Starting /dee2/code/volunteer_pipeline.sh SRR7692617 current disk space = 1524315246592 free memory = 1349857332 SRR7692617 SRAfilesize b6f701469de559c230f813aee7fabcfd SRR7692617.sra SRR7692617.sra file validated SRR7692617 is paired end SRR7692617 is conventional basespace SRR7692617 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692617_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.233 30.0 18.0 32.0 18.0 33.0 2 29.20275 31.0 28.0 33.0 18.0 33.0 3 31.12275 33.0 31.0 33.0 28.0 33.0 4 32.301 33.0 33.0 33.0 31.0 33.0 5 32.8425 33.0 33.0 34.0 32.0 34.0 6 36.40225 38.0 37.0 38.0 34.0 38.0 7 36.8395 38.0 37.0 38.0 34.0 38.0 8 37.1995 38.0 38.0 38.0 36.0 38.0 9 37.32225 38.0 38.0 38.0 37.0 38.0 10-11 37.435249999999996 38.0 38.0 38.0 37.0 38.0 12-13 37.521375 38.0 38.0 38.0 37.0 38.0 14-15 37.454125000000005 38.0 38.0 38.0 37.0 38.0 16-17 37.486000000000004 38.0 38.0 38.0 37.0 38.0 18-19 37.429249999999996 38.0 38.0 38.0 37.0 38.0 20-21 37.371875 38.0 38.0 38.0 37.0 38.0 22-23 37.424875 38.0 38.0 38.0 37.0 38.0 24-25 37.518375 38.0 38.0 38.0 37.0 38.0 26-27 37.437 38.0 38.0 38.0 37.0 38.0 28-29 37.462375 38.0 38.0 38.0 37.0 38.0 30-31 37.481125 38.0 38.0 38.0 37.0 38.0 32-33 37.4865 38.0 38.0 38.0 37.0 38.0 34-35 37.297375 38.0 38.0 38.0 37.0 38.0 36-37 37.38725 38.0 38.0 38.0 37.0 38.0 38-39 37.337375 38.0 38.0 38.0 37.0 38.0 40-41 37.342749999999995 38.0 38.0 38.0 37.0 38.0 42-43 37.32599999999999 38.0 38.0 38.0 37.0 38.0 44-45 37.362 38.0 38.0 38.0 37.0 38.0 46-47 37.321625 38.0 38.0 38.0 37.0 38.0 48-49 37.272999999999996 38.0 38.0 38.0 37.0 38.0 50-51 37.336124999999996 38.0 38.0 38.0 37.0 38.0 52-53 37.356625 38.0 38.0 38.0 37.0 38.0 54-55 37.381375 38.0 38.0 38.0 37.0 38.0 56-57 37.345375000000004 38.0 38.0 38.0 37.0 38.0 58-59 37.32225 38.0 38.0 38.0 37.0 38.0 60-61 37.408 38.0 38.0 38.0 37.0 38.0 62-63 37.373999999999995 38.0 38.0 38.0 37.0 38.0 64-65 37.307249999999996 38.0 38.0 38.0 37.0 38.0 66-67 37.282 38.0 38.0 38.0 37.0 38.0 68-69 37.277 38.0 38.0 38.0 37.0 38.0 70-71 37.293875 38.0 38.0 38.0 37.0 38.0 72-73 37.2475 38.0 38.0 38.0 36.5 38.0 74-75 37.19225 38.0 38.0 38.0 36.5 38.0 76-77 37.227625 38.0 38.0 38.0 36.0 38.0 78-79 37.1995 38.0 38.0 38.0 36.0 38.0 80-81 37.183875 38.0 38.0 38.0 36.0 38.0 82-83 37.16675 38.0 38.0 38.0 36.0 38.0 84-85 37.135625000000005 38.0 38.0 38.0 36.0 38.0 86-87 37.1055 38.0 38.0 38.0 36.0 38.0 88-89 37.092 38.0 38.0 38.0 36.0 38.0 90-91 37.008250000000004 38.0 38.0 38.0 36.0 38.0 92-93 37.0205 38.0 38.0 38.0 36.0 38.0 94-95 36.896 38.0 38.0 38.0 35.5 38.0 96-97 36.928625 38.0 38.0 38.0 35.0 38.0 98-99 36.841875 38.0 38.0 38.0 35.0 38.0 100-101 36.87675 38.0 38.0 38.0 35.0 38.0 102-103 36.709374999999994 38.0 38.0 38.0 34.5 38.0 104-105 36.650999999999996 38.0 38.0 38.0 34.0 38.0 106-107 36.476625 38.0 38.0 38.0 34.0 38.0 108-109 36.382374999999996 38.0 38.0 38.0 33.5 38.0 110-111 36.478125 38.0 38.0 38.0 34.0 38.0 112-113 36.593875 38.0 