Starting /dee2/code/volunteer_pipeline.sh SRR7473373 current disk space = 1542315098112 free memory = 1593908656 SRR7473373 SRAfilesize b3137973f1e76053ac8b3ae09b85cd9b SRR7473373.sra SRR7473373.sra file validated SRR7473373 is paired end SRR7473373 is conventional basespace SRR7473373 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4545 34.0 34.0 34.0 33.0 34.0 2 33.52475 34.0 34.0 34.0 33.0 34.0 3 33.53575 34.0 34.0 34.0 33.0 34.0 4 33.5695 34.0 34.0 34.0 33.0 34.0 5 33.58025 34.0 34.0 34.0 33.0 34.0 6 37.096 38.0 38.0 38.0 36.0 38.0 7 37.411 38.0 38.0 38.0 37.0 38.0 8 37.581 38.0 38.0 38.0 38.0 38.0 9 37.61675 38.0 38.0 38.0 38.0 38.0 10-14 37.5527 38.0 38.0 38.0 38.0 38.0 15-19 37.5446 38.0 38.0 38.0 38.0 38.0 20-24 37.52065 38.0 38.0 38.0 38.0 38.0 25-29 37.4124 38.0 38.0 38.0 37.4 38.0 30-34 37.324 38.0 38.0 38.0 37.0 38.0 35-39 37.189049999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.068349999999995 38.0 38.0 38.0 36.4 38.0 45-49 36.9972 38.0 38.0 38.0 36.0 38.0 50-54 37.058350000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.13965 38.0 38.0 38.0 36.0 38.0 60-64 36.9821 38.0 38.0 38.0 36.0 38.0 65-69 36.7569 38.0 38.0 38.0 35.0 38.0 70-74 36.7213 38.0 38.0 38.0 35.0 38.0 75-79 36.731100000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.616150000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.55929999999999 38.0 38.0 38.0 34.6 38.0 90-94 36.163650000000004 38.0 38.0 38.0 33.6 38.0 95-99 35.88175 38.0 37.2 38.0 32.8 38.0 100-104 35.75075 38.0 37.0 38.0 32.6 38.0 105-109 35.6291 38.0 37.0 38.0 31.2 38.0 110-114 35.37425 38.0 36.2 38.0 30.6 38.0 115-119 35.0304 38.0 35.6 38.0 28.6 38.0 120-124 34.83225 38.0 35.2 38.0 27.6 38.0 125-129 34.362049999999996 38.0 35.0 38.0 25.0 38.0 130-134 33.76995 38.0 33.6 38.0 23.2 38.0 135-139 33.07855000000001 38.0 33.2 38.0 17.4 38.0 140-144 32.511700000000005 38.0 32.8 38.0 13.8 38.0 145-149 31.137349999999998 38.0 30.8 38.0 8.4 38.0 150-151 25.489875 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 4.0 15 5.0 16 3.0 17 7.0 18 7.0 19 14.0 20 3.0 21 11.0 22 8.0 23 15.0 24 13.0 25 18.0 26 25.0 27 27.0 28 41.0 29 48.0 30 46.0 31 69.0 32 79.0 33 132.0 34 172.0 35 315.0 36 862.0 37 2067.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.50864878415643 11.807470543995988 10.879919779393333 37.80396089245425 2 25.45 16.05 30.45 28.050000000000004 3 22.35 20.925 24.2 32.525 4 27.900000000000002 26.724999999999998 20.175 25.2 5 26.875 30.075000000000003 22.55 20.5 6 22.775000000000002 31.6 22.95 22.675 7 17.675 21.85 40.8 19.675 8 20.150000000000002 22.45 28.249999999999996 29.15 9 20.575 21.075 31.175000000000004 27.175 10-14 22.835 25.75 24.805 26.61 15-19 22.89 25.345000000000002 25.545 26.22 20-24 22.314999999999998 25.55 25.679999999999996 26.455000000000002 25-29 23.26 25.174999999999997 25.345000000000002 26.22 30-34 22.66 24.66 25.155 27.525 35-39 22.70408163265306 24.69987995198079 25.725290116046416 26.87074829931973 40-44 23.521458260303472 24.543041714657722 25.38434573589063 26.551154289148183 45-49 23.54265699274456 25.349011758819113 24.838628971728795 26.26970227670753 50-54 23.095 25.105 25.135 26.665 55-59 23.09 24.465 25.14 27.305 60-64 22.88 24.245 25.395 27.48 65-69 22.82 24.845 25.230000000000004 27.105 70-74 23.3 25.419999999999998 24.725 26.555 75-79 23.26732673267327 25.05750575057506 24.352435243524354 