Starting /dee2/code/volunteer_pipeline.sh SRR7692618 current disk space = 1515173150720 free memory = 1597852872 SRR7692618 SRAfilesize aba8ec0f2a28b609d55df5f9d0a694cb SRR7692618.sra SRR7692618.sra file validated SRR7692618 is paired end SRR7692618 is conventional basespace SRR7692618 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692618_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.822 28.0 18.0 32.0 18.0 33.0 2 29.0755 31.0 28.0 33.0 18.0 33.0 3 31.0105 33.0 31.0 33.0 28.0 33.0 4 32.25 33.0 33.0 33.0 31.0 33.0 5 32.8565 33.0 33.0 33.0 32.0 34.0 6 36.58075 38.0 37.0 38.0 34.0 38.0 7 36.7865 38.0 37.0 38.0 34.0 38.0 8 37.125 38.0 38.0 38.0 36.0 38.0 9 37.32275 38.0 38.0 38.0 37.0 38.0 10-11 37.415 38.0 38.0 38.0 37.0 38.0 12-13 37.466125000000005 38.0 38.0 38.0 37.0 38.0 14-15 37.458875 38.0 38.0 38.0 37.0 38.0 16-17 37.38975 38.0 38.0 38.0 37.0 38.0 18-19 37.444125 38.0 38.0 38.0 37.0 38.0 20-21 37.41925 38.0 38.0 38.0 37.0 38.0 22-23 37.4375 38.0 38.0 38.0 37.0 38.0 24-25 37.489875 38.0 38.0 38.0 37.0 38.0 26-27 37.3655 38.0 38.0 38.0 37.0 38.0 28-29 37.4405 38.0 38.0 38.0 37.0 38.0 30-31 37.515875 38.0 38.0 38.0 37.5 38.0 32-33 37.466125000000005 38.0 38.0 38.0 37.0 38.0 34-35 37.29174999999999 38.0 38.0 38.0 37.0 38.0 36-37 37.377625 38.0 38.0 38.0 37.0 38.0 38-39 37.371625 38.0 38.0 38.0 37.0 38.0 40-41 37.385374999999996 38.0 38.0 38.0 37.0 38.0 42-43 37.33525 38.0 38.0 38.0 37.0 38.0 44-45 37.419125 38.0 38.0 38.0 37.0 38.0 46-47 37.382 38.0 38.0 38.0 37.0 38.0 48-49 37.326875 38.0 38.0 38.0 37.0 38.0 50-51 37.3765 38.0 38.0 38.0 37.0 38.0 52-53 37.373374999999996 38.0 38.0 38.0 37.0 38.0 54-55 37.370625000000004 38.0 38.0 38.0 37.0 38.0 56-57 37.345124999999996 38.0 38.0 38.0 37.0 38.0 58-59 37.329875 38.0 38.0 38.0 37.0 38.0 60-61 37.370625000000004 38.0 38.0 38.0 37.0 38.0 62-63 37.325874999999996 38.0 38.0 38.0 37.0 38.0 64-65 37.313625 38.0 38.0 38.0 37.0 38.0 66-67 37.317 38.0 38.0 38.0 37.0 38.0 68-69 37.343625 38.0 38.0 38.0 37.0 38.0 70-71 37.272875 38.0 38.0 38.0 37.0 38.0 72-73 37.326625 38.0 38.0 38.0 37.0 38.0 74-75 37.228875 38.0 38.0 38.0 36.5 38.0 76-77 37.18425 38.0 38.0 38.0 36.0 38.0 78-79 37.236999999999995 38.0 38.0 38.0 36.0 38.0 80-81 37.2455 38.0 38.0 38.0 36.0 38.0 82-83 37.2405 38.0 38.0 38.0 36.0 38.0 84-85 37.188375 38.0 38.0 38.0 36.0 38.0 86-87 37.155874999999995 38.0 38.0 38.0 36.0 38.0 88-89 37.169875000000005 38.0 38.0 38.0 36.0 38.0 90-91 37.10625 38.0 38.0 38.0 36.0 38.0 92-93 37.02075000000001 38.0 38.0 38.0 35.5 38.0 94-95 37.04325 38.0 38.0 38.0 35.5 38.0 96-97 37.104625 38.0 38.0 38.0 36.0 38.0 98-99 36.960750000000004 38.0 38.0 38.0 35.0 38.0 100-101 37.051375 38.0 38.0 38.0 35.5 38.0 102-103 36.781875 38.0 38.0 38.0 34.5 38.0 104-105 36.734125000000006 38.0 38.0 38.0 34.5 38.0 106-107 36.547875 38.0 38.0 38.0 34.0 38.0 108-109 36.548625 38.0 38.0 38.0 34.0 38.0 110-111 36.529250000000005 38.0 38.0 38.0 34.0 38.0 112-113 36.743125 38.0 38.0 38.0 34.5 38.0 114-115 36.6025 38.0 38.0 38.0 34.0 38.0 116-117 36.5055 38.0 38.0 38.0 34.0 38.0 118-119 36.25775 38.0 37.5 38.0 33.0 38.0 120-121 36.448499999999996 38.0 37.5 38.0 33.5 38.0 122-123 36.32725 38.0 37.5 38.0 33.5 38.0 124-125 36.407 38.0 38.0 38.0 34.0 38.0 126 32.2145 36.