38.0 38.0 34.0 38.0 114-115 36.456875 38.0 37.5 38.0 34.0 38.0 116-117 36.50875 38.0 38.0 38.0 34.0 38.0 118-119 36.279375 38.0 37.0 38.0 34.0 38.0 120-121 36.348 38.0 37.5 38.0 33.5 38.0 122-123 36.1795 38.0 37.0 38.0 33.0 38.0 124-125 36.268625 38.0 37.5 38.0 33.5 38.0 126 31.859 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 3.0 24 2.0 25 3.0 26 7.0 27 9.0 28 24.0 29 17.0 30 26.0 31 34.0 32 65.0 33 66.0 34 85.0 35 196.0 36 521.0 37 2937.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.464646464646464 11.767676767676766 10.606060606060606 41.16161616161616 2 22.05 16.1 36.55 25.3 3 21.05 20.225 24.224999999999998 34.5 4 26.0 26.200000000000003 22.95 24.85 5 24.45 31.225 24.175 20.150000000000002 6 21.425 33.550000000000004 24.675 20.349999999999998 7 15.950000000000001 24.95 40.075 19.025 8 18.5 24.9 31.025000000000002 25.575 9 19.125 22.825 32.975 25.074999999999996 10-11 22.525000000000002 31.05 23.8375 22.5875 12-13 21.525 25.900000000000002 27.287499999999998 25.2875 14-15 20.7625 27.462500000000002 27.55 24.224999999999998 16-17 22.037499999999998 26.9625 27.2625 23.7375 18-19 21.9375 26.875 26.974999999999998 24.212500000000002 20-21 21.9625 27.1 26.174999999999997 24.762500000000003 22-23 21.4 27.425 26.674999999999997 24.5 24-25 21.587500000000002 27.212500000000002 26.337500000000002 24.8625 26-27 21.040130016252032 28.253531691461433 25.86573321665208 24.840605075634453 28-29 21.224999999999998 27.3625 26.6125 24.8 30-31 21.9 27.5875 26.7625 23.75 32-33 22.8125 26.825 27.187499999999996 23.175 34-35 21.23416530791421 26.62736736485639 26.928383293615955 25.210084033613445 36-37 22.1 26.487500000000004 26.9125 24.5 38-39 22.632765531062123 26.978957915831664 25.814128256513026 24.574148296593187 40-41 22.3875 27.1625 26.0375 24.4125 42-43 21.875 27.950000000000003 25.575 24.6 44-45 22.162499999999998 28.1 25.587500000000002 24.15 46-47 21.363352095059412 27.592245153220762 26.7667292057536 24.27767354596623 48-49 21.26753507014028 27.55511022044088 26.803607214428858 24.37374749498998 50-51 22.15965965965966 27.715215215215217 25.538038038038035 24.587087087087088 52-53 22.25975975975976 27.177177177177175 25.650650650650654 24.91241241241241 54-55 21.402675334416802 27.590948868608578 25.790723840480062 25.21565195649456 56-57 21.8125 27.150000000000002 26.424999999999997 24.6125 58-59 22.854640980735553 25.806855141356017 25.881911433575183 25.456592444333246 60-61 21.675 25.7875 26.775 25.7625 62-63 22.165270658832352 26.153269158644832 26.003250406300786 25.678209776222026 64-65 22.890361295161895 25.853231653956744 26.8533566695837 24.40305038129766 66-67 22.343085771442862 27.094273568392097 25.84396099024756 24.718679669917478 68-69 23.45 27.0625 25.95 23.5375 70-71 22.175 26.8375 25.624999999999996 25.362499999999997 72-73 22.412499999999998 26.8 25.424999999999997 25.362499999999997 74-75 22.3875 26.1 26.75 24.762500000000003 76-77 21.875 27.0625 26.950000000000003 