27.322732273227324 80-84 23.209641928385675 24.45489097819564 25.41508301660332 26.920384076815363 85-89 22.775000000000002 25.080000000000002 24.865000000000002 27.279999999999998 90-94 23.92696348174087 24.167083541770886 24.957478739369684 26.948474237118557 95-99 23.699769515983565 24.571600360757593 25.07766309249424 26.650967030764605 100-104 23.466173308665432 24.496224811240563 24.91624581229061 27.121356067803394 105-109 23.785 24.875 24.02 27.32 110-114 23.615 24.65 24.515 27.22 115-119 24.14 24.67 24.48 26.71 120-124 24.025 24.46 24.455 27.060000000000002 125-129 24.30900426385754 24.218710810132933 24.865813895159267 26.606471030850265 130-134 24.503678323087776 24.97228660687292 24.36763075682757 26.156404313211727 135-139 24.443212738083243 25.057946185629348 23.929255265544693 26.56958581074272 140-144 23.90954773869347 24.613065326633166 23.71859296482412 27.758793969849243 145-149 23.946215440398852 24.293699954675933 24.439744170821374 27.32034043410384 150-151 23.722627737226276 24.439969796123837 23.97432670526051 27.86307576138938 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 2.0 27 2.5 28 3.0 29 5.5 30 8.5 31 11.5 32 16.0 33 20.5 34 21.5 35 28.5 36 41.5 37 62.0 38 85.0 39 104.5 40 119.5 41 131.5 42 146.5 43 160.5 44 168.0 45 172.5 46 183.5 47 191.0 48 160.5 49 148.5 50 158.5 51 143.0 52 156.0 53 152.5 54 127.5 55 132.0 56 129.5 57 102.0 58 97.5 59 90.5 60 80.0 61 80.0 62 70.0 63 63.0 64 53.5 65 51.0 66 44.5 67 38.0 68 38.0 69 34.5 70 31.0 71 28.0 72 26.0 73 22.0 74 15.5 75 14.0 76 10.5 77 5.0 78 3.0 79 1.5 80 2.0 81 2.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.04 40-44 0.155 45-49 0.075 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.02 85-89 0.0 90-94 0.05 95-99 0.21 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.325 130-134 0.77 135-139 0.77 140-144 0.5 145-149 0.715 150-151 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.59814049586777 94.475 2 1.8078512396694213 3.5000000000000004 3 0.46487603305785125 1.35 4 0.05165289256198347 0.2 5 0.025826446280991736 0.125 6 0.0 0.0 7 0.05165289256198347 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 7 0.17500000000000002 No Hit GGCCAACATAGCCTTCTCCGTCCCCCCTTCGCAGTAACACCAAGTACAGG 7 0.17500000000000002 No Hit CTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.7625000000000002 0.0 0.0 0.0 0.0 104-105 2.1 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.7249999999999996 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.875 0.0 0.0 0.0 0.0 122-123 5.2125 0.0 0.0 0.0 0.0 124-125 5.8 0.0 0.0 0.0 0.0 126-127 6.325 0.0 0.0 0.0 0.0 128-129 6.9875 0.0 0.0 0.0 0.0 130-131 7.449999999999999 0.0 0.0 0.0 0.0 132-133 8.05 0.0 0.0 0.0 0.0 134-135 8.7375 0.0 0.0 0.0 0.0 136-137 9.3 0.0 0.0 0.0 0.0 138-139 10.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7473373 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7473373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39325 33.0 33.0 34.0 32.0 34.0 2 32.55975 34.0 33.0 34.0 32.0 34.0 3 32.6005 34.0 33.0 34.0 32.0 34.0 4 32.53875 34.0 33.0 34.0 32.0 34.0 5 32.56175 34.0 33.0 34.0 32.0 34.0 6 36.525 38.0 38.0 38.0 36.0 38.0 7 36.592 38.0 38.0 38.0 36.0 38.0 8 36.67275 38.0 38.0 38.0 36.0 38.0 9 36.68675 38.0 38.0 38.0 36.0 38.0 10-14 36.725049999999996 38.0 38.0 38.0 36.6 38.0 15-19 36.573949999999996 38.0 38.0 38.0 36.4 