.0 18 11.0 19 9.0 20 5.0 21 14.0 22 11.0 23 20.0 24 31.0 25 29.0 26 28.0 27 33.0 28 30.0 29 29.0 30 49.0 31 60.0 32 79.0 33 118.0 34 155.0 35 253.0 36 640.0 37 2216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.91024663107043 19.221967963386728 11.848461734045259 28.019323671497588 2 29.621154335113147 21.99338927027714 28.29900839054157 20.086448004068142 3 24.542217700915565 25.33062054933876 27.721261444557477 22.4059003051882 4 26.422764227642276 32.113821138211385 19.13109756097561 22.33231707317073 5 28.26307770441849 34.02742508887761 18.308786185881157 19.400711020822754 6 23.38524380903753 34.38856267551698 20.11743681388818 22.108756701557315 7 22.63573795564619 19.576854448126436 34.66734641855723 23.120061177670152 8 25.0 23.252279635258358 23.10030395136778 28.64741641337386 9 25.145459144953204 22.46395142929421 26.08145712117379 26.309132304578803 10-14 27.00984102952309 25.13247539742619 22.45268735806207 25.404996214988646 15-19 26.25732484076433 25.110828025477705 23.77579617834395 24.856050955414013 20-24 26.846874520043002 25.638662775815284 23.416781856345672 24.09768084779604 25-29 26.60438045642518 25.123806606422626 24.092510338489813 24.179302598662378 30-34 26.907958548164785 25.733830210832608 23.42641278268416 23.931798458318443 35-39 26.55554987473797 25.379620635001785 24.142338565366327 23.92249092489391 40-44 26.5979170920972 25.668776802123748 24.132121707167652 23.601184398611394 45-49 26.297169811320753 25.815217391304344 23.60028712059065 24.28732567678425 50-54 25.948623665798475 25.105970073029976 24.498238087942394 24.44716817322915 55-59 26.730651419236267 24.959158668572595 24.89279150500306 23.417398407188074 60-64 25.777255062384945 25.383514011045204 24.631826549396603 24.207404377173248 65-69 27.245524428623018 25.532683279162153 24.242893256977762 22.978899035237063 70-74 26.816927322907087 25.75385873453951 23.924154144945316 23.505059797608098 75-79 26.495245884878848 25.462631632757386 24.33289029751559 23.709232184848176 80-84 26.514028721827565 25.808759646343333 24.198906321868453 23.47830530996065 85-89 26.618337757810906 26.041453951398815 24.060649377169696 23.279558913620583 90-94 26.840867253016974 25.363059930456128 24.65739415013295 23.138678666393943 95-99 26.74592146569914 25.51592815603932 24.32195975503062 23.41619062323092 100-104 26.983380370021955 25.546148217832133 24.34409950872792 23.126371903418 105-109 26.935710933833878 25.6322018874811 23.822931331143437 23.609155847541583 110-114 27.31164830574845 25.928053046520127 23.980577455228946 22.779721192502482 115-119 27.097075780397862 26.39069235963227 23.850828442320676 22.661403417649197 120-124 27.372793354101766 25.4932502596054 24.091381100726895 23.04257528556594 125-129 27.65338459140735 25.637695464699465 24.006441893085356 22.702478050807834 130-134 27.4669855464282 25.579702609961526 23.863990849537277 23.089320994072995 135-139 27.86283231612703 25.447398365573605 24.30950656873901 22.38026274956036 140-144 28.351421188630493 26.015503875968992 23.364341085271317 22.2687338501292 145-149 28.227821740941273 25.900666389004584 23.984798000832985 21.886713869221158 150-151 29.51830948943431 26.079537997112485 22.680141750885944 21.722010762567265 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 18.0 1 15.0 2 11.0 3 9.5 4 9.0 5 8.0 6 6.5 7 3.5 8 1.5 9 1.5 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 1.0 19 0.5 20 1.5 21 3.0 22 3.0 23 2.0 24 1.0 25 1.0 26 2.5 27 8.0 28 9.0 29 5.5 30 3.5 31 5.5 32 11.0 33 14.0 34 19.5 35 27.0 36 40.0 37 54.5 38 67.0 39 90.5 40 111.0 41 114.5 42 129.0 43 150.0 44 163.0 45 178.5 46 179.5 47 170.5 48 175.5 49 176.0 50 153.0 51 134.0 52 124.5 53 128.0 54 148.5 55 154.5 56 128.0 57 104.5 58 100.0 59 94.5 60 86.0 61 75.5 62 75.5 63 66.0 64 58.0 65 58.0 66 47.0 67 47.0 68 47.0 69 35.5 70 32.0 71 25.0 72 18.0 73 18.0 74 17.0 75 12.0 76 5.0 77 3.5 78 3.