Starting /dee2/code/volunteer_pipeline.sh SRR7692621 current disk space = 1523767439360 free memory = 1605529088 SRR7692621 SRAfilesize d518bce8720d55575f207d11c69c1d76 SRR7692621.sra SRR7692621.sra file validated SRR7692621 is paired end SRR7692621 is conventional basespace SRR7692621 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692621_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.25925 32.0 25.0 33.0 18.0 33.0 2 28.33475 29.0 27.0 33.0 18.0 33.0 3 30.94675 33.0 30.0 33.0 27.0 33.0 4 32.2015 33.0 33.0 33.0 30.0 33.0 5 32.423 33.0 33.0 33.0 32.0 34.0 6 36.30275 38.0 36.0 38.0 33.0 38.0 7 36.53975 38.0 37.0 38.0 34.0 38.0 8 36.6695 38.0 38.0 38.0 34.0 38.0 9 37.1195 38.0 38.0 38.0 36.0 38.0 10-11 37.25125 38.0 38.0 38.0 36.0 38.0 12-13 37.383250000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.300125 38.0 38.0 38.0 36.5 38.0 16-17 37.266125 38.0 38.0 38.0 37.0 38.0 18-19 37.296625 38.0 38.0 38.0 37.0 38.0 20-21 37.301125 38.0 38.0 38.0 37.0 38.0 22-23 37.371375 38.0 38.0 38.0 37.0 38.0 24-25 37.432375 38.0 38.0 38.0 37.0 38.0 26-27 37.329125000000005 38.0 38.0 38.0 37.0 38.0 28-29 37.398250000000004 38.0 38.0 38.0 37.0 38.0 30-31 37.437875000000005 38.0 38.0 38.0 37.0 38.0 32-33 37.397125 38.0 38.0 38.0 37.0 38.0 34-35 37.16075 38.0 38.0 38.0 37.0 38.0 36-37 37.368875 38.0 38.0 38.0 37.0 38.0 38-39 37.342875 38.0 38.0 38.0 37.0 38.0 40-41 37.348124999999996 38.0 38.0 38.0 37.0 38.0 42-43 37.25675 38.0 38.0 38.0 37.0 38.0 44-45 37.416 38.0 38.0 38.0 37.0 38.0 46-47 37.333 38.0 38.0 38.0 37.0 38.0 48-49 37.170875 38.0 38.0 38.0 37.0 38.0 50-51 37.254 38.0 38.0 38.0 37.0 38.0 52-53 37.271375 38.0 38.0 38.0 37.0 38.0 54-55 37.3125 38.0 38.0 38.0 37.0 38.0 56-57 37.25625 38.0 38.0 38.0 37.0 38.0 58-59 37.279875 38.0 38.0 38.0 37.0 38.0 60-61 37.289 38.0 38.0 38.0 37.0 38.0 62-63 37.343375 38.0 38.0 38.0 37.0 38.0 64-65 37.28375 38.0 38.0 38.0 36.5 38.0 66-67 37.268 38.0 38.0 38.0 37.0 38.0 68-69 37.264624999999995 38.0 38.0 38.0 37.0 38.0 70-71 37.28 38.0 38.0 38.0 36.5 38.0 72-73 37.258375 38.0 38.0 38.0 36.0 38.0 74-75 37.191125 38.0 38.0 38.0 36.0 38.0 76-77 37.179 38.0 38.0 38.0 36.0 38.0 78-79 37.170125 38.0 38.0 38.0 36.0 38.0 80-81 37.169875000000005 38.0 38.0 38.0 36.0 38.0 82-83 37.1295 38.0 38.0 38.0 36.0 38.0 84-85 37.149375000000006 38.0 38.0 38.0 36.0 38.0 86-87 37.13575 38.0 38.0 38.0 36.0 38.0 88-89 37.119875 38.0 38.0 38.0 36.0 38.0 90-91 36.9995 38.0 38.0 38.0 35.0 38.0 92-93 36.977000000000004 38.0 38.0 38.0 35.0 38.0 94-95 36.929125 38.0 38.0 38.0 35.0 38.0 96-97 37.043875 38.0 38.0 38.0 35.0 38.0 98-99 36.87025 38.0 38.0 38.0 35.0 38.0 100-101 36.897999999999996 38.0 38.0 38.0 35.0 38.0 102-103 36.753875 38.0 38.0 38.0 35.0 38.0 104-105 36.702749999999995 38.0 38.0 38.0 34.0 38.0 106-107 36.448499999999996 38.0 38.0 38.0 34.0 38.0 108-109 36.362750000000005 38.0 38.0 38.0 34.0 38.0 110-111 36.401375 38.0 38.0 38.0 34.0 38.0 112-113 36.488 38.0 38.0 38.0 34.0 38.0 114-115 36.424875 38.0 37.5 38.0 34.0 38.0 116-117 36.551249999999996 38.0 38.0 38.0 34.0 38.0 118-119 36.32275 38.0 37.0 38.0 33.5 38.0 120-121 36.3545 38.0 38.0 38.0 34.0 38.0 122-123 36.240375 38.0 37.0 38.0 33.5 38.0 124-125 36.3425 38.0 37.0 38.0 33.5 38.0 126 32.08325 35.