Starting /dee2/code/volunteer_pipeline.sh SRR7692606 current disk space = 1524254392320 free memory = 1605624156 SRR7692606 SRAfilesize d20400ce830b7b6c88f44ae404411cbb SRR7692606.sra SRR7692606.sra file validated SRR7692606 is paired end SRR7692606 is conventional basespace SRR7692606 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692606_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.2715 32.0 25.0 33.0 18.0 33.0 2 28.34025 29.0 27.0 31.0 18.0 33.0 3 30.86325 33.0 30.0 33.0 27.0 33.0 4 32.17925 33.0 33.0 33.0 30.0 33.0 5 32.413 33.0 33.0 33.0 32.0 34.0 6 36.36925 38.0 37.0 38.0 33.0 38.0 7 36.57425 38.0 37.0 38.0 34.0 38.0 8 36.674 38.0 38.0 38.0 34.0 38.0 9 37.07475 38.0 38.0 38.0 36.0 38.0 10-11 37.2995 38.0 38.0 38.0 36.5 38.0 12-13 37.403375 38.0 38.0 38.0 37.0 38.0 14-15 37.383250000000004 38.0 38.0 38.0 37.0 38.0 16-17 37.393125 38.0 38.0 38.0 37.0 38.0 18-19 37.410375 38.0 38.0 38.0 37.0 38.0 20-21 37.395125 38.0 38.0 38.0 37.0 38.0 22-23 37.446625 38.0 38.0 38.0 37.5 38.0 24-25 37.483875 38.0 38.0 38.0 37.0 38.0 26-27 37.430375 38.0 38.0 38.0 37.0 38.0 28-29 37.476875 38.0 38.0 38.0 37.0 38.0 30-31 37.496125 38.0 38.0 38.0 37.0 38.0 32-33 37.4875 38.0 38.0 38.0 37.5 38.0 34-35 37.263374999999996 38.0 38.0 38.0 37.0 38.0 36-37 37.443749999999994 38.0 38.0 38.0 37.0 38.0 38-39 37.39725 38.0 38.0 38.0 37.0 38.0 40-41 37.386625 38.0 38.0 38.0 37.0 38.0 42-43 37.27075 38.0 38.0 38.0 37.0 38.0 44-45 37.432 38.0 38.0 38.0 37.0 38.0 46-47 37.369875 38.0 38.0 38.0 37.0 38.0 48-49 37.274125 38.0 38.0 38.0 37.0 38.0 50-51 37.39275 38.0 38.0 38.0 37.0 38.0 52-53 37.349375 38.0 38.0 38.0 37.0 38.0 54-55 37.393125 38.0 38.0 38.0 37.0 38.0 56-57 37.347125000000005 38.0 38.0 38.0 37.0 38.0 58-59 37.334375 38.0 38.0 38.0 37.0 38.0 60-61 37.335499999999996 38.0 38.0 38.0 37.0 38.0 62-63 37.309 38.0 38.0 38.0 37.0 38.0 64-65 37.318 38.0 38.0 38.0 37.0 38.0 66-67 37.267250000000004 38.0 38.0 38.0 37.0 38.0 68-69 37.327625 38.0 38.0 38.0 37.0 38.0 70-71 37.293499999999995 38.0 38.0 38.0 36.0 38.0 72-73 37.32025 38.0 38.0 38.0 37.0 38.0 74-75 37.204125000000005 38.0 38.0 38.0 36.0 38.0 76-77 37.181875 38.0 38.0 38.0 36.0 38.0 78-79 37.23025 38.0 38.0 38.0 36.0 38.0 80-81 37.165125 38.0 38.0 38.0 36.0 38.0 82-83 37.113125 38.0 38.0 38.0 36.0 38.0 84-85 37.150499999999994 38.0 38.0 38.0 36.0 38.0 86-87 37.11625 38.0 38.0 38.0 36.0 38.0 88-89 37.1315 38.0 38.0 38.0 36.0 38.0 90-91 37.04225 38.0 38.0 38.0 36.0 38.0 92-93 36.999125 38.0 38.0 38.0 35.5 38.0 94-95 36.91475 38.0 38.0 38.0 35.0 38.0 96-97 36.99525 38.0 38.0 38.0 35.5 38.0 98-99 36.81425 38.0 38.0 38.0 35.0 38.0 100-101 36.812 38.0 38.0 38.0 35.0 38.0 102-103 36.75075 38.0 38.0 38.0 34.5 38.0 104-105 36.716375 38.0 38.0 38.0 34.5 38.0 106-107 36.540875 38.0 38.0 38.0 34.0 38.0 108-109 36.459125 38.0 38.0 38.0 34.0 38.0 110-111 36.458 38.0 38.0 38.0 34.0 38.0 112-113 36.609624999999994 38.0 38.0 38.0 34.0 38.0 114-115 36.455875000000006 38.0 38.0 38.0 34.0 38.0 116-117 36.420500000000004 38.0 38.0 38.0 34.0 38.0 118-119 36.288125 38.0 37.0 38.0 33.5 38.0 120-121 36.403 38.0 38.0 38.0 34.0 38.0 122-123 36.194125 38.0 37.0 38.0 33.0 38.0 124-125 36.253125 38.0 37.0 38.0 34.0 38.0 126 31.8265 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 3.0 25 3.0 26 6.0 27 8.0 28 16.0 29 14.0 30 35.0 31 34.0 32 52.0 33 81.0 34 115.0 35 186.0 36 612.0 37 2831.