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 0.0 23 3.0 24 3.0 25 4.0 26 6.0 27 8.0 28 13.0 29 17.0 30 33.0 31 32.0 32 48.0 33 68.0 34 99.0 35 182.0 36 544.0 37 2937.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.392405063291136 9.620253164556962 8.278481012658228 40.70886075949367 2 22.2 12.975 35.9 28.925 3 21.575 15.925 25.1 37.4 4 27.175 22.175 22.525000000000002 28.125 5 25.75 29.5 23.400000000000002 21.349999999999998 6 22.55 30.525000000000002 23.35 23.575 7 18.25 23.375 38.25 20.125 8 20.325 24.7 30.349999999999998 24.625 9 19.05 22.675 34.0 24.275 10-11 23.075000000000003 30.65 23.75 22.525000000000002 12-13 23.2375 23.7 27.437499999999996 25.624999999999996 14-15 22.112499999999997 25.7 27.175 25.0125 16-17 23.2625 25.9625 25.8625 24.9125 18-19 22.775000000000002 26.25 25.85 25.124999999999996 20-21 22.575 26.1 26.7625 24.5625 22-23 23.2125 26.150000000000002 26.150000000000002 24.4875 24-25 23.35 25.525 25.374999999999996 25.75 26-27 22.093023255813954 26.71917979494874 26.63165791447862 24.55613903475869 28-29 22.7625 27.224999999999998 25.424999999999997 24.587500000000002 30-31 22.8625 25.662499999999998 25.974999999999998 25.5 32-33 22.0 25.6125 27.1375 25.25 34-35 22.78084252758275 25.952858575727184 26.10330992978937 25.162988966900702 36-37 23.8625 25.637500000000003 25.5125 24.9875 38-39 22.65214124718257 25.39444027047333 25.88279489105935 26.070623591284747 40-41 22.237499999999997 26.325 25.650000000000002 25.7875 42-43 23.0125 25.85 25.687500000000004 25.45 44-45 23.3625 24.975 26.7625 24.9 46-47 22.81711283462597 25.894420815611706 25.494120590442833 25.794345759319487 48-49 23.43436873747495 25.826653306613228 25.501002004008015 25.237975951903806 50-51 23.513953197347014 25.36603679139031 26.49230384182205 24.62770616944062 52-53 22.76026026026026 25.663163163163162 25.350350350350347 26.226226226226224 54-55 23.14235676757568 25.619214410808105 25.531648736552416 25.706780085063798 56-57 22.455613903475868 26.19404851212803 25.756439109777446 25.593898474618655 58-59 22.970098836481924 25.972726135368447 25.960215188289755 25.096959839859878 60-61 22.8375 25.3125 25.412499999999998 26.437500000000004 62-63 23.658872077028885 24.384144054020258 26.997624109040892 24.959359759909965 64-65 23.536768384192097 26.313156578289142 25.100050025012504 25.050025012506254 66-67 23.63022266700025 25.056292219164373 25.64423317488116 25.66925193895422 68-69 23.94647992997374 25.847192697261473 24.84681755658372 25.35950981618107 70-71 23.254941205904426 25.093820365273956 26.169627220415308 25.481611208406306 72-73 23.93098274568642 25.468867216804203 25.09377344336084 25.506376594148538 74-75 23.175 25.412499999999998 25.5125 25.900000000000002 76-77 22.7 26.4125 25.7625 25.124999999999996 78-79 24.375 24.75 25.137500000000003 25.7375 80-81 24.125 24.7875 25.4 25.687500000000004 82-83 23.6625 25.687500000000004 25.775 24.875 84-85 24.190523815476936 