Starting /dee2/code/volunteer_pipeline.sh SRR7692620 current disk space = 1524000198656 free memory = 1384968108 SRR7692620 SRAfilesize 61f5338639b07315dc5a05c25326a022 SRR7692620.sra SRR7692620.sra file validated SRR7692620 is paired end SRR7692620 is conventional basespace SRR7692620 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692620_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.98625 18.0 18.0 25.0 18.0 32.0 2 29.66575 30.0 27.0 31.0 27.0 33.0 3 31.54775 33.0 31.0 33.0 29.0 33.0 4 32.42625 33.0 33.0 33.0 31.0 34.0 5 33.117 33.0 33.0 34.0 33.0 34.0 6 36.965 38.0 37.0 38.0 35.0 38.0 7 37.03925 38.0 38.0 38.0 36.0 38.0 8 37.1885 38.0 38.0 38.0 36.0 38.0 9 37.32325 38.0 38.0 38.0 37.0 38.0 10-11 37.3065 38.0 38.0 38.0 36.5 38.0 12-13 37.40475 38.0 38.0 38.0 37.0 38.0 14-15 37.401625 38.0 38.0 38.0 37.0 38.0 16-17 37.411125 38.0 38.0 38.0 37.0 38.0 18-19 37.445875 38.0 38.0 38.0 37.0 38.0 20-21 37.384625 38.0 38.0 38.0 37.0 38.0 22-23 37.461375000000004 38.0 38.0 38.0 37.0 38.0 24-25 37.436875 38.0 38.0 38.0 37.0 38.0 26-27 37.386625 38.0 38.0 38.0 37.0 38.0 28-29 37.413875000000004 38.0 38.0 38.0 37.0 38.0 30-31 37.465125 38.0 38.0 38.0 37.0 38.0 32-33 37.503125 38.0 38.0 38.0 37.0 38.0 34-35 37.317750000000004 38.0 38.0 38.0 37.0 38.0 36-37 37.432249999999996 38.0 38.0 38.0 37.0 38.0 38-39 37.403999999999996 38.0 38.0 38.0 37.0 38.0 40-41 37.383375 38.0 38.0 38.0 37.0 38.0 42-43 37.327124999999995 38.0 38.0 38.0 37.0 38.0 44-45 37.389250000000004 38.0 38.0 38.0 37.0 38.0 46-47 37.301375 38.0 38.0 38.0 37.0 38.0 48-49 37.290875 38.0 38.0 38.0 37.0 38.0 50-51 37.376875 38.0 38.0 38.0 37.0 38.0 52-53 37.3725 38.0 38.0 38.0 37.0 38.0 54-55 37.415499999999994 38.0 38.0 38.0 37.0 38.0 56-57 37.332875 38.0 38.0 38.0 37.0 38.0 58-59 37.356125000000006 38.0 38.0 38.0 37.0 38.0 60-61 37.366125 38.0 38.0 38.0 37.0 38.0 62-63 37.37375 38.0 38.0 38.0 37.0 38.0 64-65 37.353624999999994 38.0 38.0 38.0 37.0 38.0 66-67 37.343 38.0 38.0 38.0 37.0 38.0 68-69 37.3485 38.0 38.0 38.0 36.5 38.0 70-71 37.346125 38.0 38.0 38.0 37.0 38.0 72-73 37.2485 38.0 38.0 38.0 36.5 38.0 74-75 37.236999999999995 38.0 38.0 38.0 36.0 38.0 76-77 37.194125 38.0 38.0 38.0 36.0 38.0 78-79 37.189499999999995 38.0 38.0 38.0 36.0 38.0 80-81 37.22225 38.0 38.0 38.0 36.0 38.0 82-83 37.16025 38.0 38.0 38.0 36.0 38.0 84-85 37.164500000000004 38.0 38.0 38.0 36.0 38.0 86-87 37.11475 38.0 38.0 38.0 36.0 38.0 88-89 37.136624999999995 38.0 38.0 38.0 36.0 38.0 90-91 37.064875 38.0 38.0 38.0 35.5 38.0 92-93 37.0655 38.0 38.0 38.0 35.5 38.0 94-95 36.993375 38.0 38.0 38.0 35.0 38.0 96-97 36.97 38.0 38.0 38.0 35.0 38.0 98-99 36.83525 38.0 38.0 38.0 35.0 38.0 100-101 36.939125000000004 38.0 38.0 38.0 35.0 38.0 102-103 36.8515 38.0 38.0 38.0 35.0 38.0 104-105 36.72225 38.0 38.0 38.0 34.0 38.0 106-107 36.475375 38.0 38.0 38.0 34.0 38.0 108-109 36.539249999999996 38.0 38.0 38.0 34.0 38.0 110-111 