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.21471774193548 10.105846774193548 8.11491935483871 45.564516129032256 2 21.25 14.2 37.95 26.6 3 22.375 17.299999999999997 23.75 36.575 4 26.424999999999997 25.825 22.175 25.575 5 24.9 30.099999999999998 24.3 20.7 6 22.25 31.474999999999998 25.124999999999996 21.15 7 18.3 23.474999999999998 37.55 20.674999999999997 8 20.375 22.8 31.225 25.6 9 20.3 22.225 32.300000000000004 25.174999999999997 10-11 24.125 29.775000000000002 23.1375 22.9625 12-13 23.525 23.1125 27.125 26.237500000000004 14-15 22.8375 25.55 26.187500000000004 25.424999999999997 16-17 22.8125 25.174999999999997 26.5375 25.474999999999998 18-19 24.6 25.2125 24.7375 25.45 20-21 24.0625 25.337500000000002 26.275 24.325 22-23 23.2375 26.487500000000004 25.374999999999996 24.9 24-25 22.4625 25.9875 25.275 26.275 26-27 23.24040505063133 25.62820352544068 26.02825353169146 25.103137892236532 28-29 23.425 24.9375 25.9875 25.650000000000002 30-31 23.65 25.724999999999998 25.05 25.575 32-33 24.55 24.5375 26.35 24.5625 34-35 23.11551486266148 25.77448890003763 25.887369873322463 25.222626363978428 36-37 22.75 25.5625 26.025 25.662499999999998 38-39 24.333124608641203 24.53350031308704 25.860989355040704 25.272385723231057 40-41 23.724999999999998 25.4 25.7125 25.162499999999998 42-43 23.674999999999997 24.8125 25.724999999999998 25.7875 44-45 22.9625 26.05 25.1875 25.8 46-47 23.583843941478055 24.39664874327873 26.147305239464803 25.872202075778418 48-49 23.584669338677354 25.225450901803608 26.127254509018037 25.062625250501004 50-51 23.135635635635634 24.8998998998999 26.25125125125125 25.713213213213216 52-53 23.7987987987988 24.96246246246246 25.400400400400404 25.83833833833834 54-55 23.395471037157513 25.347178781433755 25.234580257725508 26.022769923683224 56-57 23.680920230057513 25.568892223055762 24.943735933983497 25.806451612903224 58-59 23.251157552246276 26.066825178325615 25.140783381303965 25.541233888124136 60-61 23.9375 23.8375 25.924999999999997 26.3 62-63 23.08654327163582 25.76288144072036 26.063031515757878 25.087543771885944 64-65 24.59344508381286 25.94445834375782 23.792844633475106 25.66925193895422 66-67 23.636136136136134 24.91241241241241 26.313813813813812 25.13763763763764 68-69 23.471301738151805 25.159434788045516 24.98436913842691 26.384894335375762 70-71 23.267450587940957 25.494120590442833 25.93194896172129 25.30647985989492 72-73 23.7375 24.725 25.724999999999998 25.8125 74-75 23.625 24.65 25.9875 25.7375 76-77 23.9375 24.887500000000003 25.575 25.6 78-79 23.724999999999998 24.925 25.412499999999998 25.937500000000004 80-81 23.974999999999998 25.7625 