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 4.0 25 5.0 26 6.0 27 12.0 28 14.0 29 25.0 30 30.0 31 44.0 32 50.0 33 81.0 34 126.0 35 198.0 36 560.0 37 2844.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.05926860025221 9.684741488020176 8.247162673392182 41.008827238335435 2 23.674999999999997 12.275 35.0 29.049999999999997 3 22.25 16.575 26.05 35.125 4 26.1 22.400000000000002 22.675 28.825 5 25.0 28.025 24.95 22.025 6 22.25 31.65 24.6 21.5 7 18.975 22.475 38.45 20.1 8 21.875 23.45 29.475 25.2 9 20.724999999999998 23.200000000000003 32.175 23.9 10-11 23.075000000000003 29.8375 23.8125 23.275000000000002 12-13 22.575 24.6625 27.037499999999998 25.724999999999998 14-15 23.0625 24.7875 27.8375 24.3125 16-17 23.474999999999998 25.087500000000002 26.4125 25.025 18-19 23.674999999999997 26.7625 25.575 23.9875 20-21 23.0625 26.525 25.912499999999998 24.5 22-23 23.25 24.825 25.95 25.974999999999998 24-25 23.150000000000002 24.7375 26.025 26.087500000000002 26-27 22.661330665332667 25.737868934467233 26.3631815907954 25.237618809404704 28-29 23.875 26.3125 24.6875 25.124999999999996 30-31 22.725 25.9875 26.0 25.2875 32-33 23.7375 26.3625 25.324999999999996 24.575 34-35 23.731155778894472 25.728643216080403 25.603015075376884 24.937185929648244 36-37 23.5625 25.1875 26.237500000000004 25.0125 38-39 23.12899586310643 26.35075843048765 26.36329447160587 24.15695123480005 40-41 23.549999999999997 26.375 25.0125 25.0625 42-43 22.975 25.687500000000004 25.4375 25.900000000000002 44-45 23.225 24.8125 26.387500000000003 25.575 46-47 23.839899937460913 26.06629143214509 25.203252032520325 24.89055659787367 48-49 24.052697616060225 26.223337515683813 25.633626097867 24.090338770388957 50-51 23.832185347526615 25.59799624295554 25.648090169067 24.921728240450847 52-53 23.882279273638073 26.449592986850345 24.320601127113335 25.347526612398248 54-55 22.796048518194322 25.672127047642867 25.922220832812304 25.609603601350507 56-57 23.474999999999998 26.25 25.1 25.174999999999997 58-59 23.71121121121121 26.526526526526528 24.81231231231231 24.94994994994995 60-61 22.625 25.7375 25.900000000000002 25.7375 62-63 23.3183295823956 26.106526631657918 25.131282820705174 25.44386096524131 64-65 23.6963861448043 25.4345379517319 25.009378516943855 25.859697386519947 66-67 23.1615807903952 25.287643821910955 25.700350175087543 25.850425212606304 68-69 23.468367091772944 25.76894223555889 25.818954738684667 24.943735933983497 70-71 23.768442110527634 25.381345336334082 25.156289072268066 25.693923480870218 72-73 23.9125 24.9875 25.412499999999998 25.687500000000004 74-75 23.9375 25.4875 25.2875 25.2875 76-77 24.0375 25.7125 24.8 25.45 78-79 23.3875 25.2875 25.637500000000003 25.687500000000004 80-81 