36.545625 38.0 38.0 38.0 34.0 38.0 112-113 36.568 38.0 38.0 38.0 34.0 38.0 114-115 36.484624999999994 38.0 38.0 38.0 34.0 38.0 116-117 36.47225 38.0 38.0 38.0 34.0 38.0 118-119 36.264875 38.0 37.0 38.0 33.0 38.0 120-121 36.481125000000006 38.0 38.0 38.0 34.0 38.0 122-123 36.256125 38.0 37.0 38.0 33.0 38.0 124-125 36.327375 38.0 37.0 38.0 34.0 38.0 126 31.9815 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 0.0 25 5.0 26 8.0 27 10.0 28 11.0 29 19.0 30 25.0 31 38.0 32 48.0 33 73.0 34 115.0 35 184.0 36 624.0 37 2837.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.863117870722434 9.987325728770596 15.462610899873258 42.68694550063372 2 22.875 13.575000000000001 34.775 28.775000000000002 3 22.05 16.075 24.375 37.5 4 26.424999999999997 24.4 21.975 27.200000000000003 5 26.924999999999997 28.075 23.599999999999998 21.4 6 21.375 30.599999999999998 24.625 23.400000000000002 7 19.575 21.9 38.25 20.275000000000002 8 21.45 21.425 29.125 28.000000000000004 9 20.674999999999997 21.425 32.9 25.0 10-11 25.1875 28.15 22.5125 24.15 12-13 23.8375 22.5625 26.0125 27.5875 14-15 23.849999999999998 23.625 26.5375 25.9875 16-17 24.05 24.224999999999998 25.4875 26.237500000000004 18-19 24.3625 25.0375 24.5 26.1 20-21 24.2625 24.85 24.275 26.6125 22-23 23.75 25.874999999999996 24.675 25.7 24-25 23.7625 25.2625 24.6 26.375 26-27 23.577947243405426 25.378172271533945 25.57819727465933 25.465683210401302 28-29 24.3 24.212500000000002 25.15 26.337500000000002 30-31 23.8125 25.224999999999998 24.0125 26.950000000000003 32-33 23.625 25.575 25.2625 25.5375 34-35 23.802958134870895 25.983955878666332 25.09400852343946 25.119077463023316 36-37 25.2875 24.0625 24.962500000000002 25.687500000000004 38-39 23.42263395092639 24.799699549323986 25.61342013019529 26.164246369554334 40-41 24.075 25.7 24.474999999999998 25.75 42-43 23.9 25.15 24.712500000000002 26.237500000000004 44-45 23.65 25.624999999999996 24.75 25.974999999999998 46-47 24.884331624359135 24.509190946604978 24.696761285482054 25.909716143553833 48-49 25.046963055729492 24.708829054477143 24.458359423919852 25.785848465873514 50-51 24.527593542735577 24.490051307721185 24.765361031160054 26.21699411838318 52-53 24.80920805704992 24.896784686600775 23.94595270862004 26.348054547729262 54-55 23.925 24.625 24.3875 27.0625 56-57 24.025 24.95 25.137500000000003 25.887500000000003 58-59 24.524762381190595 25.22511255627814 23.88694347173587 26.3631815907954 60-61 24.099999999999998 25.1 23.799999999999997 27.0 62-63 24.762500000000003 24.7375 24.4375 26.0625 64-65 24.04050506313289 24.915614451806476 24.290536317039628 26.753344168021005 66-67 24.4875 24.85 24.3125 26.35 68-69 24.65 24.5375 25.324999999999996 25.4875 70-71 24.025 26.137500000000003 24.6 25.2375 72-73 23.974999999999998 24.75 24.45 26.825 74-75 25.1 23.8375 24.575 26.487500000000004 76-77 24.8 25.1875 23.9 26.1125 78-79 24.2625 24.425 24.224999999999998 