25.337500000000002 24.925 82-83 23.3 25.2 25.2375 26.2625 84-85 23.7 25.662499999999998 25.525 25.112499999999997 86-87 24.9 24.8125 25.087500000000002 25.2 88-89 24.5 25.124999999999996 24.6625 25.7125 90-91 24.349999999999998 24.7375 25.15 25.7625 92-93 24.384144054020258 25.24696761285482 25.5220707765412 24.84681755658372 94-95 24.915572232645403 25.07817385866166 24.878048780487806 25.128205128205128 96-97 23.583843941478055 25.459547330248846 25.484556708765787 25.472052019507313 98-99 25.084406652494685 23.983993997749156 25.959734900587723 24.97186444916844 100-101 24.318579644911228 25.431357839459867 25.23130782695674 25.018754688672168 102-103 24.4 25.112499999999997 24.7375 25.75 104-105 23.962500000000002 25.2 25.374999999999996 25.4625 106-107 24.85 25.1 24.762500000000003 25.2875 108-109 23.9875 25.650000000000002 24.75 25.6125 110-111 24.7875 25.3125 24.925 24.975 112-113 24.337500000000002 25.825 24.887500000000003 24.95 114-115 24.9 24.625 25.137500000000003 25.337500000000002 116-117 25.387500000000003 24.837500000000002 24.975 24.8 118-119 24.887500000000003 27.025 23.45 24.637500000000003 120-121 24.775 25.324999999999996 24.6 25.3 122-123 25.424999999999997 25.137500000000003 24.5375 24.9 124-125 25.3 26.237500000000004 24.212500000000002 24.25 126 25.474999999999998 26.05 23.3 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 3.5 29 6.5 30 9.5 31 10.0 32 21.0 33 33.5 34 37.0 35 41.5 36 55.0 37 77.5 38 99.5 39 119.5 40 140.5 41 150.0 42 164.0 43 185.0 44 188.0 45 187.5 46 192.5 47 202.5 48 186.5 49 157.0 50 144.0 51 138.0 52 128.0 53 106.0 54 93.0 55 86.0 56 78.5 57 79.0 58 72.0 59 72.0 60 73.0 61 64.5 62 59.5 63 50.5 64 49.0 65 57.0 66 57.5 67 51.0 68 47.0 69 45.0 70 38.0 71 30.0 72 26.5 73 20.0 74 16.5 75 12.5 76 6.0 77 6.0 78 6.0 79 6.0 80 6.0 81 2.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.3375 36-37 0.0 38-39 0.1875 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.2 50-51 0.1 52-53 0.1 54-55 0.08750000000000001 56-57 0.025 58-59 0.11249999999999999 60-61 0.0 62-63 0.05 64-65 0.075 66-67 0.1 68-69 0.0375 70-71 0.075 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0375 94-95 0.0625 96-97 0.0375 98-99 0.0375 100-101 0.025 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGGGC 15 0.0039514517 60.000004 88-89 >>END_MODULE SRR7692606 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692606_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82225 33.0 33.0 34.0 32.0 34.0 2 32.866 33.0 33.0 34.0 32.0 34.0 3 32.815 33.0 33.0 34.0 32.0 34.0 4 32.80275 33.0 33.0 34.0 32.0 34.0 5 32.77625 33.0 33.0 34.0 32.0 34.0 6 36.865 38.0 38.0 38.0 36.0 38.0 7 36.8355 38.0 38.0 38.0 36.0 38.0 8 36.95075 38.0 38.0 38.0 36.0 38.0 9 36.805 38.0 38.0 38.0 35.0 38.0 10-11 36.954 38.0 38.0 38.0 36.0 38.0 12-13 36.981750000000005 38.0 38.0 38.0 36.0 38.0 14-15 36.721999999999994 38.0 38.0 38.0 35.0 38.0 16-17 36.952375 38.0 38.0 38.0 36.0 38.0 18-19 36.906875 38.0 38.0 38.0 35.5 38.0 20-21 36.984125 38.0 38.0 38.0 