24.69058632329041 26.390798849856235 24.72809101137642 86-87 23.1625 25.2875 25.85 25.7 88-89 23.474999999999998 25.9625 25.474999999999998 25.087500000000002 90-91 23.91548943617952 25.090636329541194 25.25315664458057 25.740717589698715 92-93 23.761880940470235 25.52526263131566 25.76288144072036 24.949974987493746 94-95 23.574287143571787 25.82541270635318 25.86293146573287 24.73736868434217 96-97 22.39589846192322 26.09728648243091 25.847192697261473 25.659622358384393 98-99 24.409153432537202 24.746780042515944 26.32237088908341 24.52169563586345 100-101 23.0278784848106 25.440680085010626 25.30316289536192 26.22827853481685 102-103 23.9125 24.275 26.487500000000004 25.324999999999996 104-105 23.6125 25.4625 25.8625 25.0625 106-107 24.087500000000002 24.837500000000002 26.025 25.05 108-109 23.9125 25.525 25.662499999999998 24.9 110-111 24.462500000000002 25.624999999999996 25.25 24.6625 112-113 23.5625 25.8625 25.5625 25.0125 114-115 24.6 25.7125 24.55 25.137500000000003 116-117 24.8125 25.387500000000003 24.675 25.124999999999996 118-119 23.974999999999998 26.737499999999997 25.0375 24.25 120-121 25.275 25.25 23.6125 25.8625 122-123 24.375 26.625 24.5625 24.4375 124-125 24.95 25.337500000000002 24.6125 25.1 126 24.55 26.375 24.325 24.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.0 26 2.0 27 2.5 28 4.0 29 4.5 30 8.5 31 12.0 32 15.0 33 21.5 34 26.0 35 44.0 36 60.5 37 80.0 38 93.5 39 108.0 40 141.5 41 159.0 42 181.5 43 185.5 44 197.0 45 219.0 46 216.5 47 223.5 48 216.5 49 186.5 50 155.5 51 136.5 52 124.0 53 106.5 54 82.5 55 70.5 56 76.5 57 78.5 58 75.0 59 67.0 60 59.0 61 53.0 62 54.0 63 48.5 64 42.5 65 49.0 66 45.0 67 34.5 68 36.0 69 34.5 70 27.5 71 29.0 72 22.5 73 18.5 74 18.0 75 12.0 76 6.5 77 4.5 78 6.0 79 6.0 80 3.5 81 2.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.3 36-37 0.0 38-39 0.17500000000000002 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.075 48-49 0.2 50-51 0.11249999999999999 52-53 0.1 54-55 0.075 56-57 0.025 58-59 0.08750000000000001 60-61 0.0 62-63 0.0375 64-65 0.05 66-67 0.075 68-69 0.0375 70-71 0.075 72-73 0.025 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.05 94-95 0.05 96-97 0.0375 98-99 0.0375 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.9749999999999999 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692618 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692618_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78225 33.0 33.0 34.0 32.0 34.0 2 32.79875 33.0 33.0 34.0 32.0 34.0 3 32.85525 34.0 33.0 34.0 32.0 34.0 4 32.74475 34.0 33.0 34.0 32.0 34.0 5 32.78425 34.0 33.0 34.0 32.0 34.0 6 36.96375 38.0 38.0 38.0 36.0 38.0 7 36.78025 38.0 38.0 38.0 35.0 38.0 8 36.74825 38.0 38.0 38.0 35.0 38.0 9 36.65275 38.0 38.0 38.0 35.0 38.0 10-11 36.86825 38.0 38.0 38.0 35.5 38.0 12-13 36.929500000000004 38.0 38.0 38.0 36.0 38.0 14-15 36.688125 38.0 38.0 38.0 35.0 38.0 16-17 36.871625 38.0 38.0 38.0 36.0 38.0 18-19 36.850875 38.0 38.0 38.0 35.5 38.0 20-21 36.959625 38.0 38.0 38.0 36.0 38.0 22-23 36.79875 38.0 38.0 38.0 35.5 38.0 24-25 36.817499999999995 38.0 38.0 38.0 