23.9125 26.224999999999998 24.887500000000003 24.975 82-83 24.6 25.5625 24.4125 25.424999999999997 84-85 23.7625 24.9 25.387500000000003 25.95 86-87 23.1875 25.45 25.575 25.7875 88-89 24.337500000000002 24.5125 25.324999999999996 25.825 90-91 23.799999999999997 24.775 25.6 25.825 92-93 24.353044130516317 24.840605075634453 25.828228528566072 24.978122265283158 94-95 24.290536317039628 24.965620702587824 24.54056757094637 26.20327540942618 96-97 23.755938984746187 25.206301575393848 25.481370342585645 25.55638909727432 98-99 24.953119139892486 24.553069133641706 25.603200400050007 24.8906113264158 100-101 24.224999999999998 26.2625 24.637500000000003 24.875 102-103 24.075 24.4 25.8 25.724999999999998 104-105 24.4125 25.587500000000002 25.362499999999997 24.637500000000003 106-107 24.075 25.4625 24.7875 25.674999999999997 108-109 23.974999999999998 25.074999999999996 25.05 25.900000000000002 110-111 24.45 25.7 24.9875 24.8625 112-113 25.4 25.2625 24.712500000000002 24.625 114-115 24.1875 24.637500000000003 24.925 26.25 116-117 24.712500000000002 25.224999999999998 24.875 25.1875 118-119 25.275 25.337500000000002 25.224999999999998 24.1625 120-121 24.4375 25.35 24.6875 25.525 122-123 25.05 25.05 24.925 24.975 124-125 25.5375 25.5 23.9875 24.975 126 25.55 23.425 26.224999999999998 24.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 1.0 27 4.5 28 5.0 29 9.0 30 12.5 31 10.5 32 16.5 33 24.5 34 37.0 35 54.5 36 65.0 37 77.0 38 97.5 39 114.0 40 126.0 41 149.0 42 177.5 43 185.5 44 184.5 45 194.0 46 200.0 47 192.0 48 165.0 49 150.5 50 155.5 51 142.5 52 121.5 53 112.0 54 97.0 55 84.0 56 88.0 57 87.5 58 82.5 59 86.0 60 82.0 61 69.5 62 69.0 63 66.5 64 51.0 65 46.5 66 41.5 67 37.0 68 40.5 69 37.5 70 30.0 71 22.0 72 17.0 73 16.0 74 17.5 75 13.0 76 9.0 77 7.0 78 3.5 79 2.5 80 3.5 81 4.0 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.05 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.5 36-37 0.0 38-39 0.2875 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0625 48-49 0.375 50-51 0.1875 52-53 0.1875 54-55 0.0375 56-57 0.0 58-59 0.1 60-61 0.0 62-63 0.025 64-65 0.0375 66-67 0.05 68-69 0.025 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0125 96-97 0.025 98-99 0.0125 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1411972720384 98.125 2 0.7072493053801465 1.4000000000000001 3 0.1262945188178833 0.375 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTAT 15 0.0039514517 60.000004 82-83 TGCTGTT 15 0.0039514517 60.000004 54-55 >>END_MODULE SRR7692621 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692621_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66875 33.0 33.0 34.0 32.0 34.0 2 32.68525 33.0 33.0 34.0 32.0 34.0 3 32.64175 33.0 33.0 34.0 31.0 34.0 4 32.70275 33.0 33.0 34.0 32.0 34.0 5 32.6285 33.0 33.0 34.0 32.0 34.0 6 36.793 38.0 38.0 38.0 36.0 38.0 7 36.7745 38.0 38.0 38.0 35.0 38.0 8 36.67275 38.0 38.0 38.0 35.0 38.0 9 36.62575 38.0 38.0 38.0 34.0 38.0 10-11 36.758875 38.0 38.0 38.0 35.0 38.0 12-13 