36.0 38.0 22-23 36.934 38.0 38.0 38.0 36.0 38.0 24-25 36.9755 38.0 38.0 38.0 36.0 38.0 26-27 36.93075 38.0 38.0 38.0 36.0 38.0 28-29 37.001000000000005 38.0 38.0 38.0 36.0 38.0 30-31 37.081875 38.0 38.0 38.0 36.0 38.0 32-33 37.0835 38.0 38.0 38.0 36.5 38.0 34-35 37.11175 38.0 38.0 38.0 36.5 38.0 36-37 37.07775 38.0 38.0 38.0 36.5 38.0 38-39 37.087125 38.0 38.0 38.0 36.5 38.0 40-41 37.050124999999994 38.0 38.0 38.0 36.5 38.0 42-43 37.0275 38.0 38.0 38.0 36.0 38.0 44-45 36.994249999999994 38.0 38.0 38.0 36.0 38.0 46-47 36.97525 38.0 38.0 38.0 36.5 38.0 48-49 36.966875 38.0 38.0 38.0 36.0 38.0 50-51 37.009125 38.0 38.0 38.0 36.5 38.0 52-53 37.032875000000004 38.0 38.0 38.0 36.0 38.0 54-55 36.989999999999995 38.0 38.0 38.0 36.0 38.0 56-57 37.0015 38.0 38.0 38.0 36.0 38.0 58-59 37.064 38.0 38.0 38.0 36.0 38.0 60-61 37.00775 38.0 38.0 38.0 36.0 38.0 62-63 36.990750000000006 38.0 38.0 38.0 36.0 38.0 64-65 37.0 38.0 38.0 38.0 36.0 38.0 66-67 36.961375000000004 38.0 38.0 38.0 36.0 38.0 68-69 36.9265 38.0 38.0 38.0 36.0 38.0 70-71 36.857375 38.0 38.0 38.0 36.0 38.0 72-73 36.972625 38.0 38.0 38.0 36.0 38.0 74-75 36.89275 38.0 38.0 38.0 36.0 38.0 76-77 36.843999999999994 38.0 38.0 38.0 35.5 38.0 78-79 36.808125000000004 38.0 38.0 38.0 35.0 38.0 80-81 36.78874999999999 38.0 38.0 38.0 35.0 38.0 82-83 36.800375 38.0 38.0 38.0 35.0 38.0 84-85 36.7055 38.0 38.0 38.0 35.0 38.0 86-87 36.743750000000006 38.0 38.0 38.0 35.0 38.0 88-89 36.7465 38.0 38.0 38.0 35.0 38.0 90-91 36.615375 38.0 38.0 38.0 34.5 38.0 92-93 36.620625000000004 38.0 38.0 38.0 35.0 38.0 94-95 36.694 38.0 38.0 38.0 35.0 38.0 96-97 36.617374999999996 38.0 38.0 38.0 35.0 38.0 98-99 36.51775 38.0 38.0 38.0 34.0 38.0 100-101 36.45425 38.0 38.0 38.0 34.0 38.0 102-103 36.47025 38.0 38.0 38.0 34.0 38.0 104-105 36.413875000000004 38.0 38.0 38.0 34.0 38.0 106-107 36.290000000000006 38.0 38.0 38.0 34.0 38.0 108-109 36.156 38.0 38.0 38.0 33.5 38.0 110-111 36.231750000000005 38.0 38.0 38.0 34.0 38.0 112-113 36.122749999999996 38.0 38.0 38.0 33.0 38.0 114-115 36.04600000000001 38.0 37.0 38.0 33.0 38.0 116-117 35.822625 38.0 37.0 38.0 31.5 38.0 118-119 36.013 38.0 37.0 38.0 32.5 38.0 120-121 35.94125 38.0 37.5 38.0 31.0 38.0 122-123 35.558625 38.0 36.0 38.0 30.0 38.0 124-125 35.2225 38.0 35.5 38.0 29.5 38.0 126 30.4215 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 9.0 18 8.0 19 12.0 20 9.0 21 10.0 22 5.0 23 8.0 24 6.0 25 13.0 26 13.0 27 14.0 28 23.0 29 26.0 30 33.0 31 43.0 32 50.0 33 76.0 34 107.0 35 173.0 36 417.0 37 2942.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.975 16.900000000000002 12.35 35.775 2 27.1 25.624999999999996 29.725 17.549999999999997 3 22.675 25.7 27.224999999999998 24.4 4 25.775 31.55 20.65 22.025 5 25.650000000000002 32.175 20.974999999999998 21.2 6 23.05 34.699999999999996 20.474999999999998 21.775 7 22.025 19.650000000000002 34.675 23.65 8 23.325000000000003 22.05 26.125 28.499999999999996 9 22.825 22.05 28.325 26.8 10-11 26.7125 27.775 21.4 24.1125 12-13 26.275 22.7125 