38.0 20-24 36.3934 38.0 38.0 38.0 36.0 38.0 25-29 36.439350000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.5314 38.0 38.0 38.0 36.6 38.0 35-39 36.4784 38.0 38.0 38.0 36.6 38.0 40-44 36.52284999999999 38.0 38.0 38.0 36.4 38.0 45-49 36.353750000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.43665 38.0 38.0 38.0 36.0 38.0 55-59 36.4085 38.0 38.0 38.0 36.0 38.0 60-64 36.2832 38.0 38.0 38.0 35.6 38.0 65-69 36.040299999999995 38.0 38.0 38.0 34.6 38.0 70-74 36.148250000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.1025 38.0 38.0 38.0 34.4 38.0 80-84 35.96915 38.0 38.0 38.0 34.0 38.0 85-89 35.89525 38.0 38.0 38.0 34.0 38.0 90-94 35.76234999999999 38.0 38.0 38.0 33.8 38.0 95-99 35.4553 38.0 38.0 38.0 32.8 38.0 100-104 34.922399999999996 38.0 37.8 38.0 29.0 38.0 105-109 34.8421 38.0 37.6 38.0 28.8 38.0 110-114 34.45025 38.0 36.0 38.0 25.6 38.0 115-119 34.2632 38.0 36.0 38.0 23.6 38.0 120-124 34.041599999999995 38.0 35.2 38.0 23.2 38.0 125-129 33.68320000000001 38.0 34.8 38.0 21.4 38.0 130-134 33.25165 38.0 33.0 38.0 15.8 38.0 135-139 32.50019999999999 38.0 33.0 38.0 12.4 38.0 140-144 31.7976 38.0 32.6 38.0 9.2 38.0 145-149 30.47735 38.0 30.4 38.0 2.0 38.0 150-151 24.3395 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 48.0 3 18.0 4 6.0 5 7.0 6 2.0 7 3.0 8 0.0 9 1.0 10 1.0 11 5.0 12 6.0 13 2.0 14 14.0 15 0.0 16 4.0 17 11.0 18 6.0 19 7.0 20 14.0 21 12.0 22 18.0 23 22.0 24 23.0 25 27.0 26 21.0 27 28.0 28 29.0 29 41.0 30 37.0 31 60.0 32 70.0 33 115.0 34 131.0 35 284.0 36 669.0 37 2258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.73157761458597 18.08052671562421 12.889339073183084 29.298556596606733 2 31.224696356275306 22.798582995951417 25.55668016194332 20.42004048582996 3 26.08255254494809 25.424158014687265 24.588503418586985 23.904786021777667 4 27.02429149797571 32.23684210526316 18.775303643724698 21.963562753036435 5 28.148710166919578 32.119372787051084 18.765806777946384 20.966110268082954 6 23.66082762122366 35.82127443513582 18.456461030718458 22.061436912922062 7 22.103929024081115 19.366286438529784 34.06844106463878 24.461343472750315 8 24.82323232323232 21.86868686868687 23.232323232323232 30.075757575757578 9 25.832492431886983 20.81231079717457 25.22704339051463 28.128153380423814 10-14 27.01491033649003 25.2820874471086 22.441063872657665 25.261938343743708 15-19 27.32387227572225 25.30663963507349 23.19817536746072 24.171312721743536 20-24 27.35638027452974 24.580579562785967 23.940010167768175 24.123029994916116 25-29 26.382049850246204 25.40738108533428 23.650946748565918 24.559622315853595 30-34 26.588832487309645 26.15228426395939 22.98984771573604 24.269035532994923 35-39 26.72834485563237 25.264335095567304 23.40890605937373 24.598413989426597 40-44 27.260267018630387 25.1332554952028 23.24483476318595 24.36164272298086 45-49 27.319955179790163 25.028012631150048 23.520423754711214 24.13160843434858 50-54 27.137924030062972 25.10156408693886 23.821856591509242 23.93865529148893 55-59 27.45496066988074 24.587668104541994 24.2476528799797 23.709718345597565 60-64 26.855195564823763 25.319159757896344 24.017089669904887 23.808555007375006 65-69 27.341111452256676 24.961621123733497 23.25759901750077 24.439668406509057 70-74 27.518040451265374 24.890740928956195 23.996341091574347 23.594877528204087 75-79 27.13233426466853 24.7244094488189 