Starting /dee2/code/volunteer_pipeline.sh SRR7692622 current disk space = 1515192254464 free memory = 1567215104 SRR7692622 SRAfilesize 7564562502810ef06185478340307cbc SRR7692622.sra SRR7692622.sra file validated SRR7692622 is paired end SRR7692622 is conventional basespace SRR7692622 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692622_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.309 32.0 25.0 33.0 18.0 33.0 2 26.87875 29.0 25.0 31.0 18.0 33.0 3 29.67925 31.0 29.0 33.0 25.0 33.0 4 31.173 33.0 31.0 33.0 29.0 33.0 5 32.1875 33.0 32.0 33.0 32.0 33.0 6 35.7465 38.0 35.0 38.0 31.0 38.0 7 36.557 38.0 37.0 38.0 34.0 38.0 8 37.17 38.0 38.0 38.0 36.0 38.0 9 37.31175 38.0 38.0 38.0 36.0 38.0 10-11 37.422375 38.0 38.0 38.0 37.0 38.0 12-13 37.469625 38.0 38.0 38.0 37.0 38.0 14-15 37.499375 38.0 38.0 38.0 37.0 38.0 16-17 37.45725 38.0 38.0 38.0 37.0 38.0 18-19 37.505750000000006 38.0 38.0 38.0 37.0 38.0 20-21 37.419 38.0 38.0 38.0 37.0 38.0 22-23 37.501000000000005 38.0 38.0 38.0 37.0 38.0 24-25 37.51375 38.0 38.0 38.0 37.0 38.0 26-27 37.48775 38.0 38.0 38.0 37.0 38.0 28-29 37.509625 38.0 38.0 38.0 37.0 38.0 30-31 37.504875 38.0 38.0 38.0 37.0 38.0 32-33 37.52175 38.0 38.0 38.0 37.5 38.0 34-35 37.35575 38.0 38.0 38.0 37.0 38.0 36-37 37.447874999999996 38.0 38.0 38.0 37.0 38.0 38-39 37.457 38.0 38.0 38.0 37.0 38.0 40-41 37.435625 38.0 38.0 38.0 37.0 38.0 42-43 37.428625 38.0 38.0 38.0 37.0 38.0 44-45 37.444375 38.0 38.0 38.0 37.0 38.0 46-47 37.378 38.0 38.0 38.0 37.0 38.0 48-49 37.311375 38.0 38.0 38.0 37.0 38.0 50-51 37.37050000000001 38.0 38.0 38.0 37.0 38.0 52-53 37.3535 38.0 38.0 38.0 37.0 38.0 54-55 37.361875 38.0 38.0 38.0 37.0 38.0 56-57 37.3165 38.0 38.0 38.0 37.0 38.0 58-59 37.28475 38.0 38.0 38.0 37.0 38.0 60-61 37.423500000000004 38.0 38.0 38.0 37.0 38.0 62-63 37.3575 38.0 38.0 38.0 37.0 38.0 64-65 37.318749999999994 38.0 38.0 38.0 37.0 38.0 66-67 37.256 38.0 38.0 38.0 37.0 38.0 68-69 37.339875000000006 38.0 38.0 38.0 37.0 38.0 70-71 37.3245 38.0 38.0 38.0 37.0 38.0 72-73 37.264375 38.0 38.0 38.0 37.0 38.0 74-75 37.325374999999994 38.0 38.0 38.0 37.0 38.0 76-77 37.247749999999996 38.0 38.0 38.0 36.0 38.0 78-79 37.269875 38.0 38.0 38.0 36.0 38.0 80-81 37.244625 38.0 38.0 38.0 36.5 38.0 82-83 37.203500000000005 38.0 38.0 38.0 36.0 38.0 84-85 37.24525 38.0 38.0 38.0 36.0 38.0 86-87 37.226375 38.0 38.0 38.0 36.0 38.0 88-89 37.242125 38.0 38.0 38.0 36.0 38.0 90-91 37.140249999999995 38.0 38.0 38.0 36.0 38.0 92-93 37.089875000000006 38.0 38.0 38.0 36.0 38.0 94-95 37.047625 38.0 38.0 38.0 35.5 38.0 96-97 37.048 38.0 38.0 38.0 36.0 38.0 98-99 36.94775 38.0 38.0 38.0 35.0 38.0 100-101 36.977374999999995 38.0 38.0 38.0 35.0 38.0 102-103 36.877125 38.0 38.0 38.0 35.0 38.0 104-105 36.824 38.0 38.0 38.0 35.0 38.0 106-107 36.630250000000004 38.0 38.0 38.0 34.0 38.0 108-109 36.59125 38.0 38.0 38.0 34.0 38.0 110-111 36.622875 38.0 38.0 38.0 34.0 38.0 112-113 36.669375 38.0 38.0 38.0 34.0 38.0 114-115 36.569500000000005 38.0 38.0 38.0 34.0 38.0 116-117 36.594875 38.0 38.0 38.0 34.0 38.0 118-119 36.380250000000004 38.0 37.0 38.0 34.0 38.0 120-121 36.500625 38.0 38.0 38.0 34.0 38.0 122-123 36.421 38.0 37.5 38.0 34.0 38.0 124-125 36.459625 38.0 38.0 38.0 34.0 38.0 126 32.03825 35.