25.525 25.4875 14-15 25.162499999999998 25.15 25.25 24.4375 16-17 26.4125 25.224999999999998 23.9125 24.45 18-19 25.324999999999996 25.362499999999997 24.887500000000003 24.425 20-21 24.837500000000002 25.662499999999998 24.474999999999998 25.025 22-23 26.075 25.362499999999997 24.675 23.8875 24-25 24.9375 25.1 25.25 24.712500000000002 26-27 24.9125 25.75 24.65 24.6875 28-29 25.275 25.25 25.5375 23.9375 30-31 24.8625 25.112499999999997 25.4 24.625 32-33 25.174999999999997 25.825 24.962500000000002 24.0375 34-35 26.3 25.112499999999997 23.4125 25.174999999999997 36-37 25.7375 24.2875 25.224999999999998 24.75 38-39 24.85 24.8 25.1875 25.162499999999998 40-41 25.474999999999998 25.887500000000003 24.337500000000002 24.3 42-43 24.8125 25.45 26.0125 23.724999999999998 44-45 25.0 25.074999999999996 24.4375 25.4875 46-47 25.6125 26.0375 24.4375 23.9125 48-49 25.8 24.45 25.337500000000002 24.4125 50-51 24.4375 25.775 25.874999999999996 23.9125 52-53 26.0125 24.6875 25.3 24.0 54-55 25.0625 25.224999999999998 24.9875 24.725 56-57 25.2125 25.912499999999998 24.4125 24.462500000000002 58-59 26.1625 24.1625 25.0125 24.6625 60-61 24.837500000000002 25.474999999999998 24.9 24.7875 62-63 26.05 24.85 25.224999999999998 23.875 64-65 25.687500000000004 25.2625 25.374999999999996 23.674999999999997 66-67 24.5625 24.8125 25.7875 24.837500000000002 68-69 25.074999999999996 25.087500000000002 26.424999999999997 23.4125 70-71 25.324999999999996 24.75 25.7125 24.212500000000002 72-73 25.6125 25.087500000000002 25.9625 23.3375 74-75 24.525 26.337500000000002 25.324999999999996 23.8125 76-77 26.1625 26.1625 24.675 23.0 78-79 25.8125 25.25 25.35 23.5875 80-81 25.137500000000003 26.187500000000004 24.925 23.75 82-83 25.587500000000002 25.074999999999996 25.324999999999996 24.0125 84-85 24.8 25.85 25.337500000000002 24.0125 86-87 24.9125 25.887500000000003 26.0625 23.1375 88-89 26.200000000000003 24.9 24.337500000000002 24.5625 90-91 25.9625 25.2375 24.8125 23.9875 92-93 25.0375 25.5625 25.55 23.849999999999998 94-95 26.1125 25.337500000000002 24.7875 23.7625 96-97 25.2625 25.8 25.087500000000002 23.849999999999998 98-99 25.974999999999998 25.7625 25.374999999999996 22.8875 100-101 25.900000000000002 25.887500000000003 25.0 23.2125 102-103 25.724999999999998 25.687500000000004 25.374999999999996 23.2125 104-105 25.637500000000003 25.55 24.837500000000002 23.974999999999998 106-107 25.374999999999996 26.1625 25.35 23.1125 108-109 25.837500000000002 26.0125 25.25 22.900000000000002 110-111 25.7625 26.375 24.474999999999998 23.3875 112-113 26.625 25.924999999999997 24.637500000000003 22.8125 114-115 26.275 25.650000000000002 25.4 22.675 116-117 26.887499999999996 26.275 24.4125 22.425 118-119 27.5875 25.5375 23.9 22.975 120-121 26.4125 26.150000000000002 24.325 23.1125 122-123 26.82347053671963 27.161266107844362 23.533091455023143 22.48217190041286 124-125 26.9125 27.025 23.425 22.6375 126 27.525 25.924999999999997 24.575 21.