27.0875 80-81 24.1125 24.962500000000002 24.725 26.200000000000003 82-83 24.9875 24.4875 24.8125 25.7125 84-85 25.1 24.8125 23.974999999999998 26.1125 86-87 24.3625 24.212500000000002 25.0125 26.4125 88-89 26.275 25.387500000000003 23.625 24.712500000000002 90-91 24.3125 24.925 24.65 26.1125 92-93 25.174999999999997 24.625 23.9125 26.2875 94-95 25.15 24.2625 24.474999999999998 26.1125 96-97 25.0375 24.05 23.599999999999998 27.3125 98-99 24.75 24.224999999999998 24.75 26.275 100-101 25.162499999999998 24.5 24.1875 26.150000000000002 102-103 24.25 25.15 24.212500000000002 26.387500000000003 104-105 25.162499999999998 25.5 24.7875 24.55 106-107 25.662499999999998 23.9875 24.0 26.35 108-109 25.074999999999996 25.474999999999998 23.7625 25.687500000000004 110-111 25.025 24.762500000000003 24.887500000000003 25.324999999999996 112-113 25.3125 24.75 24.15 25.7875 114-115 24.95 24.6125 23.724999999999998 26.7125 116-117 24.725 24.9125 24.349999999999998 26.0125 118-119 25.3 24.7375 24.087500000000002 25.874999999999996 120-121 25.974999999999998 24.212500000000002 23.3125 26.5 122-123 25.25 25.05 24.349999999999998 25.35 124-125 25.112499999999997 24.2375 24.575 26.075 126 24.675 24.775 24.55 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 1.5 27 2.0 28 3.5 29 4.0 30 3.5 31 6.5 32 13.5 33 16.0 34 23.5 35 35.0 36 43.0 37 53.0 38 71.5 39 87.5 40 113.5 41 140.5 42 165.5 43 188.0 44 197.5 45 194.5 46 190.0 47 189.5 48 167.0 49 161.0 50 163.0 51 148.5 52 126.0 53 101.0 54 94.5 55 85.5 56 76.5 57 86.0 58 74.0 59 74.0 60 85.5 61 78.5 62 73.5 63 64.0 64 66.0 65 67.0 66 65.5 67 62.0 68 50.5 69 48.0 70 47.0 71 39.0 72 28.0 73 27.0 74 27.0 75 20.5 76 13.0 77 8.5 78 10.0 79 7.5 80 3.5 81 3.0 82 1.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.27499999999999997 36-37 0.0 38-39 0.15 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.1875 50-51 0.11249999999999999 52-53 0.08750000000000001 54-55 0.0 56-57 0.0 58-59 0.05 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.9249999999999999 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692620 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692620_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80475 33.0 33.0 34.0 32.0 34.0 2 32.8615 33.0 33.0 34.0 32.0 34.0 3 32.8155 34.0 33.0 34.0 32.0 34.0 4 32.789 34.0 33.0 34.0 32.0 34.0 5 32.70275 33.0 33.0 34.0 32.0 34.0 6 36.92275 38.0 38.0 38.0 36.0 38.0 7 36.87175 38.0 38.0 38.0 36.0 38.0 8 36.97625 38.0 38.0 38.0 36.0 38.0 9 36.81725 38.0 38.0 38.0 36.0 38.0 10-11 36.958749999999995 38.0 38.0 38.0 36.0 38.0 12-13 36.983625 38.0 38.0 38.0 36.0 38.0 14-15 36.72925 38.0 38.0 38.0 35.0 38.0 16-17 36.8915 38.0 38.0 38.0 36.0 38.0 18-19 36.85025 38.0 38.0 38.0 36.0 38.0 20-21 36.9905 38.0 38.0 38.0 36.0 38.0 22-23 36.858125 38.0 38.0 38.0 36.0 38.0 24-25 36.862125 38.0 38.0 38.0 36.0 38.0 26-27 36.979625 38.0 38.0 38.0 36.0 38.0 28-29 36.978875 