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 7.0 26 9.0 27 11.0 28 9.0 29 14.0 30 22.0 31 30.0 32 47.0 33 69.0 34 104.0 35 169.0 36 593.0 37 2912.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.22670025188917 9.974811083123427 8.387909319899245 41.41057934508816 2 23.35 13.825000000000001 36.75 26.075 3 22.725 15.575 23.75 37.95 4 25.724999999999998 24.05 21.675 28.549999999999997 5 26.05 28.225 24.2 21.525 6 22.125 31.424999999999997 25.174999999999997 21.275 7 18.099999999999998 23.575 39.300000000000004 19.025 8 21.075 23.175 30.675 25.074999999999996 9 21.05 22.3 32.800000000000004 23.849999999999998 10-11 23.2625 30.175 23.525 23.0375 12-13 23.3875 24.3125 27.3375 24.962500000000002 14-15 23.0 25.1 26.337500000000002 25.5625 16-17 23.0625 25.525 25.9875 25.424999999999997 18-19 23.0125 25.162499999999998 26.075 25.75 20-21 23.4875 25.974999999999998 26.3125 24.224999999999998 22-23 23.7875 25.9625 25.85 24.4 24-25 23.175 25.9625 25.7125 25.15 26-27 23.63090772693173 24.85621405351338 26.269067266816705 25.243810952738183 28-29 23.325000000000003 25.587500000000002 26.3625 24.725 30-31 23.3625 25.224999999999998 25.85 25.5625 32-33 24.1625 25.15 25.95 24.7375 34-35 23.27856515740625 26.589740373761444 25.348049667628246 24.783644801204062 36-37 22.625 25.95 25.624999999999996 25.8 38-39 24.188901415507953 25.50419641738695 25.554302893649005 24.752599273456095 40-41 23.6125 25.337500000000002 25.8125 25.2375 42-43 23.9375 25.1 25.924999999999997 25.0375 44-45 22.2125 25.7375 26.150000000000002 25.900000000000002 46-47 23.17118919594848 26.5474552957359 25.75965987245217 24.52169563586345 48-49 23.365071410674016 25.570032573289904 25.51991981959409 25.544976196441993 50-51 24.593241551939926 25.56946182728411 25.46933667083855 24.367959949937422 52-53 23.66412213740458 25.616318358152924 25.165811537980225 25.55374796646227 54-55 23.6368184092046 25.50025012506253 25.0 25.86293146573287 56-57 23.15289411176397 25.90323790473809 25.890736342042754 25.053131641455185 58-59 23.61111111111111 26.664164164164166 25.175175175175173 24.54954954954955 60-61 24.075 26.3 25.7625 23.8625 62-63 23.377922240280036 25.61570196274534 25.715714464308036 25.29066133266658 64-65 23.927454659161977 27.01688555347092 23.939962476547844 25.115697310819264 66-67 23.2982982982983 25.11261261261261 24.91241241241241 26.676676676676674 68-69 23.27790973871734 24.85310663832979 26.653331666458307 25.21565195649456 70-71 23.618404601150285 25.693923480870218 25.331332833208304 25.35633908477119 