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 1.675 3 1.7000000000000002 4 1.6 5 1.55 6 2.075 7 1.925 8 1.3 9 1.175 10-14 0.9249999999999999 15-19 1.875 20-24 2.335 25-29 2.0650000000000004 30-34 2.0549999999999997 35-39 2.205 40-44 2.06 45-49 2.48 50-54 2.095 55-59 2.06 60-64 2.22 65-69 3.085 70-74 2.17 75-79 2.19 80-84 2.165 85-89 2.06 90-94 2.22 95-99 2.8449999999999998 100-104 4.33 105-109 4.105 110-114 4.234999999999999 115-119 3.7350000000000003 120-124 3.6999999999999997 125-129 3.755 130-134 3.83 135-139 3.3300000000000005 140-144 3.25 145-149 3.9600000000000004 150-151 4.7625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13905401912639 94.925 2 1.3181700697854741 2.55 3 0.2843111915223572 0.8250000000000001 4 0.07753941586973379 0.3 5 0.051692943913155855 0.25 6 0.07753941586973379 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051692943913155855 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 16 0.4 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit GCGACTTATATTCTGTAGCAAGGTTAACCGAATAGGGGAGCCGAAGGGAA 6 0.15 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 6 0.15 No Hit GTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAA 5 0.125 No Hit CGGGAACTCAAAGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.9749999999999999 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 3.0374999999999996 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.487500000000001 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 4.987500000000001 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.85 0.0 0.0 0.0 0.0 132-133 6.325 0.0 0.0 0.0 0.0 134-135 6.875 0.0 0.0 0.0 0.0 136-137 7.3375 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCCAC 10 0.0065277154 147.09334 145 >>END_MODULE Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957578 spots for SRR7473372.sra Written 957578 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra Read 957564 spots for SRR7473372.sra Written 957564 spots for SRR7473372.sra SRR ids: ['SRR7473372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t_fm5mao SRR7473372.sra spots: 19151294 blocks: [[1, 957564], [957565, 1915128], [1915129, 2872692], [2872693, 3830256], [3830257, 4787820], [4787821, 5745384], [5745385, 6702948], [6702949, 7660512], [7660513, 8618076], [8618077, 9575640], [9575641, 10533204], [10533205, 11490768], [11490769, 12448332], [12448333, 13405896], [13405897, 14363460], [14363461, 15321024], [15321025, 16278588], [16278589, 17236152], [17236153, 18193716], [18193717, 19151294]] SRR7473372 file size 6468044 SRR7473372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473372 SRR7473372_1.fastq SRR7473372_2.fastq Input file: SRR7473372_1.fastq Paired file: SRR7473372_2.fastq trimmed: SRR7473372-trimmed-pair1.fastq, SRR7473372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:37:20 2024 >> started Sat Dec 7 15:37:53 2024 >> done (32.482s) 19151294 read pairs processed; of these: 50611 ( 0.26%) short read pairs filtered out after trimming by size control 141719 ( 0.74%) empty read pairs filtered out after trimming by size control 18958964 (99.00%) read pairs available; of these: 12924074 (68.17%) trimmed read pairs available after processing 6034890 (31.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 40 0.00% 20 27 0.00% 21 25 0.00% 22 32 0.00% 23 32 0.00% 24 36 0.00% 25 35 0.00% 26 24 0.00% 27 42 0.00% 28 37 0.00% 29 39 0.00% 30 45 0.00% 31 71 0.00% 32 57 0.00% 33 56 0.00% 34 68 0.00% 35 66 0.00% 36 65 0.00% 37 71 0.00% 38 82 0.00% 39 109 0.00% 40 109 0.00% 41 133 0.00% 42 143 0.00% 43 143 0.00% 44 150 0.00% 45 166 0.00% 46 198 0.00% 47 217 0.00% 48 247 0.00% 49 295 0.00% 50 351 0.00% 51 398 0.00% 52 424 0.00% 53 395 0.00% 54 443 0.00% 55 442 0.00% 56 530 0.00% 57 536 0.00% 58 607 0.00% 59 725 0.00% 60 775 0.00% 61 939 0.00% 62 1008 0.01% 63 1177 0.01% 64 1372 0.01% 65 1658 0.01% 66 1905 0.01% 67 2575 0.01% 68 3501 0.02% 69 7151 0.04% 70 8977 0.05% 71 7100 0.04% 72 5651 0.03% 73 5082 0.03% 74 4633 0.02% 75 4497 0.02% 76 4344 0.02% 77 4571 0.02% 78 4838 0.03% 79 5318 0.03% 80 5859 0.03% 81 6563 