23.947167894335788 24.196088392176783 80-84 27.138792928266614 24.939036781142043 23.85693964641333 24.065230644178012 85-89 27.352031242075363 24.369833138915656 24.13653192676371 24.14160369224527 90-94 27.743607990647078 25.05972652874498 23.102729629441367 24.093935851166574 95-99 26.954921803127874 25.646529694367782 23.86793417152203 23.530614330982317 100-104 27.337015433851235 24.972900428431323 23.57404635317194 24.1160377845455 105-109 28.040418621436302 25.08635355982884 23.235551889467445 23.637675929267413 110-114 27.35152984882101 26.175119962850214 23.228935555440895 23.24441463288788 115-119 27.760641579272054 25.493522516964834 23.457742134484885 23.288093769278223 120-124 27.618312757201647 25.72530864197531 23.410493827160494 23.24588477366255 125-129 28.08254425689584 25.051461506792922 23.574516261836145 23.291477974475093 130-134 27.866405928365584 25.77192260189378 22.941539728283246 23.42013174145739 135-139 28.384615384615387 25.117948717948718 23.599999999999998 22.897435897435898 140-144 28.747054605060956 25.898985759655773 22.933101116688864 22.420858518594404 145-149 28.427232464723453 25.97589865073643 23.153774848079102 22.443094036461016 150-151 28.985507246376812 25.56935817805383 23.08488612836439 22.36024844720497 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 18.0 1 12.5 2 7.5 3 6.0 4 4.0 5 3.5 6 2.0 7 1.0 8 1.5 9 2.0 10 1.5 11 1.5 12 2.0 13 1.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.0 20 0.5 21 1.5 22 3.0 23 3.0 24 2.0 25 2.0 26 3.0 27 3.0 28 4.0 29 5.0 30 6.5 31 7.0 32 11.0 33 14.0 34 17.5 35 24.5 36 31.0 37 44.0 38 60.5 39 73.0 40 95.5 41 120.0 42 128.0 43 133.0 44 146.5 45 160.5 46 164.0 47 165.5 48 167.0 49 167.5 50 151.0 51 142.0 52 136.5 53 137.5 54 149.5 55 145.0 56 128.0 57 112.0 58 109.0 59 109.5 60 99.0 61 84.5 62 88.5 63 81.0 64 68.5 65 60.0 66 50.5 67 55.5 68 50.0 69 37.0 70 36.5 71 38.5 72 34.0 73 25.0 74 18.0 75 12.0 76 8.0 77 6.0 78 2.0 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 1.2 3 1.275 4 1.2 5 1.15 6 1.525 7 1.375 8 1.0 9 0.8999999999999999 10-14 0.74 15-19 1.35 20-24 1.6500000000000001 25-29 1.505 30-34 1.5 35-39 1.6400000000000001 40-44 1.505 45-49 1.83 50-54 1.54 55-59 1.4749999999999999 60-64 1.695 65-69 2.29 70-74 1.6099999999999999 75-79 1.575 80-84 1.58 85-89 1.415 90-94 1.635 95-99 2.17 100-104 3.1350000000000002 105-109 3.015 110-114 3.0949999999999998 115-119 2.74 120-124 2.8000000000000003 125-129 2.8400000000000003 130-134 2.8400000000000003 135-139 2.5 140-144 2.39 145-149 2.91 150-151 3.4000000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.525 #Duplication Level Percentage of deduplicated Percentage of total 1 97.64309764309765 94.25 2 1.761201761201761 3.4000000000000004 3 0.33670033670033667 0.975 4 0.1554001554001554 0.6 5 0.0 0.0 6 0.0259000259000259 0.15 7 0.0518000518000518 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0259000259000259 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit GCGACTTATATTCTGTAGCAAGGTTAACCGAATAGGGGAGCCGAAGGGAA 7 0.17500000000000002 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 7 0.17500000000000002 No Hit CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 3.025 0.0 0.0 0.0 0.0 112-113 3.375 0.0 0.0 0.0 0.0 114-115 3.6500000000000004 0.0 0.0 0.0 0.0 116-117 4.050000000000001 0.0 0.0 0.0 0.0 118-119 4.325 0.0 0.0 0.0 0.0 120-121 4.75 0.0 