72-73 23.5 25.7375 25.5 25.2625 74-75 23.875 24.9 25.624999999999996 25.6 76-77 24.2875 25.674999999999997 24.837500000000002 25.2 78-79 23.375 25.275 25.4875 25.8625 80-81 24.45 25.5125 25.587500000000002 24.45 82-83 23.974999999999998 25.2375 25.025 25.7625 84-85 23.5375 25.2375 25.5375 25.687500000000004 86-87 24.0625 25.0 25.412499999999998 25.525 88-89 23.8375 25.5 25.4875 25.174999999999997 90-91 24.1625 26.1125 24.975 24.75 92-93 23.377922240280036 25.87823477934742 25.490686335791974 25.25315664458057 94-95 23.818454613653415 25.55638909727432 26.069017254313575 24.55613903475869 96-97 24.49056132016502 25.378172271533945 25.078134766845857 25.053131641455185 98-99 24.30303787973497 24.978122265283158 25.703212901612705 25.015626953369168 100-101 24.253031628953618 24.765595699462434 25.690711338917367 25.29066133266658 102-103 24.462500000000002 24.575 25.275 25.687500000000004 104-105 24.474999999999998 25.174999999999997 25.6125 24.7375 106-107 25.35 24.325 25.2625 25.0625 108-109 23.849999999999998 24.175 25.5 26.474999999999998 110-111 23.8875 25.374999999999996 26.2875 24.45 112-113 23.8125 25.825 24.9375 25.424999999999997 114-115 24.725 25.2125 24.425 25.637500000000003 116-117 24.125 25.7625 24.962500000000002 25.15 118-119 24.625 26.2875 24.325 24.762500000000003 120-121 24.2 25.337500000000002 24.887500000000003 25.575 122-123 24.4 25.4375 25.3 24.8625 124-125 23.7125 25.5 24.837500000000002 25.95 126 24.099999999999998 25.775 24.275 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 0.5 26 2.0 27 4.0 28 4.0 29 3.0 30 8.5 31 12.0 32 12.0 33 23.5 34 36.5 35 49.0 36 58.5 37 70.0 38 86.5 39 102.0 40 139.5 41 169.5 42 183.5 43 191.0 44 199.5 45 207.0 46 215.5 47 202.0 48 176.5 49 171.5 50 148.0 51 127.0 52 122.5 53 111.0 54 94.5 55 83.0 56 80.0 57 81.0 58 74.0 59 71.5 60 74.0 61 66.5 62 59.0 63 65.0 64 60.0 65 48.0 66 42.0 67 40.5 68 38.0 69 35.5 70 30.0 71 26.0 72 25.5 73 20.0 74 13.5 75 8.5 76 7.5 77 3.5 78 3.5 79 4.0 80 2.5 81 1.5 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.3375 36-37 0.0 38-39 0.21250000000000002 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.22499999999999998 50-51 0.125 52-53 0.11249999999999999 54-55 0.05 56-57 0.0125 58-59 0.1 60-61 0.0 62-63 0.0125 64-65 0.0625 66-67 0.1 68-69 0.0125 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.025 96-97 0.0125 98-99 0.0125 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692622 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692622_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6915 33.0 33.0 34.0 32.0 34.0 2 32.734 33.0 33.0 34.0 32.0 34.0 3 32.69825 33.0 33.0 34.0 31.0 34.0 4 32.6975 33.0 33.0 34.0 32.0 34.0 5 32.73325 33.0 33.0 34.0 32.0 34.0 6 36.8935 38.0 38.0 38.0 36.0 38.0 7 36.85225 38.0 38.0 38.0 36.0 38.0 8 36.7135 38.0 38.0 38.0 35.0 38.0 9 36.56475 38.0 38.0 38.0 35.0 38.0 10-11 36.9045 38.0 