38.0 38.0 38.0 36.0 38.0 30-31 37.081875 38.0 38.0 38.0 36.5 38.0 32-33 36.998625000000004 38.0 38.0 38.0 36.0 38.0 34-35 37.006125 38.0 38.0 38.0 36.0 38.0 36-37 37.086749999999995 38.0 38.0 38.0 36.5 38.0 38-39 37.070499999999996 38.0 38.0 38.0 36.5 38.0 40-41 37.013374999999996 38.0 38.0 38.0 36.0 38.0 42-43 37.1095 38.0 38.0 38.0 37.0 38.0 44-45 37.057625 38.0 38.0 38.0 36.0 38.0 46-47 36.978375 38.0 38.0 38.0 36.0 38.0 48-49 37.010374999999996 38.0 38.0 38.0 36.0 38.0 50-51 37.015125 38.0 38.0 38.0 36.5 38.0 52-53 37.0745 38.0 38.0 38.0 36.5 38.0 54-55 37.066125 38.0 38.0 38.0 36.5 38.0 56-57 37.011625 38.0 38.0 38.0 36.0 38.0 58-59 37.03775 38.0 38.0 38.0 36.0 38.0 60-61 37.080375000000004 38.0 38.0 38.0 36.5 38.0 62-63 36.96125000000001 38.0 38.0 38.0 36.0 38.0 64-65 37.017125 38.0 38.0 38.0 36.0 38.0 66-67 37.0205 38.0 38.0 38.0 36.0 38.0 68-69 36.9795 38.0 38.0 38.0 36.0 38.0 70-71 36.864999999999995 38.0 38.0 38.0 36.0 38.0 72-73 36.8985 38.0 38.0 38.0 36.0 38.0 74-75 36.899874999999994 38.0 38.0 38.0 36.0 38.0 76-77 36.767 38.0 38.0 38.0 35.5 38.0 78-79 36.754 38.0 38.0 38.0 35.5 38.0 80-81 36.80775 38.0 38.0 38.0 35.5 38.0 82-83 36.817750000000004 38.0 38.0 38.0 35.5 38.0 84-85 36.68825 38.0 38.0 38.0 35.0 38.0 86-87 36.7555 38.0 38.0 38.0 35.0 38.0 88-89 36.740875 38.0 38.0 38.0 35.0 38.0 90-91 36.652 38.0 38.0 38.0 35.0 38.0 92-93 36.637874999999994 38.0 38.0 38.0 35.0 38.0 94-95 36.645375 38.0 38.0 38.0 34.5 38.0 96-97 36.6425 38.0 38.0 38.0 34.5 38.0 98-99 36.666875000000005 38.0 38.0 38.0 35.0 38.0 100-101 36.593875 38.0 38.0 38.0 34.0 38.0 102-103 36.513875 38.0 38.0 38.0 34.5 38.0 104-105 36.451 38.0 38.0 38.0 34.0 38.0 106-107 36.39425 38.0 38.0 38.0 34.0 38.0 108-109 36.344625 38.0 38.0 38.0 34.0 38.0 110-111 36.27525 38.0 38.0 38.0 34.0 38.0 112-113 36.284499999999994 38.0 38.0 38.0 34.0 38.0 114-115 36.15675 38.0 38.0 38.0 33.0 38.0 116-117 35.952124999999995 38.0 37.0 38.0 33.0 38.0 118-119 36.19075 38.0 38.0 38.0 33.0 38.0 120-121 35.98075 38.0 37.5 38.0 31.5 38.0 122-123 35.57325 38.0 36.0 38.0 31.0 38.0 124-125 35.31762500000001 38.0 35.5 38.0 29.5 38.0 126 30.391 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 4.0 17 5.0 18 12.0 19 12.0 20 12.0 21 11.0 22 4.0 23 4.0 24 5.0 25 12.0 26 11.0 27 22.0 28 29.0 29 30.0 30 28.0 31 36.0 32 58.0 33 61.0 34 80.0 35 164.0 36 441.0 37 2959.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.550000000000004 17.525 12.2 36.725 2 29.4 23.599999999999998 27.175 19.825 3 23.575 25.124999999999996 25.324999999999996 25.974999999999998 4 27.400000000000002 29.25 18.95 24.4 5 26.924999999999997 30.9 20.775 21.4 6 22.75 31.874999999999996 21.325 24.05 7 23.775 17.150000000000002 33.625 25.45 8 24.15 21.55 24.575 29.725 9 24.25 21.45 26.05 28.249999999999996 10-11 27.075 27.05 20.625 25.25 12-13 27.200000000000003 22.35 23.974999999999998 26.474999999999998 14-15 26.025 24.224999999999998 