35.5 38.0 26-27 36.932249999999996 38.0 38.0 38.0 36.0 38.0 28-29 37.007625000000004 38.0 38.0 38.0 36.0 38.0 30-31 37.036875 38.0 38.0 38.0 36.0 38.0 32-33 36.974125 38.0 38.0 38.0 36.0 38.0 34-35 37.04425 38.0 38.0 38.0 36.0 38.0 36-37 37.0965 38.0 38.0 38.0 36.0 38.0 38-39 37.073625 38.0 38.0 38.0 36.5 38.0 40-41 37.044125 38.0 38.0 38.0 36.0 38.0 42-43 37.0155 38.0 38.0 38.0 36.0 38.0 44-45 37.005250000000004 38.0 38.0 38.0 36.0 38.0 46-47 37.030125 38.0 38.0 38.0 36.0 38.0 48-49 37.0 38.0 38.0 38.0 36.0 38.0 50-51 36.948625 38.0 38.0 38.0 36.0 38.0 52-53 37.0105 38.0 38.0 38.0 36.0 38.0 54-55 37.015125 38.0 38.0 38.0 36.0 38.0 56-57 37.047375 38.0 38.0 38.0 36.0 38.0 58-59 37.014375 38.0 38.0 38.0 36.0 38.0 60-61 37.093374999999995 38.0 38.0 38.0 36.0 38.0 62-63 36.971875 38.0 38.0 38.0 36.0 38.0 64-65 37.01075 38.0 38.0 38.0 36.0 38.0 66-67 36.916250000000005 38.0 38.0 38.0 36.0 38.0 68-69 36.869125 38.0 38.0 38.0 36.0 38.0 70-71 36.891875 38.0 38.0 38.0 36.0 38.0 72-73 36.9895 38.0 38.0 38.0 36.0 38.0 74-75 36.798375 38.0 38.0 38.0 35.0 38.0 76-77 36.775375 38.0 38.0 38.0 35.0 38.0 78-79 36.76925 38.0 38.0 38.0 35.0 38.0 80-81 36.737 38.0 38.0 38.0 35.0 38.0 82-83 36.73825 38.0 38.0 38.0 35.0 38.0 84-85 36.627 38.0 38.0 38.0 35.0 38.0 86-87 36.712875 38.0 38.0 38.0 35.0 38.0 88-89 36.675875000000005 38.0 38.0 38.0 35.0 38.0 90-91 36.627375 38.0 38.0 38.0 35.0 38.0 92-93 36.543375 38.0 38.0 38.0 34.0 38.0 94-95 36.663624999999996 38.0 38.0 38.0 35.0 38.0 96-97 36.65925 38.0 38.0 38.0 35.0 38.0 98-99 36.57525 38.0 38.0 38.0 34.0 38.0 100-101 36.49275 38.0 38.0 38.0 34.0 38.0 102-103 36.441874999999996 38.0 38.0 38.0 34.0 38.0 104-105 36.348375000000004 38.0 38.0 38.0 34.0 38.0 106-107 36.314625 38.0 38.0 38.0 34.0 38.0 108-109 36.251374999999996 38.0 38.0 38.0 33.5 38.0 110-111 36.185375 38.0 38.0 38.0 33.0 38.0 112-113 36.158 38.0 38.0 38.0 33.0 38.0 114-115 36.093500000000006 38.0 37.0 38.0 33.0 38.0 116-117 35.89125 38.0 37.0 38.0 31.5 38.0 118-119 36.025625000000005 38.0 37.0 38.0 32.5 38.0 120-121 35.845749999999995 38.0 37.0 38.0 31.0 38.0 122-123 35.430875 38.0 36.0 38.0 29.0 38.0 124-125 35.202625 38.0 35.5 38.0 28.5 38.0 126 30.29325 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 3.0 18 12.0 19 9.0 20 7.0 21 6.0 22 5.0 23 3.0 24 9.0 25 11.0 26 24.0 27 22.0 28 18.0 29 27.0 30 37.0 31 50.0 32 64.0 33 79.0 34 123.0 35 190.0 36 389.0 37 2910.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.65 19.025 12.174999999999999 32.15 2 27.85 25.724999999999998 26.900000000000002 19.525000000000002 3 23.775 25.624999999999996 28.225 22.375 4 27.425 31.05 19.725 21.8 5 28.525 30.4 20.674999999999997 20.4 6 22.900000000000002 34.525 21.6 20.974999999999998 7 23.35 18.8 34.449999999999996 23.400000000000002 8 23.35 23.150000000000002 25.825 27.675 9 24.975 22.275 26.3 26.450000000000003 10-11 25.9625 29.2875 21.325 23.425 12-13 26.025 24.1125 24.5625 25.3 14-15 24.8625 25.074999999999996 26.1125 23.95 16-17 26.55 25.587500000000002 24.05 23.8125 18-19 25.724999999999998 25.2125 24.337500000000002 24.725 20-21 26.075 25.4875 