36.796625000000006 38.0 38.0 38.0 36.0 38.0 14-15 36.570499999999996 38.0 38.0 38.0 35.0 38.0 16-17 36.779875000000004 38.0 38.0 38.0 35.5 38.0 18-19 36.726375000000004 38.0 38.0 38.0 35.5 38.0 20-21 36.863125 38.0 38.0 38.0 36.0 38.0 22-23 36.8245 38.0 38.0 38.0 36.0 38.0 24-25 36.930375 38.0 38.0 38.0 36.0 38.0 26-27 36.8735 38.0 38.0 38.0 36.0 38.0 28-29 36.9755 38.0 38.0 38.0 36.0 38.0 30-31 37.003874999999994 38.0 38.0 38.0 36.0 38.0 32-33 36.8575 38.0 38.0 38.0 36.0 38.0 34-35 36.9055 38.0 38.0 38.0 36.0 38.0 36-37 36.949124999999995 38.0 38.0 38.0 36.0 38.0 38-39 36.982875 38.0 38.0 38.0 36.0 38.0 40-41 36.98175 38.0 38.0 38.0 36.0 38.0 42-43 37.001125 38.0 38.0 38.0 36.0 38.0 44-45 36.92375 38.0 38.0 38.0 36.0 38.0 46-47 36.888625 38.0 38.0 38.0 36.0 38.0 48-49 36.87675 38.0 38.0 38.0 36.0 38.0 50-51 36.926874999999995 38.0 38.0 38.0 36.0 38.0 52-53 36.975 38.0 38.0 38.0 36.0 38.0 54-55 36.89 38.0 38.0 38.0 36.0 38.0 56-57 36.920375 38.0 38.0 38.0 36.0 38.0 58-59 37.00075 38.0 38.0 38.0 36.0 38.0 60-61 36.973124999999996 38.0 38.0 38.0 36.0 38.0 62-63 36.827124999999995 38.0 38.0 38.0 36.0 38.0 64-65 36.9985 38.0 38.0 38.0 36.0 38.0 66-67 36.829750000000004 38.0 38.0 38.0 36.0 38.0 68-69 36.7635 38.0 38.0 38.0 35.0 38.0 70-71 36.819625 38.0 38.0 38.0 35.0 38.0 72-73 36.83475 38.0 38.0 38.0 36.0 38.0 74-75 36.76625 38.0 38.0 38.0 35.0 38.0 76-77 36.7395 38.0 38.0 38.0 35.0 38.0 78-79 36.671499999999995 38.0 38.0 38.0 35.0 38.0 80-81 36.619375000000005 38.0 38.0 38.0 34.5 38.0 82-83 36.63525 38.0 38.0 38.0 34.5 38.0 84-85 36.59925 38.0 38.0 38.0 35.0 38.0 86-87 36.69075 38.0 38.0 38.0 35.0 38.0 88-89 36.68825 38.0 38.0 38.0 34.5 38.0 90-91 36.611374999999995 38.0 38.0 38.0 35.0 38.0 92-93 36.614625000000004 38.0 38.0 38.0 34.5 38.0 94-95 36.631 38.0 38.0 38.0 34.5 38.0 96-97 36.595625 38.0 38.0 38.0 34.5 38.0 98-99 36.5375 38.0 38.0 38.0 34.0 38.0 100-101 36.44825 38.0 38.0 38.0 34.0 38.0 102-103 36.54975 38.0 38.0 38.0 34.0 38.0 104-105 36.33775 38.0 38.0 38.0 34.0 38.0 106-107 36.338125 38.0 38.0 38.0 33.5 38.0 108-109 36.134 38.0 38.0 38.0 33.5 38.0 110-111 36.08125 38.0 38.0 38.0 33.0 38.0 112-113 35.993625 38.0 37.5 38.0 32.5 38.0 114-115 36.087125 38.0 38.0 38.0 33.0 38.0 116-117 35.848375000000004 38.0 37.0 38.0 31.5 38.0 118-119 35.846125 38.0 37.0 38.0 31.0 38.0 120-121 35.978 38.0 37.0 38.0 31.5 38.0 122-123 35.603375 38.0 36.0 38.0 31.0 38.0 124-125 35.38012500000001 38.0 35.5 38.0 29.5 38.0 126 30.34525 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 7.0 18 12.0 19 6.0 20 7.0 21 5.0 22 16.0 23 11.0 24 12.0 25 9.0 26 12.0 27 20.0 28 26.0 29 41.0 30 33.0 31 52.0 32 41.0 33 79.0 34 106.0 35 192.0 36 443.0 37 2867.