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 1.5 24 2.0 25 1.0 26 1.0 27 4.0 28 5.0 29 5.0 30 11.5 31 16.0 32 19.5 33 21.0 34 28.5 35 44.5 36 58.0 37 67.0 38 89.0 39 114.0 40 132.0 41 154.0 42 163.5 43 178.5 44 176.0 45 178.5 46 186.5 47 174.5 48 168.5 49 172.0 50 162.5 51 135.0 52 123.0 53 107.5 54 97.0 55 94.5 56 84.5 57 76.0 58 77.0 59 79.5 60 74.5 61 69.5 62 69.5 63 64.5 64 54.5 65 57.0 66 60.5 67 52.0 68 50.0 69 40.5 70 34.5 71 37.5 72 31.0 73 29.0 74 20.0 75 10.5 76 8.5 77 5.0 78 5.0 79 5.5 80 4.0 81 2.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.08750000000000001 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114 3.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655283 spots for SRR7692606.sra Written 655283 spots for SRR7692606.sra Read 655288 spots for SRR7692606.sra Written 655288 spots for SRR7692606.sra SRR ids: ['SRR7692606.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rkocr66d SRR7692606.sra spots: 13105665 blocks: [[1, 655283], [655284, 1310566], [1310567, 1965849], [1965850, 2621132], [2621133, 3276415], [3276416, 3931698], [3931699, 4586981], [4586982, 5242264], [5242265, 5897547], [5897548, 6552830], [6552831, 7208113], [7208114, 7863396], [7863397, 8518679], [8518680, 9173962], [9173963, 9829245], [9829246, 10484528], [10484529, 11139811], [11139812, 11795094], [11795095, 12450377], [12450378, 13105665]] SRR7692606 file size 4180504 SRR7692606 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692606 SRR7692606_1.fastq SRR7692606_2.fastq Input file: SRR7692606_1.fastq Paired file: SRR7692606_2.fastq trimmed: SRR7692606-trimmed-pair1.fastq, SRR7692606-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 14:41:05 2024 >> started Mon Dec 9 14:41:25 2024 >> done (20.139s) 13105665 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 47 ( 0.00%) empty read pairs filtered out after trimming by size control 13105615 (100.00%) read pairs available; of these: 1354851 (10.34%) trimmed read pairs available after processing 11750764 (89.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 5 0.00% 36 2 0.00% 37 3 0.00% 38 3 0.00% 39 3 0.00% 40 6 0.00% 41 4 0.00% 42 6 0.00% 43 7 0.00% 44 3 0.00% 45 3 0.00% 46 4 0.00% 47 8 0.00% 48 5 0.00% 49 11 0.00% 50 7 0.00% 51 20 0.00% 52 21 0.00% 53 21 0.00% 54 19 0.00% 55 23 0.00% 56 19 0.00% 57 27 0.00% 58 30 0.00% 59 43 0.00% 60 46 0.00% 61 58 0.00% 62 51 0.00% 63 65 0.00% 64 72 0.00% 65 95 0.00% 66 111 0.00% 67 113 0.00% 68 168 0.00% 69 157 0.00% 70 194 0.00% 71 148 0.00% 72 169 0.00% 73 180 0.00% 74 222 0.00% 75 241 0.00% 76 312 0.00% 77 358 0.00% 78 354 0.00% 79 411 0.00% 80 483 0.00% 81 578 0.00% 82 692 0.01% 83 841 0.01% 84 929 0.01% 85 1080 0.01% 86 1240 0.01% 87 1374 0.01% 88 1731 0.01% 89 1977 0.02% 90 2290 0.02% 91 2787 0.02% 92 3112 0.02% 93 3800 0.03% 94 4434 0.03% 95 5211 0.04% 96 6160 0.05% 97 7351 0.06% 98 8087 0.06% 99 9636 0.07% 100 11149 0.09% 101 12704 0.10% 102 14931 0.11% 103 17005 0.13% 104 19406 0.15% 105 21713 0.17% 106 24371 0.19% 107 27216 0.21% 108 30319 0.23% 109 33644 0.26% 110 37181 0.28% 