38.0 38.0 35.5 38.0 12-13 36.85425 38.0 38.0 38.0 36.0 38.0 14-15 36.630875 38.0 38.0 38.0 35.0 38.0 16-17 36.791624999999996 38.0 38.0 38.0 35.0 38.0 18-19 36.767375 38.0 38.0 38.0 35.5 38.0 20-21 36.83325 38.0 38.0 38.0 35.5 38.0 22-23 36.750875 38.0 38.0 38.0 35.5 38.0 24-25 36.798375 38.0 38.0 38.0 36.0 38.0 26-27 36.811125000000004 38.0 38.0 38.0 35.5 38.0 28-29 36.929 38.0 38.0 38.0 36.0 38.0 30-31 36.958 38.0 38.0 38.0 36.0 38.0 32-33 36.90025 38.0 38.0 38.0 36.0 38.0 34-35 36.93325 38.0 38.0 38.0 36.0 38.0 36-37 36.934875000000005 38.0 38.0 38.0 36.0 38.0 38-39 36.91 38.0 38.0 38.0 36.0 38.0 40-41 36.962500000000006 38.0 38.0 38.0 36.0 38.0 42-43 36.967125 38.0 38.0 38.0 36.0 38.0 44-45 36.958749999999995 38.0 38.0 38.0 36.0 38.0 46-47 36.957750000000004 38.0 38.0 38.0 36.0 38.0 48-49 36.929375 38.0 38.0 38.0 36.0 38.0 50-51 36.9285 38.0 38.0 38.0 36.0 38.0 52-53 36.966625 38.0 38.0 38.0 36.0 38.0 54-55 36.938 38.0 38.0 38.0 36.0 38.0 56-57 36.981624999999994 38.0 38.0 38.0 36.0 38.0 58-59 36.926249999999996 38.0 38.0 38.0 36.0 38.0 60-61 36.936875 38.0 38.0 38.0 36.0 38.0 62-63 36.893874999999994 38.0 38.0 38.0 36.0 38.0 64-65 36.928 38.0 38.0 38.0 36.0 38.0 66-67 36.870125 38.0 38.0 38.0 35.5 38.0 68-69 36.897375 38.0 38.0 38.0 36.0 38.0 70-71 36.76025 38.0 38.0 38.0 35.5 38.0 72-73 36.92100000000001 38.0 38.0 38.0 36.0 38.0 74-75 36.705625 38.0 38.0 38.0 35.0 38.0 76-77 36.747625 38.0 38.0 38.0 35.5 38.0 78-79 36.718125 38.0 38.0 38.0 35.0 38.0 80-81 36.724000000000004 38.0 38.0 38.0 35.0 38.0 82-83 36.68575 38.0 38.0 38.0 35.0 38.0 84-85 36.598124999999996 38.0 38.0 38.0 35.0 38.0 86-87 36.638125 38.0 38.0 38.0 35.0 38.0 88-89 36.64725 38.0 38.0 38.0 34.5 38.0 90-91 36.560125 38.0 38.0 38.0 34.0 38.0 92-93 36.475625 38.0 38.0 38.0 34.0 38.0 94-95 36.551 38.0 38.0 38.0 34.0 38.0 96-97 36.47 38.0 38.0 38.0 34.0 38.0 98-99 36.463499999999996 38.0 38.0 38.0 34.0 38.0 100-101 36.38375 38.0 38.0 38.0 34.0 38.0 102-103 36.353 38.0 38.0 38.0 34.0 38.0 104-105 36.221374999999995 38.0 38.0 38.0 33.5 38.0 106-107 36.10875 38.0 38.0 38.0 33.0 38.0 108-109 36.0155 38.0 37.5 38.0 32.5 38.0 110-111 36.125875 38.0 38.0 38.0 33.0 38.0 112-113 36.001375 38.0 37.0 38.0 33.0 38.0 114-115 35.925749999999994 38.0 37.0 38.0 32.0 38.0 116-117 35.716375 38.0 36.0 38.0 31.0 38.0 118-119 35.854625 38.0 36.5 38.0 31.5 38.0 120-121 35.74925 38.0 37.0 38.0 31.0 38.0 122-123 35.355999999999995 38.0 35.5 38.0 29.5 38.0 124-125 35.131125 38.0 35.0 38.0 28.5 38.0 126 30.0245 33.0 24.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 6.0 17 5.0 18 12.0 19 10.0 20 16.0 21 9.0 22 2.0 23 10.0 24 14.0 25 9.0 26 10.0 27 16.0 28 27.0 29 36.0 30 23.0 31 45.0 32 55.0 33 68.0 34 130.0 35 191.0 36 480.0 37 2825.