24.1125 78-79 22.6875 26.674999999999997 26.3 24.337500000000002 80-81 22.625 27.3125 25.55 24.5125 82-83 22.537499999999998 25.974999999999998 26.3625 25.124999999999996 84-85 22.9625 27.1375 25.5625 24.337500000000002 86-87 22.6375 26.900000000000002 26.337500000000002 24.125 88-89 22.1875 27.0625 25.7625 24.9875 90-91 22.775000000000002 27.0125 26.35 23.8625 92-93 22.8375 26.2625 26.075 24.825 94-95 23.3625 26.887499999999996 24.9375 24.8125 96-97 22.525000000000002 26.7625 25.9625 24.75 98-99 21.8625 26.1 26.424999999999997 25.6125 100-101 23.0875 26.8625 26.1125 23.9375 102-103 23.5 26.55 25.9625 23.9875 104-105 23.0375 27.2625 25.0625 24.637500000000003 106-107 23.0 26.737499999999997 25.775 24.4875 108-109 22.575 26.637499999999996 25.75 25.0375 110-111 23.325000000000003 27.0875 24.962500000000002 24.625 112-113 23.724999999999998 26.424999999999997 25.3 24.55 114-115 23.5 26.525 25.137500000000003 24.837500000000002 116-117 23.1875 26.224999999999998 26.174999999999997 24.4125 118-119 23.775 27.474999999999998 24.762500000000003 23.9875 120-121 23.925 27.1 24.0625 24.9125 122-123 23.9 28.225 23.575 24.3 124-125 23.9875 27.8625 24.1125 24.0375 126 23.825 27.775 22.925 25.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 2.0 27 2.5 28 5.5 29 8.5 30 15.5 31 26.5 32 35.5 33 37.0 34 48.5 35 68.5 36 78.5 37 96.5 38 112.0 39 142.5 40 182.5 41 181.5 42 197.0 43 221.5 44 219.0 45 219.5 46 200.5 47 194.5 48 193.0 49 166.0 50 148.0 51 140.5 52 113.5 53 82.5 54 74.5 55 74.5 56 75.0 57 65.0 58 58.5 59 55.5 60 54.5 61 48.0 62 36.0 63 34.5 64 36.5 65 31.0 66 24.0 67 26.0 68 28.0 69 23.0 70 20.5 71 19.5 72 17.0 73 13.5 74 10.0 75 11.0 76 8.0 77 4.0 78 2.5 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.3375 36-37 0.0 38-39 0.2 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0625 48-49 0.2 50-51 0.1 52-53 0.1 54-55 0.0125 56-57 0.0 58-59 0.075 60-61 0.0 62-63 0.0125 64-65 0.0125 66-67 0.025 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.9000000000000004 0.0 0.0 0.0 0.0 108-109 3.875 0.0 0.0 0.0 0.0 110-111 4.775 0.0 0.0 0.0 0.0 112-113 5.9 0.0 0.0 0.0 0.0 114 6.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692617 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692617_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69825 33.0 33.0 34.0 31.0 34.0 2 32.71875 33.0 33.0 34.0 32.0 34.0 3 32.73 33.0 33.0 34.0 31.0 34.0 4 32.67575 33.0 33.0 34.0 31.0 34.0 5 32.691 33.0 33.0 34.0 32.0 34.0 6 36.829 38.0 38.0 38.0 36.0 38.0 7 36.68075 38.0 38.0 38.0 35.0 38.0 8 36.78225 38.0 38.0 38.0 35.0 38.0 9 36.606 38.0 38.0 38.0 34.0 38.0 10-11 36.783875 38.0 38.0 38.0 35.0 38.0 12-13 36.846125 38.0 38.0 38.0 36.0 38.0 14-15 36.600875 38.0 38.0 38.0 34.5 38.0 16-17 36.8335 38.0 38.0 38.0 35.5 38.0 18-19 36.673625 38.0 38.0 38.0 34.5 38.0 20-21 36.77575 38.0 38.0 38.0 35.0 38.0 22-23 36.781875 38.0 38.0 38.0 35.5 38.0 24-25 36.801375 38.0 38.0 38.0 36.0 38.0 26-27 36.7855 38.0 38.0 