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.75 19.025 13.3 30.925000000000004 2 29.849999999999998 23.925 26.900000000000002 19.325 3 22.55 26.525 27.500000000000004 23.425 4 26.424999999999997 29.625 22.075 21.875 5 27.525 33.425 18.925 20.125 6 23.275000000000002 35.075 20.525 21.125 7 25.05 17.974999999999998 34.425 22.55 8 24.0 22.900000000000002 25.45 27.650000000000002 9 23.549999999999997 23.025000000000002 26.325 27.1 10-11 26.887499999999996 28.5625 20.65 23.9 12-13 25.637500000000003 24.1375 24.9875 25.2375 14-15 25.025 25.025 25.124999999999996 24.825 16-17 25.424999999999997 24.375 24.6625 25.5375 18-19 25.650000000000002 25.025 24.7875 24.5375 20-21 24.9375 25.912499999999998 24.712500000000002 24.4375 22-23 26.05 24.775 24.462500000000002 24.712500000000002 24-25 25.412499999999998 24.4375 25.474999999999998 24.675 26-27 25.7375 25.2375 24.1375 24.887500000000003 28-29 25.2625 25.324999999999996 24.3875 25.025 30-31 23.9375 25.7375 25.2875 25.0375 32-33 25.2125 25.0625 24.4 25.324999999999996 34-35 24.8625 25.8125 24.887500000000003 24.4375 36-37 24.55 25.2125 25.412499999999998 24.825 38-39 25.874999999999996 25.2875 25.0 23.8375 40-41 25.9625 24.3 24.887500000000003 24.85 42-43 24.125 26.025 24.9875 24.8625 44-45 24.2875 25.424999999999997 26.05 24.2375 46-47 26.5 24.8625 24.625 24.0125 48-49 24.7875 25.174999999999997 24.9875 25.05 50-51 25.575 25.874999999999996 24.637500000000003 23.9125 52-53 25.662499999999998 24.65 25.2875 24.4 54-55 25.2875 25.0625 25.0 24.65 56-57 24.725 25.087500000000002 25.35 24.837500000000002 58-59 24.525 25.324999999999996 24.975 25.174999999999997 60-61 25.112499999999997 25.15 25.362499999999997 24.375 62-63 25.0625 25.587500000000002 25.6125 23.7375 64-65 26.5625 25.575 24.325 23.5375 66-67 25.825 25.587500000000002 24.6 23.9875 68-69 25.974999999999998 25.087500000000002 25.374999999999996 23.5625 70-71 25.7 26.3625 23.974999999999998 23.962500000000002 72-73 25.2375 24.55 25.8125 24.4 74-75 25.9875 24.7875 25.387500000000003 23.8375 76-77 26.275 24.425 24.9125 24.3875 78-79 25.0 25.6 25.5 23.9 80-81 25.837500000000002 25.4875 25.887500000000003 22.787499999999998 82-83 25.7625 24.625 25.525 24.087500000000002 84-85 25.5375 25.074999999999996 25.900000000000002 23.4875 86-87 25.4875 26.087500000000002 25.2125 23.2125 88-89 24.5125 24.3 26.2125 24.975 90-91 25.687500000000004 25.5375 25.525 23.25 92-93 25.474999999999998 24.8 25.5375 24.1875 94-95 25.7375 25.412499999999998 24.975 23.875 96-97 25.15 25.1875 26.0 23.6625 98-99 25.6125 25.224999999999998 24.962500000000002 24.2 100-101 25.35 24.962500000000002 25.412499999999998 24.275 102-103 24.5375 25.45 26.387500000000003 23.625 104-105 25.1875 25.937500000000004 26.237500000000004 22.6375 106-107 25.837500000000002 25.275 25.35 23.5375 108-109 25.7125 24.8625 26.525 22.900000000000002 110-111 26.625 26.237500000000004 24.575 22.5625 112-113 26.0625 25.4375 24.975 23.525 114-115 25.587500000000002 25.137500000000003 25.5625 23.7125 116-117 25.8125 26.387500000000003 24.2625 23.5375 118-119 25.874999999999996 26.0125 24.7375 23.375 120-121 24.9375 26.9625 24.9125 23.1875 122-123 27.135175690884083 25.872202075778418 24.409153432537202 22.5834688008003 124-125 26.887499999999996 25.2875 25.15 22.675 126 25.15 26.125 25.75 22.