0.0 0.0 0.0 122-123 5.0 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.65 0.0 0.0 0.0 0.0 130-131 7.074999999999999 0.0 0.0 0.0 0.0 132-133 7.65 0.0 0.0 0.0 0.0 134-135 8.3125 0.0 0.0 0.0 0.0 136-137 8.875 0.0 0.0 0.0 0.0 138-139 9.600000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCTTT 10 0.0070022237 143.75641 1 AAAAAAA 40 0.00803781 17.969551 25-29 >>END_MODULE Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753644 spots for SRR7473373.sra Written 753644 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra Read 753629 spots for SRR7473373.sra Written 753629 spots for SRR7473373.sra SRR ids: ['SRR7473373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ahgjt0du SRR7473373.sra spots: 15072595 blocks: [[1, 753629], [753630, 1507258], [1507259, 2260887], [2260888, 3014516], [3014517, 3768145], [3768146, 4521774], [4521775, 5275403], [5275404, 6029032], [6029033, 6782661], [6782662, 7536290], [7536291, 8289919], [8289920, 9043548], [9043549, 9797177], [9797178, 10550806], [10550807, 11304435], [11304436, 12058064], [12058065, 12811693], [12811694, 13565322], [13565323, 14318951], [14318952, 15072595]] SRR7473373 file size 5085907 SRR7473373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7473373 SRR7473373_1.fastq SRR7473373_2.fastq Input file: SRR7473373_1.fastq Paired file: SRR7473373_2.fastq trimmed: SRR7473373-trimmed-pair1.fastq, SRR7473373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:37:26 2024 >> started Sat Dec 7 15:37:43 2024 >> done (17.062s) 15072595 read pairs processed; of these: 37491 ( 0.25%) short read pairs filtered out after trimming by size control 76505 ( 0.51%) empty read pairs filtered out after trimming by size control 14958599 (99.24%) read pairs available; of these: 9232345 (61.72%) trimmed read pairs available after processing 5726254 (38.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 21 0.00% 20 13 0.00% 21 23 0.00% 22 21 0.00% 23 22 0.00% 24 24 0.00% 25 25 0.00% 26 18 0.00% 27 26 0.00% 28 33 0.00% 29 35 0.00% 30 28 0.00% 31 41 0.00% 32 45 0.00% 33 40 0.00% 34 51 0.00% 35 52 0.00% 36 48 0.00% 37 51 0.00% 38 57 0.00% 39 69 0.00% 40 82 0.00% 41 93 0.00% 42 105 0.00% 43 107 0.00% 44 110 0.00% 45 167 0.00% 46 141 0.00% 47 148 0.00% 48 186 0.00% 49 224 0.00% 50 264 0.00% 51 353 0.00% 52 363 0.00% 53 365 0.00% 54 349 0.00% 55 386 0.00% 56 380 0.00% 57 449 0.00% 58 538 0.00% 59 566 0.00% 60 584 0.00% 61 622 0.00% 62 776 0.01% 63 955 0.01% 64 1105 0.01% 65 1428 0.01% 66 1902 0.01% 67 3561 0.02% 68 5104 0.03% 69 8780 0.06% 70 8269 0.06% 71 4445 0.03% 72 3271 0.02% 73 3152 0.02% 74 3078 0.02% 75 3079 0.02% 76 3280 0.02% 77 3585 0.02% 78 4036 0.03% 79 4441 0.03% 80 4987 0.03% 81 5401 0.04% 82 6048 0.04% 83 7226 0.05% 84 8945 0.06% 85 9706 0.06% 86 10419 0.07% 87 11243 0.08% 88 11958 0.08% 89 12675 0.08% 90 13218 0.09% 91 14351 0.10% 92 14572 0.10% 93 16886 0.11% 94 17507 0.12% 95 19563 0.13% 96 19764 0.13% 97 20326 0.14% 98 20412 0.14% 99 21494 0.14% 100 23310 0.16% 101 22766 0.15% 102 24051 0.16% 103 25089 0.17% 104 26881 0.18% 105 29413 0.20% 106 29688 0.20% 107 29581 0.20% 108 31543 0.21% 109 34488 0.23% 110 35425 0.24% 111 33307 0.22% 112 34365 0.23% 113 38451 0.26% 114 37533 0.25% 115 39698 0.27% 116 41461 0.28% 117 40940 0.27% 118 42276 0.28% 119 43720 0.29% 120 45591 0.30% 121 46044 0.31% 122 48259 0.32% 123 49469 0.33% 124 52231 