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.725 17.325 12.825000000000001 35.125 2 28.275 24.875 27.85 19.0 3 22.85 26.375 26.85 23.925 4 25.974999999999998 31.0 20.5 22.525000000000002 5 28.975 31.374999999999996 19.3 20.349999999999998 6 23.575 33.925 21.55 20.95 7 22.925 18.8 35.05 23.225 8 23.05 22.400000000000002 25.775 28.775000000000002 9 23.575 21.575 28.425 26.424999999999997 10-11 26.687499999999996 27.35 21.8875 24.075 12-13 26.6625 22.7 25.4625 25.174999999999997 14-15 24.9375 24.975 25.2625 24.825 16-17 26.2125 25.324999999999996 23.3125 25.15 18-19 25.5625 25.45 25.087500000000002 23.9 20-21 25.025 25.6125 25.587500000000002 23.775 22-23 25.137500000000003 25.074999999999996 25.124999999999996 24.6625 24-25 25.7125 25.55 24.325 24.4125 26-27 25.424999999999997 25.825 24.4375 24.3125 28-29 25.5625 25.224999999999998 24.575 24.637500000000003 30-31 24.6125 26.0375 25.5625 23.7875 32-33 25.837500000000002 26.05 24.3 23.8125 34-35 25.7625 24.962500000000002 24.45 24.825 36-37 25.7 24.575 24.962500000000002 24.762500000000003 38-39 25.624999999999996 25.624999999999996 24.775 23.974999999999998 40-41 26.025 25.174999999999997 24.65 24.15 42-43 25.275 25.2 24.887500000000003 24.637500000000003 44-45 25.162499999999998 25.7375 24.712500000000002 24.3875 46-47 25.674999999999997 24.474999999999998 25.974999999999998 23.875 48-49 25.7625 25.900000000000002 25.35 22.9875 50-51 25.0625 26.224999999999998 25.087500000000002 23.625 52-53 25.2875 25.9625 24.6125 24.1375 54-55 24.95 26.187500000000004 25.124999999999996 23.7375 56-57 24.9125 25.8125 25.2 24.075 58-59 25.825 24.8 25.087500000000002 24.2875 60-61 24.6875 25.7625 25.525 24.025 62-63 25.1 26.674999999999997 24.887500000000003 23.3375 64-65 26.174999999999997 24.675 25.3 23.849999999999998 66-67 24.725 26.0 24.625 24.65 68-69 24.587500000000002 25.9875 24.9 24.525 70-71 26.1125 24.025 25.900000000000002 23.962500000000002 72-73 24.325 25.025 26.637499999999996 24.0125 74-75 25.474999999999998 25.4625 25.8 23.2625 76-77 26.224999999999998 24.5125 24.7 24.5625 78-79 24.5 25.025 25.662499999999998 24.8125 80-81 25.3125 25.7125 25.25 23.724999999999998 82-83 26.437500000000004 24.75 24.712500000000002 24.099999999999998 84-85 25.75 24.825 24.725 24.7 86-87 25.7 25.7875 25.7125 22.8 88-89 25.837500000000002 25.2 25.5125 23.45 90-91 24.9875 25.4 25.5625 24.05 92-93 25.374999999999996 25.637500000000003 25.05 23.9375 94-95 25.724999999999998 25.337500000000002 24.875 24.0625 96-97 25.25 25.624999999999996 25.6125 23.5125 98-99 25.5375 26.487500000000004 24.725 23.25 100-101 25.55 25.174999999999997 25.1875 24.087500000000002 102-103 25.9625 25.0 26.1125 22.925 104-105 25.474999999999998 25.2125 26.05 23.2625 106-107 24.875 26.2625 25.0 23.8625 108-109 25.337500000000002 26.224999999999998 25.587500000000002 22.85 110-111 25.9625 26.4625 24.9125 22.662499999999998 112-113 25.1875 26.224999999999998 25.2375 23.35 114-115 26.075 26.474999999999998 24.9 22.55 116-117 25.337500000000002 26.0375 25.5125 23.1125 118-119 25.7 26.8375 25.2375 22.225 120-121 25.9625 26.0625 25.124999999999996 22.85 122-123 26.91345672836418 25.87543771885943 24.299649824912457 22.911455727863935 124-125 26.737499999999997 26.7625 23.962500000000002 22.537499999999998 126 25.4 26.125 25.724999999999998 22.