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 1.0 22 0.5 23 1.5 24 1.5 25 1.5 26 3.0 27 3.0 28 3.5 29 7.0 30 9.5 31 8.5 32 15.5 33 26.0 34 28.5 35 34.5 36 51.0 37 73.0 38 91.5 39 102.5 40 129.5 41 156.0 42 164.0 43 192.5 44 200.0 45 179.5 46 173.5 47 172.5 48 161.0 49 151.5 50 145.0 51 126.0 52 117.5 53 118.5 54 104.5 55 80.5 56 69.5 57 82.5 58 95.5 59 97.5 60 99.5 61 85.5 62 73.0 63 71.0 64 68.0 65 67.5 66 57.5 67 41.5 68 36.0 69 37.5 70 33.0 71 24.5 72 21.0 73 20.0 74 20.0 75 17.0 76 10.5 77 8.0 78 7.0 79 4.5 80 2.0 81 2.0 82 2.5 83 2.0 84 1.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0375 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5534591194968553 1.0999999999999999 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519127 spots for SRR7692621.sra Written 519127 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra Read 519123 spots for SRR7692621.sra Written 519123 spots for SRR7692621.sra SRR ids: ['SRR7692621.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_61okv2k3 SRR7692621.sra spots: 10382464 blocks: [[1, 519123], [519124, 1038246], [1038247, 1557369], [1557370, 2076492], [2076493, 2595615], [2595616, 3114738], [3114739, 3633861], [3633862, 4152984], [4152985, 4672107], [4672108, 5191230], [5191231, 5710353], [5710354, 6229476], [6229477, 6748599], [6748600, 7267722], [7267723, 7786845], [7786846, 8305968], [8305969, 8825091], [8825092, 9344214], [9344215, 9863337], [9863338, 10382464]] SRR7692621 file size 3309592 SRR7692621 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692621 SRR7692621_1.fastq SRR7692621_2.fastq Input file: SRR7692621_1.fastq Paired file: SRR7692621_2.fastq trimmed: SRR7692621-trimmed-pair1.fastq, SRR7692621-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:19:34 2024 >> started Mon Dec 9 15:20:41 2024 >> done (66.810s) 10382464 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 43 ( 0.00%) empty read pairs filtered out after trimming by size control 10382418 (100.00%) read pairs available; of these: 780420 ( 7.52%) trimmed read pairs available after processing 9601998 (92.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 1 0.00% 36 3 0.00% 37 0 0.00% 38 2 0.00% 39 4 0.00% 40 3 0.00% 41 4 0.00% 42 3 0.00% 43 2 0.00% 44 4 0.00% 45 4 0.00% 46 5 0.00% 47 9 0.00% 48 13 0.00% 49 7 0.00% 50 13 0.00% 51 23 0.00% 52 28 0.00% 53 28 0.00% 54 21 0.00% 55 22 0.00% 56 35 0.00% 57 33 0.00% 58 41 0.00% 59 52 0.00% 60 68 0.00% 61 70 0.00% 62 84 0.00% 63 93 0.00% 64 96 0.00% 65 102 0.00% 66 135 0.00% 67 151 0.00% 68 171 0.00% 69 206 0.00% 70 198 0.00% 71 225 0.00% 72 268 0.00% 73 290 0.00% 74 372 0.00% 75 418 0.00% 76 459 0.00% 77 475 0.00% 78 540 0.01% 79 641 0.01% 80 738 0.01% 81 772 0.01% 82 936 0.01% 83 1127 0.01% 84 1234 0.01% 85 1441 0.01% 86 1615 0.02% 87 1831 0.02% 88 1950 0.02% 89 2182 0.02% 90 2496 0.02% 91 2867 0.03% 92 3238 0.03% 93 3655 0.04% 94 4115 0.04% 95 4708 0.05% 96 5116 0.05% 97 5671 0.05% 98 6191 0.06% 99 6717 0.06% 100 7370 