0.03% 82 7924 0.04% 83 9168 0.05% 84 10884 0.06% 85 11571 0.06% 86 12285 0.06% 87 12652 0.07% 88 13494 0.07% 89 14160 0.07% 90 15416 0.08% 91 16933 0.09% 92 17562 0.09% 93 20316 0.11% 94 21311 0.11% 95 22950 0.12% 96 23121 0.12% 97 22800 0.12% 98 22980 0.12% 99 23484 0.12% 100 25324 0.13% 101 26022 0.14% 102 28649 0.15% 103 30670 0.16% 104 32788 0.17% 105 35542 0.19% 106 35324 0.19% 107 34729 0.18% 108 35800 0.19% 109 39487 0.21% 110 40332 0.21% 111 39637 0.21% 112 42517 0.22% 113 47928 0.25% 114 47736 0.25% 115 50955 0.27% 116 51894 0.27% 117 51538 0.27% 118 53177 0.28% 119 53288 0.28% 120 56283 0.30% 121 58304 0.31% 122 62576 0.33% 123 66408 0.35% 124 71538 0.38% 125 73658 0.39% 126 75910 0.40% 127 78464 0.41% 128 80336 0.42% 129 83596 0.44% 130 87838 0.46% 131 91959 0.49% 132 98810 0.52% 133 105994 0.56% 134 115731 0.61% 135 125151 0.66% 136 134144 0.71% 137 145100 0.77% 138 155373 0.82% 139 164940 0.87% 140 181498 0.96% 141 202489 1.07% 142 228359 1.20% 143 259109 1.37% 144 299351 1.58% 145 362197 1.91% 146 450198 2.37% 147 587428 3.10% 148 854394 4.51% 149 1490449 7.86% 150 4876906 25.72% 151 6034890 31.83% 18958964 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.4 sequence=TTCATCTTATTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=34.57 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=1.3 sequence=CCTCACGGTTCATTAGTACCGGTTAGCTCAACGCATCGCTGCGCTTACACACCCGGCCTATCAACGTCGTCGTCTTCAACGTTCCTTCAGGACTCTCAAGGAGTCAGGGAGAACTCATCTCGGGGCAAGTTTCGTGCTTAGATGCTTTCAGCACTTATCTCTTCCGCATTTAGCTACCGGGCAGTGCCATTGGCATGACAACCCGAACACCAGTGATGCGTCCACTCCGGTCCTCTCGTACTAGG criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=29 prefix-density=0.96 prefix-fanout=2.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.13 sequence-density-rank=24 fanout-score=56.49 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=9.6 sequence=GAGAAGAAGGGC SRR7473372 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:38:41 Started mapping on | Dec 07 15:38:41 Finished on | Dec 07 15:45:26 Mapping speed, Million of reads per hour | 168.52 Number of input reads | 18958964 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16480317 Uniquely mapped reads % | 86.93% Average mapped length | 290.27 Number of splices: Total | 16850656 Number of splices: Annotated (sjdb) | 15897934 Number of splices: GT/AG | 16634221 Number of splices: GC/AG | 191256 Number of splices: AT/AC | 6990 Number of splices: Non-canonical | 18189 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 212862 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 37437 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.97% % of reads unmapped: other | 1.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2285441 2285441 2285441 N_multimapping 212862 212862 212862 N_noFeature 623767 15910914 826917 N_ambiguous 411195 2237 45400 UnstrandedReadsAssigned:15445355 PositiveStrandReadsAssigned:567166 NegativeStrandReadsAssigned:15608000 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7473372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473372-trimmed-pair1.fastq SRR7473372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,958,964 reads, 15,728,928 reads pseudoaligned [quant] estimated average fragment length: 266.718 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR7473372.ke.tsv 35125 SRR7473372.se.tsv 88098 total ==> SRR7473372.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.113 117.061 14.5122 PNS24247 1044 778.282 32.6059 3.4856 PNS24249 1928 1662.28 122.022 6.10732 PNS24246 1044 778.282 32.6059 3.4856 PNS24248 1044 778.282 32.6059 3.4856 PNS24244 1471 1205.28 128.1 8.84256 PNS24243 293 95.5298 0 0 KQK14069 1603 1337.28 708.657 44.0891 KQK14071 474 233.199 11.4602 4.08868 ==> SRR7473372.se.tsv <== BRADI_1g14170v3 774 BRADI_1g53295v3 32 BRADI_1g59795v3 183 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 387 BRADI_1g74790v3 643 BRADI_1g09890v3 1 BRADI_1g77505v3 134 BRADI_1g48960v3 0 SRR7473372 completed mapping pipeline successfully