24.725 23.7125 22-23 25.087500000000002 26.6 24.637500000000003 23.674999999999997 24-25 24.65 25.2 25.9875 24.1625 26-27 24.975 25.275 25.5 24.25 28-29 24.4125 26.575 25.124999999999996 23.8875 30-31 25.8 25.525 24.55 24.125 32-33 25.874999999999996 25.8125 25.0 23.3125 34-35 25.687500000000004 25.424999999999997 25.1 23.7875 36-37 25.324999999999996 25.887500000000003 25.4375 23.35 38-39 24.7875 26.25 24.887500000000003 24.075 40-41 25.687500000000004 26.737499999999997 23.599999999999998 23.974999999999998 42-43 25.05 25.825 24.8625 24.2625 44-45 25.224999999999998 26.950000000000003 24.55 23.275000000000002 46-47 24.462500000000002 26.437500000000004 25.337500000000002 23.7625 48-49 24.8625 25.5375 24.825 24.775 50-51 25.474999999999998 25.5625 25.374999999999996 23.5875 52-53 25.587500000000002 25.900000000000002 25.5 23.0125 54-55 24.95 25.724999999999998 25.5625 23.7625 56-57 25.55 25.575 25.362499999999997 23.5125 58-59 25.7875 25.587500000000002 25.825 22.8 60-61 25.4375 25.087500000000002 26.0375 23.4375 62-63 25.3 25.412499999999998 25.912499999999998 23.375 64-65 25.35 26.900000000000002 24.3 23.45 66-67 25.6125 25.8125 25.174999999999997 23.400000000000002 68-69 24.75 25.362499999999997 26.75 23.1375 70-71 25.75 26.0 25.2125 23.0375 72-73 25.2 25.5625 25.7125 23.525 74-75 24.8625 25.9625 25.7125 23.4625 76-77 25.6 25.1875 25.374999999999996 23.8375 78-79 25.387500000000003 25.674999999999997 25.124999999999996 23.8125 80-81 25.3 25.9625 25.662499999999998 23.075000000000003 82-83 25.25 26.1 24.712500000000002 23.9375 84-85 25.4875 25.687500000000004 26.0125 22.8125 86-87 25.15 25.900000000000002 25.75 23.200000000000003 88-89 25.387500000000003 26.0 25.837500000000002 22.775000000000002 90-91 24.712500000000002 25.474999999999998 25.474999999999998 24.337500000000002 92-93 25.8 25.324999999999996 26.325 22.55 94-95 27.187499999999996 24.099999999999998 25.3 23.4125 96-97 24.7375 24.837500000000002 27.025 23.400000000000002 98-99 25.4 25.7875 26.0 22.8125 100-101 26.2875 25.95 25.3 22.4625 102-103 25.474999999999998 26.474999999999998 25.0625 22.9875 104-105 25.9875 25.912499999999998 26.1 22.0 106-107 25.45 26.224999999999998 25.2 23.125 108-109 25.7 25.4625 25.474999999999998 23.3625 110-111 25.5 25.424999999999997 26.187500000000004 22.8875 112-113 25.724999999999998 25.7875 25.2625 23.225 114-115 26.1625 26.487500000000004 24.375 22.975 116-117 25.412499999999998 27.2625 24.712500000000002 22.6125 118-119 25.8625 27.175 24.375 22.5875 120-121 26.92836604575572 26.453306663332913 24.590573821727716 22.027753469183647 122-123 26.307230422817113 27.62071553665249 24.956217162872154 21.115836877658246 124-125 27.50343792974122 26.515814476809602 23.89048631078885 22.090261282660332 126 27.425 25.6 24.675 22.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 2.0 27 5.0 28 4.5 29 6.5 30 10.5 31 12.0 32 15.0 33 24.0 34 37.0 35 45.5 36 57.5 37 66.0 38 85.5 39 114.5 40 133.0 41 161.5 42 175.0 43 183.5 44 203.0 45 198.5 46 196.5 47 201.5 48 182.0 49 168.5 50 160.0 51 134.5 52 121.5 53 114.0 54 92.5 55 85.5 56 84.0 57 72.0 58 69.5 59 75.5 60 72.0 61 67.5 62 64.5 63 59.0 64 50.0 65 42.5 66 42.0 67 41.0 68 44.0 69 37.5 70 28.5 71 27.5 72 26.0 73 25.5 74 23.5 75 14.0 76 6.0 77 9.0 78 8.0 79 3.0 80 2.