111 39994 0.31% 112 44324 0.34% 113 48247 0.37% 114 52794 0.40% 115 56936 0.43% 116 60860 0.46% 117 64378 0.49% 118 68747 0.52% 119 71762 0.55% 120 76652 0.58% 121 80715 0.62% 122 84375 0.64% 123 90233 0.69% 124 95624 0.73% 125 101942 0.78% 126 11750764 89.66% 13105615 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=31 prefix-density=0.33 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=175.58 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACCGGAACC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=2.5 sequence=GTCACCGGCAAGGGTCCCCTTGAGAACCTCGCTGACCACCTTGCCGACCCCGTCAACAACAACGCGTGGGCCTTTGCCACCAACTTCGTTCCCGGCAAGTAAGGTGTCAATGAGAGGCACATGTGTATATGCAAATCGACTATGCTCGCGACCAAGTGTGTGTAGCTGGTTTCACTTGTACTACCACGATGATGATGTAAATTAATTACGAGGATCTTATGAACAAAAGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=73.40 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.6 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCA SRR7692606 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 14:44:34 Started mapping on | Dec 09 14:45:38 Finished on | Dec 09 14:46:30 Mapping speed, Million of reads per hour | 907.31 Number of input reads | 13105615 Average input read length | 249 UNIQUE READS: Uniquely mapped reads number | 12664442 Uniquely mapped reads % | 96.63% Average mapped length | 249.27 Number of splices: Total | 10780647 Number of splices: Annotated (sjdb) | 10183341 Number of splices: GT/AG | 10634040 Number of splices: GC/AG | 128234 Number of splices: AT/AC | 4395 Number of splices: Non-canonical | 13978 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 172962 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 11740 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 268214 268214 268214 N_multimapping 172962 172962 172962 N_noFeature 565798 12338805 653240 N_ambiguous 276325 1254 38568 UnstrandedReadsAssigned:11822319 PositiveStrandReadsAssigned:324383 NegativeStrandReadsAssigned:11972634 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692606 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692606-trimmed-pair1.fastq SRR7692606-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,105,615 reads, 12,101,449 reads pseudoaligned [quant] estimated average fragment length: 157.067 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR7692606.ke.tsv 35125 SRR7692606.se.tsv 88098 total ==> SRR7692606.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 780.109 0 0 PNS24247 1044 887.933 47.9745 6.90252 PNS24249 1928 1771.93 67.4273 4.86145 PNS24246 1044 887.933 47.9745 6.90252 PNS24248 1044 887.933 47.9745 6.90252 PNS24244 1471 1314.93 43.6493 4.24083 PNS24243 293 138.622 0 0 KQK14069 1603 1446.93 8595.11 758.893 KQK14071 474 319.18 437.409 175.077 ==> SRR7692606.se.tsv <== BRADI_1g14170v3 9908 BRADI_1g53295v3 101 BRADI_1g59795v3 570 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 54 BRADI_1g74790v3 68 BRADI_1g09890v3 0 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR7692606 completed mapping pipeline successfully