38.0 36.0 38.0 28-29 36.84375 38.0 38.0 38.0 36.0 38.0 30-31 36.8965 38.0 38.0 38.0 36.0 38.0 32-33 36.8335 38.0 38.0 38.0 36.0 38.0 34-35 36.916624999999996 38.0 38.0 38.0 36.0 38.0 36-37 36.951499999999996 38.0 38.0 38.0 36.0 38.0 38-39 36.93425 38.0 38.0 38.0 36.0 38.0 40-41 36.906125 38.0 38.0 38.0 36.0 38.0 42-43 36.894000000000005 38.0 38.0 38.0 36.0 38.0 44-45 36.92075 38.0 38.0 38.0 36.0 38.0 46-47 36.879125 38.0 38.0 38.0 36.0 38.0 48-49 36.92100000000001 38.0 38.0 38.0 36.0 38.0 50-51 36.88875 38.0 38.0 38.0 36.0 38.0 52-53 36.956374999999994 38.0 38.0 38.0 36.0 38.0 54-55 36.85225 38.0 38.0 38.0 36.0 38.0 56-57 36.84825 38.0 38.0 38.0 36.0 38.0 58-59 36.886875 38.0 38.0 38.0 36.0 38.0 60-61 36.9335 38.0 38.0 38.0 36.0 38.0 62-63 36.76225 38.0 38.0 38.0 35.5 38.0 64-65 36.833625 38.0 38.0 38.0 36.0 38.0 66-67 36.883625 38.0 38.0 38.0 36.0 38.0 68-69 36.711625 38.0 38.0 38.0 35.0 38.0 70-71 36.729875 38.0 38.0 38.0 35.0 38.0 72-73 36.800875000000005 38.0 38.0 38.0 35.5 38.0 74-75 36.693375 38.0 38.0 38.0 35.0 38.0 76-77 36.710375 38.0 38.0 38.0 35.0 38.0 78-79 36.581 38.0 38.0 38.0 34.5 38.0 80-81 36.55275 38.0 38.0 38.0 34.5 38.0 82-83 36.701375 38.0 38.0 38.0 35.0 38.0 84-85 36.5215 38.0 38.0 38.0 34.5 38.0 86-87 36.573875 38.0 38.0 38.0 34.5 38.0 88-89 36.551625 38.0 38.0 38.0 34.5 38.0 90-91 36.40075 38.0 38.0 38.0 34.0 38.0 92-93 36.450625 38.0 38.0 38.0 34.0 38.0 94-95 36.46525 38.0 38.0 38.0 34.0 38.0 96-97 36.4185 38.0 38.0 38.0 34.0 38.0 98-99 36.364125 38.0 38.0 38.0 34.0 38.0 100-101 36.267125 38.0 38.0 38.0 33.5 38.0 102-103 36.241749999999996 38.0 38.0 38.0 33.5 38.0 104-105 36.119125 38.0 38.0 38.0 33.0 38.0 106-107 36.04325 38.0 37.5 38.0 33.0 38.0 108-109 36.00375 38.0 37.0 38.0 32.5 38.0 110-111 35.934875000000005 38.0 37.5 38.0 32.0 38.0 112-113 35.886375 38.0 37.0 38.0 31.0 38.0 114-115 35.824124999999995 38.0 37.0 38.0 31.0 38.0 116-117 35.603375 38.0 36.0 38.0 30.0 38.0 118-119 35.7505 38.0 37.0 38.0 31.0 38.0 120-121 35.6495 38.0 36.5 38.0 31.0 38.0 122-123 35.09625 38.0 35.0 38.0 28.0 38.0 124-125 34.848625 38.0 35.0 38.0 27.0 38.0 126 29.82525 33.0 23.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 12.0 18 15.0 19 17.0 20 10.0 21 6.0 22 9.0 23 7.0 24 7.0 25 12.0 26 19.0 27 17.0 28 29.0 29 25.0 30 42.0 31 47.0 32 60.0 33 72.0 34 132.0 35 170.0 36 499.0 37 2791.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.875 17.25 15.4 32.475 2 28.675 24.875 28.749999999999996 17.7 3 22.375 26.474999999999998 28.4 22.75 4 26.05 30.75 21.475 21.725 5 27.525 32.025 21.5 18.95 6 21.325 33.275 23.674999999999997 21.725 7 22.2 18.5 36.8 22.5 8 22.75 22.825 26.400000000000002 28.025 9 23.25 22.975 29.225 24.55 10-11 25.7875 28.849999999999998 22.475 22.8875 12-13 25.0625 23.6375 26.8625 24.4375 14-15 25.224999999999998 25.587500000000002 27.0 22.1875 16-17 24.725 25.912499999999998 26.2125 23.150000000000002 18-19 25.674999999999997 25.887500000000003 25.337500000000002 