0.35% 125 52816 0.35% 126 54615 0.37% 127 56481 0.38% 128 57800 0.39% 129 60021 0.40% 130 62953 0.42% 131 64551 0.43% 132 66918 0.45% 133 70809 0.47% 134 75500 0.50% 135 78983 0.53% 136 83083 0.56% 137 89708 0.60% 138 94689 0.63% 139 99994 0.67% 140 107343 0.72% 141 119339 0.80% 142 130817 0.87% 143 146986 0.98% 144 167002 1.12% 145 200320 1.34% 146 250053 1.67% 147 340392 2.28% 148 520064 3.48% 149 997123 6.67% 150 3940123 26.34% 151 5726254 38.28% 14958599 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=35 prefix-density=0.42 prefix-fanout=2.0 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=59.61 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.5 sequence=CACATACACACCGCGTCTATGCGCTTTCATCAAAACGAGCGTACACAGACCGTACGTACACATACAAACGGCAGACATACAAACACGACACTCTCCAGTACACGTGGCGTCACCTGGGACATCTTATTTTGTTCATCTTATTATGGAGTATTCAACAGCAGCTGAAGGCCGGCCGGCCGGAGCTTGCTAGCTAGCTACCAGCTCAGTGCTGGCCAGGCAGCTTCTCCTTGATCTT criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=25 prefix-density=1.05 prefix-fanout=2.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.20 sequence-density-rank=10 fanout-score=58.95 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=17.6 sequence=CAAGAAGAAGGT SRR7473373 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:38:31 Started mapping on | Dec 07 15:38:31 Finished on | Dec 07 15:43:58 Mapping speed, Million of reads per hour | 164.68 Number of input reads | 14958599 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12719769 Uniquely mapped reads % | 85.03% Average mapped length | 291.26 Number of splices: Total | 12965102 Number of splices: Annotated (sjdb) | 12235377 Number of splices: GT/AG | 12790668 Number of splices: GC/AG | 157025 Number of splices: AT/AC | 5473 Number of splices: Non-canonical | 11936 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.01% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 178023 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 39569 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.28% % of reads unmapped: other | 2.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2074453 2074453 2074453 N_multimapping 178023 178023 178023 N_noFeature 392960 12254673 566697 N_ambiguous 328974 1481 38090 UnstrandedReadsAssigned:11997835 PositiveStrandReadsAssigned:463615 NegativeStrandReadsAssigned:12114982 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7473373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7473373-trimmed-pair1.fastq SRR7473373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,958,599 reads, 12,206,351 reads pseudoaligned [quant] estimated average fragment length: 257.03 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR7473373.ke.tsv 35125 SRR7473373.se.tsv 88098 total ==> SRR7473373.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.582 33.921 5.14905 PNS24247 1044 787.97 20.5301 2.69166 PNS24249 1928 1671.97 59.6811 3.68762 PNS24246 1044 787.97 20.5301 2.69166 PNS24248 1044 787.97 20.5301 2.69166 PNS24244 1471 1214.97 102.808 8.74174 PNS24243 293 96.7493 0 0 KQK14069 1603 1346.97 1024.46 78.5736 KQK14071 474 237.831 27.6232 11.999 ==> SRR7473373.se.tsv <== BRADI_1g14170v3 1125 BRADI_1g53295v3 21 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 437 BRADI_1g74790v3 284 BRADI_1g09890v3 5 BRADI_1g77505v3 125 BRADI_1g48960v3 0 SRR7473373 completed mapping pipeline successfully