24.1125 25.637500000000003 16-17 26.387500000000003 23.7875 24.0625 25.7625 18-19 26.275 24.125 23.849999999999998 25.75 20-21 27.0625 24.837500000000002 23.375 24.725 22-23 26.174999999999997 24.587500000000002 23.875 25.362499999999997 24-25 25.074999999999996 25.1 24.3625 25.4625 26-27 26.200000000000003 25.1875 22.85 25.7625 28-29 26.9125 24.375 24.0 24.712500000000002 30-31 26.174999999999997 23.9875 24.7375 25.1 32-33 26.6125 25.124999999999996 23.125 25.137500000000003 34-35 25.724999999999998 23.599999999999998 24.55 26.125 36-37 25.474999999999998 24.375 24.4125 25.7375 38-39 26.2125 25.124999999999996 24.325 24.337500000000002 40-41 26.525 23.6625 23.625 26.187500000000004 42-43 25.174999999999997 24.275 25.6 24.95 44-45 26.087500000000002 24.575 24.2625 25.074999999999996 46-47 25.7875 24.075 24.5625 25.575 48-49 25.724999999999998 24.2 24.525 25.55 50-51 26.0625 24.55 24.55 24.837500000000002 52-53 26.700000000000003 24.05 24.875 24.375 54-55 25.337500000000002 24.45 24.7 25.5125 56-57 26.4125 24.25 24.349999999999998 24.9875 58-59 26.5875 24.125 23.75 25.5375 60-61 25.900000000000002 25.0375 24.2875 24.775 62-63 25.837500000000002 24.8625 24.775 24.525 64-65 26.4125 24.2375 24.1375 25.2125 66-67 25.525 24.587500000000002 24.9 24.9875 68-69 25.337500000000002 24.962500000000002 24.587500000000002 25.112499999999997 70-71 27.1125 23.825 24.5125 24.55 72-73 25.575 24.0 25.637500000000003 24.7875 74-75 26.237500000000004 23.200000000000003 25.137500000000003 25.424999999999997 76-77 25.974999999999998 24.75 23.962500000000002 25.3125 78-79 25.662499999999998 23.875 25.275 25.1875 80-81 26.7125 25.412499999999998 24.125 23.75 82-83 25.337500000000002 25.1875 24.2 25.275 84-85 26.275 24.637500000000003 24.8625 24.224999999999998 86-87 27.1125 24.6125 24.6125 23.6625 88-89 27.0875 24.5125 24.275 24.125 90-91 25.9625 24.5 25.05 24.4875 92-93 25.35 24.925 25.2375 24.4875 94-95 26.9625 23.849999999999998 24.275 24.9125 96-97 25.4375 25.6125 24.6125 24.337500000000002 98-99 25.924999999999997 24.712500000000002 24.2625 25.1 100-101 27.287499999999998 23.525 24.65 24.5375 102-103 25.9625 24.099999999999998 25.2 24.7375 104-105 26.575 25.087500000000002 24.474999999999998 23.8625 106-107 26.775 24.0125 24.675 24.5375 108-109 26.075 24.1125 25.2 24.6125 110-111 25.35 24.05 25.412499999999998 25.1875 112-113 26.6625 24.224999999999998 24.887500000000003 24.224999999999998 114-115 25.924999999999997 24.3625 25.0 24.712500000000002 116-117 25.2125 25.2375 24.5375 25.0125 118-119 26.6625 25.2125 24.337500000000002 23.7875 120-121 25.5125 25.525 24.7375 24.224999999999998 122-123 27.05 25.5375 24.0125 23.400000000000002 124-125 27.237499999999997 24.837500000000002 24.224999999999998 23.7 126 26.5 25.174999999999997 23.95 24.