0.07% 101 8274 0.08% 102 9228 0.09% 103 10297 0.10% 104 11126 0.11% 105 12250 0.12% 106 13435 0.13% 107 14652 0.14% 108 16083 0.15% 109 17768 0.17% 110 19159 0.18% 111 21207 0.20% 112 23214 0.22% 113 25316 0.24% 114 28033 0.27% 115 30890 0.30% 116 32902 0.32% 117 35300 0.34% 118 38203 0.37% 119 40074 0.39% 120 42759 0.41% 121 45266 0.44% 122 48259 0.46% 123 51542 0.50% 124 55229 0.53% 125 58556 0.56% 126 9601998 92.48% 10382418 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=5.25 fanout-score-rank=12 prefix-density=0.65 prefix-fanout=4.0 sequence=AGGTTCTCGAGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=83.61 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.5 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=24 prefix-density=0.50 prefix-fanout=2.7 sequence=CCCTCGAGAACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=95.87 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR7692621 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:35:31 Started mapping on | Dec 09 15:35:37 Finished on | Dec 09 15:41:45 Mapping speed, Million of reads per hour | 101.57 Number of input reads | 10382418 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 10068981 Uniquely mapped reads % | 96.98% Average mapped length | 249.69 Number of splices: Total | 8717557 Number of splices: Annotated (sjdb) | 8269341 Number of splices: GT/AG | 8599074 Number of splices: GC/AG | 105336 Number of splices: AT/AC | 2875 Number of splices: Non-canonical | 10272 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 130291 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 9588 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.22% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 183147 183147 183147 N_multimapping 130291 130291 130291 N_noFeature 384254 9825018 440873 N_ambiguous 220700 938 33935 UnstrandedReadsAssigned:9464027 PositiveStrandReadsAssigned:243025 NegativeStrandReadsAssigned:9594173 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692621 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692621-trimmed-pair1.fastq SRR7692621-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,382,418 reads, 9,681,092 reads pseudoaligned [quant] estimated average fragment length: 166.296 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52973 SRR7692621.ke.tsv 35125 SRR7692621.se.tsv 88098 total ==> SRR7692621.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.784 0 0 PNS24247 1044 878.704 23.5964 4.05376 PNS24249 1928 1762.7 24.0029 2.0556 PNS24246 1044 878.704 23.5964 4.05376 PNS24248 1044 878.704 23.5964 4.05376 PNS24244 1471 1305.7 19.2078 2.22069 PNS24243 293 129.547 0 0 KQK14069 1603 1437.7 887.109 93.1455 KQK14071 474 309.89 31.1035 15.1515 ==> SRR7692621.se.tsv <== BRADI_1g14170v3 1005 BRADI_1g53295v3 47 BRADI_1g59795v3 340 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 73 BRADI_1g74790v3 41 BRADI_1g09890v3 0 BRADI_1g77505v3 168 BRADI_1g48960v3 0 SRR7692621 completed mapping pipeline successfully