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0125 122-123 0.075 124-125 0.0125 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.5875 0.0 0.0 0.0 0.0 112-113 3.35 0.0 0.0 0.0 0.0 114 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCGA 30 0.0038065957 60.000004 7 >>END_MODULE Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713679 spots for SRR7692618.sra Written 713679 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra Read 713672 spots for SRR7692618.sra Written 713672 spots for SRR7692618.sra SRR ids: ['SRR7692618.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wyf2xudm SRR7692618.sra spots: 14273447 blocks: [[1, 713672], [713673, 1427344], [1427345, 2141016], [2141017, 2854688], [2854689, 3568360], [3568361, 4282032], [4282033, 4995704], [4995705, 5709376], [5709377, 6423048], [6423049, 7136720], [7136721, 7850392], [7850393, 8564064], [8564065, 9277736], [9277737, 9991408], [9991409, 10705080], [10705081, 11418752], [11418753, 12132424], [12132425, 12846096], [12846097, 13559768], [13559769, 14273447]] SRR7692618 file size 4553958 SRR7692618 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692618 SRR7692618_1.fastq SRR7692618_2.fastq Input file: SRR7692618_1.fastq Paired file: SRR7692618_2.fastq trimmed: SRR7692618-trimmed-pair1.fastq, SRR7692618-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:11:18 2024 >> started Thu Dec 12 03:11:33 2024 >> done (15.547s) 14273447 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 82 ( 0.00%) empty read pairs filtered out after trimming by size control 14273361 (100.00%) read pairs available; of these: 1599220 (11.20%) trimmed read pairs available after processing 12674141 (88.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 2 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 3 0.00% 36 4 0.00% 37 7 0.00% 38 7 0.00% 39 4 0.00% 40 5 0.00% 41 6 0.00% 42 6 0.00% 43 5 0.00% 44 8 0.00% 45 4 0.00% 46 8 0.00% 47 12 0.00% 48 10 0.00% 49 9 0.00% 50 13 0.00% 51 10 0.00% 52 17 0.00% 53 16 0.00% 54 16 0.00% 55 24 0.00% 56 22 0.00% 57 15 0.00% 58 43 0.00% 59 41 0.00% 60 68 0.00% 61 53 0.00% 62 94 0.00% 63 99 0.00% 64 82 0.00% 65 129 0.00% 66 133 0.00% 67 147 0.00% 68 156 0.00% 69 193 0.00% 70 220 0.00% 71 179 0.00% 72 186 0.00% 73 228 0.00% 74 279 0.00% 75 290 0.00% 76 355 0.00% 77 366 0.00% 78 441 0.00% 79 522 0.00% 80 556 0.00% 81 709 0.00% 82 833 0.01% 83 951 0.01% 84 1113 0.01% 85 1252 0.01% 86 1420 0.01% 87 1675 0.01% 88 1922 0.01% 89 2259 0.02% 90 2680 0.02% 91 3141 0.02% 92 3594 0.03% 93 4399 0.03% 94 5073 0.04% 95 5971 0.04% 96 7133 0.05% 97 8372 0.06% 98 9644 0.07% 99 11022 0.08% 100 12857 0.09% 101 14768 0.10% 102 17104 0.12% 103 19878 0.14% 104 22666 0.16% 105 25693 0.18% 106 29113 0.20% 107 32407 0.23% 108 36188 0.25% 109 39742 0.28% 110 43213 0.30% 111 47320 0.33% 112 52067 0.36% 113 56641 0.40% 114 61728 0.43% 115 67040 0.47% 116 72655 0.51% 117 76837 0.54% 118 82186 0.58% 