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 1.5 27 2.5 28 3.5 29 6.5 30 7.0 31 8.5 32 15.5 33 16.5 34 18.5 35 25.5 36 38.5 37 58.5 38 74.0 39 93.5 40 111.5 41 128.0 42 155.5 43 159.0 44 166.0 45 179.5 46 176.5 47 182.5 48 175.5 49 154.5 50 147.5 51 138.0 52 111.0 53 105.0 54 99.0 55 79.5 56 78.5 57 89.0 58 97.5 59 93.0 60 88.5 61 83.5 62 80.5 63 79.5 64 71.0 65 66.5 66 63.0 67 58.0 68 68.0 69 70.5 70 55.0 71 45.0 72 40.0 73 33.0 74 26.5 75 20.5 76 12.0 77 10.5 78 9.5 79 7.0 80 3.5 81 3.0 82 2.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5537377296753083 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025169896803423106 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871126 spots for SRR7692620.sra Written 871126 spots for SRR7692620.sra Read 871132 spots for SRR7692620.sra Written 871132 spots for SRR7692620.sra SRR ids: ['SRR7692620.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9w1vfpz7 SRR7692620.sra spots: 17422526 blocks: [[1, 871126], [871127, 1742252], [1742253, 2613378], [2613379, 3484504], [3484505, 4355630], [4355631, 5226756], [5226757, 6097882], [6097883, 6969008], [6969009, 7840134], [7840135, 8711260], [8711261, 9582386], [9582387, 10453512], [10453513, 11324638], [11324639, 12195764], [12195765, 13066890], [13066891, 13938016], [13938017, 14809142], [14809143, 15680268], [15680269, 16551394], [16551395, 17422526]] SRR7692620 file size 5561077 SRR7692620 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692620 SRR7692620_1.fastq SRR7692620_2.fastq Input file: SRR7692620_1.fastq Paired file: SRR7692620_2.fastq trimmed: SRR7692620-trimmed-pair1.fastq, SRR7692620-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:28:16 2024 >> started Mon Dec 9 15:29:47 2024 >> done (91.394s) 17422526 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 46 ( 0.00%) empty read pairs filtered out after trimming by size control 17422471 (100.00%) read pairs available; of these: 1002785 ( 5.76%) trimmed read pairs available after processing 16419686 (94.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 5 0.00% 36 4 0.00% 37 5 0.00% 38 10 0.00% 39 5 0.00% 40 7 0.00% 41 7 0.00% 42 9 0.00% 43 2 0.00% 44 10 0.00% 45 9 0.00% 46 17 0.00% 47 12 0.00% 48 11 0.00% 49 23 0.00% 50 19 0.00% 51 19 0.00% 52 21 0.00% 53 20 0.00% 54 29 0.00% 55 27 0.00% 56 42 0.00% 57 40 0.00% 58 38 0.00% 59 55 0.00% 60 63 0.00% 61 67 0.00% 62 73 0.00% 63 73 0.00% 64 95 0.00% 65 111 0.00% 66 134 0.00% 67 161 0.00% 68 180 0.00% 69 203 0.00% 70 229 0.00% 71 219 0.00% 72 286 0.00% 73 299 0.00% 74 312 0.00% 75 431 0.00% 76 455 0.00% 77 481 0.00% 78 572 0.00% 79 658 0.00% 80 749 0.00% 81 825 0.00% 82 979 0.01% 83 1146 0.01% 84 1233 0.01% 85 1429 0.01% 86 1683 0.01% 87 1846 0.01% 88 2112 0.01% 89 2403 0.01% 90 2795 0.02% 91 3105 0.02% 92 3577 0.02% 93 4130 0.02% 94 4673 0.03% 95 5309 0.03% 96 5969 0.03% 97 6779 0.04% 98 7711 0.04% 99 8615 0.05% 100 9698 0.06% 101 10524 0.06% 102 11909 0.07% 103 13552 0.08% 104 14856 0.09% 105 16305 0.09% 106 18667 0.11% 107 20252 0.12% 108 22148 