23.1 20-21 24.6 26.387500000000003 26.087500000000002 22.925 22-23 24.5125 26.724999999999998 25.137500000000003 23.625 24-25 24.375 25.174999999999997 26.075 24.375 26-27 25.074999999999996 26.325 26.075 22.525000000000002 28-29 24.837500000000002 26.224999999999998 26.625 22.3125 30-31 24.825 26.2875 26.275 22.6125 32-33 25.1 25.374999999999996 27.1375 22.3875 34-35 25.2625 25.924999999999997 25.7375 23.075000000000003 36-37 24.6625 27.175 25.174999999999997 22.9875 38-39 25.0625 26.025 26.987499999999997 21.925 40-41 24.25 26.0 26.1 23.65 42-43 24.875 26.0625 27.237499999999997 21.825 44-45 24.725 27.125 26.174999999999997 21.975 46-47 25.362499999999997 25.8125 25.8625 22.9625 48-49 24.349999999999998 26.137500000000003 26.85 22.662499999999998 50-51 24.4375 25.75 26.8625 22.95 52-53 25.1875 25.35 27.037499999999998 22.425 54-55 23.8125 26.1625 26.650000000000002 23.375 56-57 24.75 27.224999999999998 26.437500000000004 21.587500000000002 58-59 24.712500000000002 26.0125 26.200000000000003 23.075000000000003 60-61 23.9 26.900000000000002 26.6125 22.5875 62-63 24.825 25.900000000000002 26.9625 22.3125 64-65 23.9875 26.9125 26.737499999999997 22.3625 66-67 25.162499999999998 25.9875 26.625 22.225 68-69 25.3125 25.5 26.637499999999996 22.55 70-71 24.712500000000002 25.624999999999996 26.9625 22.7 72-73 25.5625 24.7375 26.35 23.35 74-75 23.849999999999998 26.137500000000003 27.9375 22.075 76-77 24.45 25.624999999999996 27.575 22.35 78-79 24.9 25.8 27.737499999999997 21.5625 80-81 24.5625 26.25 26.2875 22.900000000000002 82-83 24.887500000000003 25.4875 26.937499999999996 22.6875 84-85 24.1375 26.674999999999997 26.5375 22.650000000000002 86-87 24.25 26.8625 27.237499999999997 21.65 88-89 24.8625 25.55 27.025 22.5625 90-91 24.1875 26.275 27.150000000000002 22.3875 92-93 25.112499999999997 27.437499999999996 26.487500000000004 20.962500000000002 94-95 25.3 26.4125 26.5 21.7875 96-97 25.087500000000002 26.224999999999998 27.1 21.587500000000002 98-99 24.8125 25.8625 27.0625 22.2625 100-101 25.5625 25.7375 26.9625 21.7375 102-103 24.3875 26.575 26.875 22.162499999999998 104-105 24.8625 26.4625 27.3375 21.337500000000002 106-107 25.4875 27.025 25.7875 21.7 108-109 25.0 27.35 27.2625 20.3875 110-111 25.124999999999996 27.05 26.674999999999997 21.15 112-113 25.374999999999996 27.125 25.900000000000002 21.6 114-115 24.775 26.8125 26.8375 21.575 116-117 25.912499999999998 26.687499999999996 26.787499999999998 20.6125 118-119 26.4625 26.950000000000003 25.162499999999998 21.425 120-121 26.35 27.187499999999996 25.937500000000004 20.525 122-123 26.778347293411674 27.86598324790599 24.715589448681087 20.64008001000125 124-125 27.675 27.237499999999997 25.7375 19.35 126 27.750000000000004 28.275 23.65 20.