119 85365 0.60% 120 90635 0.63% 121 95476 0.67% 122 100481 0.70% 123 106406 0.75% 124 112731 0.79% 125 119763 0.84% 126 12674141 88.80% 14273361 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.18 fanout-score-rank=19 prefix-density=0.57 prefix-fanout=1.9 sequence=AAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAATCAAGGAGGAGAATATGAAGAGCTTTGGTATTAAACAAGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=222.49 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=27.1 sequence=CTTCTTCTTGGCC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=30 prefix-density=0.29 prefix-fanout=2.5 sequence=GTCACCGGCAAGGGTCCCCTTGAGAACCTCGCTGACCACCTTGCCGACCCCGTCAACAACAACGCGTGGGCCTTTGCCACCAACTTCGTTCCCGGCAAGTAAGGTGTCAATGAGAGGCACATGTGTATATGCAAATCGACTATGCTCGCGACCAAGTGTGTGTAGCTGGTTTCACTTGTACTACCACGATGATGATGTAAATTAATTACGAGGATCTTATGAAC criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=101.56 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=19.2 sequence=CAAGAAGAAGGT SRR7692618 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:12:08 Started mapping on | Dec 12 03:12:08 Finished on | Dec 12 03:13:02 Mapping speed, Million of reads per hour | 951.56 Number of input reads | 14273361 Average input read length | 249 UNIQUE READS: Uniquely mapped reads number | 13707774 Uniquely mapped reads % | 96.04% Average mapped length | 249.08 Number of splices: Total | 11499317 Number of splices: Annotated (sjdb) | 10867969 Number of splices: GT/AG | 11345442 Number of splices: GC/AG | 133910 Number of splices: AT/AC | 5018 Number of splices: Non-canonical | 14947 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 208223 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 15080 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.93% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 357366 357366 357366 N_multimapping 208223 208223 208223 N_noFeature 639180 13350012 733654 N_ambiguous 304530 1525 41441 UnstrandedReadsAssigned:12764064 PositiveStrandReadsAssigned:356237 NegativeStrandReadsAssigned:12932679 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692618 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692618-trimmed-pair1.fastq SRR7692618-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,273,361 reads, 13,083,240 reads pseudoaligned [quant] estimated average fragment length: 155.392 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR7692618.ke.tsv 35125 SRR7692618.se.tsv 88098 total ==> SRR7692618.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 781.721 0 0 PNS24247 1044 889.608 39.5045 5.23355 PNS24249 1928 1773.61 105.605 7.01735 PNS24246 1044 889.608 39.5045 5.23355 PNS24248 1044 889.608 39.5045 5.23355 PNS24244 1471 1316.61 52.8818 4.73367 PNS24243 293 140.255 0 0 KQK14069 1603 1448.61 8214.93 668.346 KQK14071 474 320.749 464.413 170.643 ==> SRR7692618.se.tsv <== BRADI_1g14170v3 9657 BRADI_1g53295v3 107 BRADI_1g59795v3 577 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 62 BRADI_1g74790v3 101 BRADI_1g09890v3 0 BRADI_1g77505v3 254 BRADI_1g48960v3 0 SRR7692618 completed mapping pipeline successfully