0.13% 109 24462 0.14% 110 26402 0.15% 111 28236 0.16% 112 31058 0.18% 113 33398 0.19% 114 36359 0.21% 115 39991 0.23% 116 42568 0.24% 117 45836 0.26% 118 48689 0.28% 119 51137 0.29% 120 54489 0.31% 121 57740 0.33% 122 61310 0.35% 123 65357 0.38% 124 69498 0.40% 125 75716 0.43% 126 16419686 94.24% 17422471 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=11 prefix-density=0.45 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=17.71 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.8 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=6.02 fanout-score-rank=2 prefix-density=0.57 prefix-fanout=4.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=34 fanout-score=7.10 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.5 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAA SRR7692620 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:34:09 Started mapping on | Dec 09 15:34:10 Finished on | Dec 09 15:38:34 Mapping speed, Million of reads per hour | 237.58 Number of input reads | 17422471 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 16956836 Uniquely mapped reads % | 97.33% Average mapped length | 250.14 Number of splices: Total | 14754811 Number of splices: Annotated (sjdb) | 14028555 Number of splices: GT/AG | 14552106 Number of splices: GC/AG | 178725 Number of splices: AT/AC | 5966 Number of splices: Non-canonical | 18014 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190331 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 10386 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.22% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 275304 275304 275304 N_multimapping 190331 190331 190331 N_noFeature 543542 16540352 644289 N_ambiguous 363679 1702 48592 UnstrandedReadsAssigned:16049615 PositiveStrandReadsAssigned:414782 NegativeStrandReadsAssigned:16263955 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692620 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692620-trimmed-pair1.fastq SRR7692620-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,422,471 reads, 16,404,138 reads pseudoaligned [quant] estimated average fragment length: 168.014 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR7692620.ke.tsv 35125 SRR7692620.se.tsv 88098 total ==> SRR7692620.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.128 5.68895e-08 6.66986e-09 PNS24247 1044 876.986 28.1165 2.89102 PNS24249 1928 1760.99 89.4707 4.58151 PNS24246 1044 876.986 28.1165 2.89102 PNS24248 1044 876.986 28.1165 2.89102 PNS24244 1471 1303.99 46.1799 3.19347 PNS24243 293 127.722 0 0 KQK14069 1603 1435.99 5433.53 341.205 KQK14071 474 308.225 167.849 49.1059 ==> SRR7692620.se.tsv <== BRADI_1g14170v3 5874 BRADI_1g53295v3 101 BRADI_1g59795v3 297 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 224 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 318 BRADI_1g48960v3 0 SRR7692620 completed mapping pipeline successfully