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 3.5 23 3.0 24 2.0 25 2.5 26 2.0 27 5.5 28 7.0 29 7.0 30 10.0 31 14.0 32 26.0 33 40.0 34 46.5 35 54.0 36 66.5 37 87.0 38 117.5 39 143.0 40 159.5 41 175.0 42 183.0 43 189.5 44 209.5 45 221.5 46 211.0 47 194.0 48 182.5 49 166.5 50 155.5 51 145.0 52 121.5 53 106.0 54 92.5 55 80.0 56 74.0 57 67.5 58 63.0 59 60.0 60 53.5 61 43.0 62 45.0 63 46.0 64 33.5 65 30.0 66 30.5 67 23.5 68 28.0 69 31.0 70 29.5 71 29.0 72 20.5 73 13.5 74 8.5 75 10.5 76 10.0 77 5.0 78 3.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0125 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.8499999999999996 0.0 0.0 0.0 0.0 108-109 3.8625 0.0 0.0 0.0 0.0 110-111 4.7125 0.0 0.0 0.0 0.0 112-113 5.85 0.0 0.0 0.0 0.0 114 6.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577406 spots for SRR7692617.sra Written 577406 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra Read 577402 spots for SRR7692617.sra Written 577402 spots for SRR7692617.sra SRR ids: ['SRR7692617.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3s5n97yx SRR7692617.sra spots: 11548044 blocks: [[1, 577402], [577403, 1154804], [1154805, 1732206], [1732207, 2309608], [2309609, 2887010], [2887011, 3464412], [3464413, 4041814], [4041815, 4619216], [4619217, 5196618], [5196619, 5774020], [5774021, 6351422], [6351423, 6928824], [6928825, 7506226], [7506227, 8083628], [8083629, 8661030], [8661031, 9238432], [9238433, 9815834], [9815835, 10393236], [10393237, 10970638], [10970639, 11548044]] SRR7692617 file size 3682343 SRR7692617 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692617 SRR7692617_1.fastq SRR7692617_2.fastq Input file: SRR7692617_1.fastq Paired file: SRR7692617_2.fastq trimmed: SRR7692617-trimmed-pair1.fastq, SRR7692617-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 14:42:56 2024 >> started Mon Dec 9 14:43:56 2024 >> done (59.851s) 11548044 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 196 ( 0.00%) empty read pairs filtered out after trimming by size control 11547845 (100.00%) read pairs available; of these: 2314919 (20.05%) trimmed read pairs available after processing 9232926 (79.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 28 2 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 9 0.00% 35 10 0.00% 36 6 0.00% 37 11 0.00% 38 9 0.00% 39 5 0.00% 40 7 0.00% 41 6 0.00% 42 13 0.00% 43 10 0.00% 44 15 0.00% 45 9 0.00% 46 15 0.00% 47 18 0.00% 48 19 0.00% 49 7 0.00% 50 23 0.00% 51 24 0.00% 52 48 0.00% 53 44 0.00% 54 51 0.00% 55 53 0.00% 56 56 0.00% 57 63 0.00% 58 83 0.00% 59 91 0.00% 60 89 0.00% 61 113 0.00% 62 153 0.00% 63 173 0.00% 64 211 0.00% 65 225 0.00% 66 267 0.00% 67 321 0.00% 68 335 0.00% 69 384 0.00% 70 446 0.00% 71 364 0.00% 72 440 0.00% 73 443 0.00% 74 546 0.00% 75 587 0.01% 76 741 0.01% 77 803 0.01% 78 887 0.01% 79 1078 0.01% 80 1241 0.01% 81 1398 0.01% 82 1694 0.01% 83 1893 0.02% 84 2295 0.02% 85 2625 0.02% 86 3127 0.03% 87 3468 0.03% 88 4045 0.04% 89 4708 0.04% 90 5349 0.05% 91 6494 0.06% 92 7477 0.06% 93 8681 0.08% 94 10176 0.09% 95 11740 0.10% 96 13976 0.12% 97 15744 0.14% 98 18028 0.16% 99 20573 0.18% 100 23789 0.21% 101 27171 0.24% 102 31077 0.27% 103 35188 0.30% 104 39906 0.35% 105 44324 0.38% 106 49787 0.43% 107 53631 0.46% 108 58690 0.51% 109 64095 0.56% 110 68608 0.59% 111 74122 0.64% 112 80831 0.70% 113 86441 0.75% 114 92494 0.80% 115 98153 0.85% 116 103203 0.89% 117 107746 0.93% 118 112073 0.97% 119 115385 1.00% 120 120178 1.04% 121 124755 1.08% 122 129497 1.12% 123 134474 1.16% 124 140154 1.21% 125 145089 1.26% 126 9232926 79.95% 11547845 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=29 prefix-density=0.21 prefix-fanout=2.7 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=180.32 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=25.1 sequence=CTTCTTCTTGGCC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.90 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.1 sequence=AGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=86.61 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=15.6 sequence=CAAGAAGAAGGT SRR7692617 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 14:48:18 Started mapping on | Dec 09 14:48:19 Finished on | Dec 09 14:51:50 Mapping speed, Million of reads per hour | 197.02 Number of input reads | 11547845 Average input read length | 247 UNIQUE READS: Uniquely mapped reads number | 11026019 Uniquely mapped reads % | 95.48% Average mapped length | 246.69 Number of splices: Total | 7989754 Number of splices: Annotated (sjdb) | 7478009 Number of splices: GT/AG | 7879402 Number of splices: GC/AG | 93706 Number of splices: AT/AC | 3285 Number of splices: Non-canonical | 13361 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 213426 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 21768 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 308403 308403 308403 N_multimapping 213426 213426 213426 N_noFeature 576644 10669630 658982 N_ambiguous 306907 1225 33179 UnstrandedReadsAssigned:10142468 PositiveStrandReadsAssigned:355164 NegativeStrandReadsAssigned:10333858 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692617 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692617-trimmed-pair1.fastq SRR7692617-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,547,845 reads, 10,468,015 reads pseudoaligned [quant] estimated average fragment length: 146.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR7692617.ke.tsv 35125 SRR7692617.se.tsv 88098 total ==> SRR7692617.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 790.277 0 0 PNS24247 1044 898.177 26.6576 4.25119 PNS24249 1928 1782.18 33.0248 2.65425 PNS24246 1044 898.177 26.6576 4.25119 PNS24248 1044 898.177 26.6576 4.25119 PNS24244 1471 1325.18 97.0025 10.4848 PNS24243 293 148.671 0 0 KQK14069 1603 1457.18 6702.67 658.851 KQK14071 474 329.115 338.56 147.346 ==> SRR7692617.se.tsv <== BRADI_1g14170v3 7979 BRADI_1g53295v3 117 BRADI_1g59795v3 718 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 55 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 325 BRADI_1g48960v3 0 SRR7692617 completed mapping pipeline successfully