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 2.0 24 2.0 25 0.5 26 1.5 27 2.5 28 7.5 29 10.5 30 7.5 31 10.0 32 16.0 33 16.5 34 27.0 35 42.0 36 53.0 37 66.0 38 82.5 39 113.0 40 129.5 41 137.5 42 165.0 43 191.0 44 191.0 45 186.5 46 196.5 47 182.0 48 155.0 49 153.0 50 149.0 51 141.0 52 131.5 53 116.5 54 103.0 55 102.0 56 100.5 57 87.5 58 80.0 59 73.0 60 79.5 61 85.0 62 71.0 63 61.5 64 61.0 65 54.0 66 50.5 67 51.0 68 45.0 69 35.5 70 33.5 71 29.5 72 22.0 73 18.5 74 13.0 75 12.5 76 11.5 77 8.5 78 6.5 79 5.0 80 3.5 81 1.0 82 0.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.05 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19232710752145 98.25 2 0.7319535588086825 1.4500000000000002 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025239777889954566 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.9249999999999998 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAGT 15 0.0039514517 60.000004 94-95 >>END_MODULE Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra Read 425531 spots for SRR7692622.sra Written 425531 spots for SRR7692622.sra SRR ids: ['SRR7692622.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h1y9_zt2 SRR7692622.sra spots: 8510620 blocks: [[1, 425531], [425532, 851062], [851063, 1276593], [1276594, 1702124], [1702125, 2127655], [2127656, 2553186], [2553187, 2978717], [2978718, 3404248], [3404249, 3829779], [3829780, 4255310], [4255311, 4680841], [4680842, 5106372], [5106373, 5531903], [5531904, 5957434], [5957435, 6382965], [6382966, 6808496], [6808497, 7234027], [7234028, 7659558], [7659559, 8085089], [8085090, 8510620]] SRR7692622 file size 2712402 SRR7692622 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692622 SRR7692622_1.fastq SRR7692622_2.fastq Input file: SRR7692622_1.fastq Paired file: SRR7692622_2.fastq trimmed: SRR7692622-trimmed-pair1.fastq, SRR7692622-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:15:03 2024 >> started Thu Dec 12 03:15:12 2024 >> done (8.204s) 8510620 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 34 ( 0.00%) empty read pairs filtered out after trimming by size control 8510585 (100.00%) read pairs available; of these: 689600 ( 8.10%) trimmed read pairs available after processing 7820985 (91.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 2 0.00% 36 2 0.00% 37 7 0.00% 38 4 0.00% 39 6 0.00% 40 4 0.00% 41 6 0.00% 42 3 0.00% 43 5 0.00% 44 4 0.00% 45 6 0.00% 46 6 0.00% 47 9 0.00% 48 11 0.00% 49 12 0.00% 50 16 0.00% 51 18 0.00% 52 20 0.00% 53 25 0.00% 54 16 0.00% 55 29 0.00% 56 28 0.00% 57 29 0.00% 58 39 0.00% 59 47 0.00% 60 58 0.00% 61 71 0.00% 62 77 0.00% 63 102 0.00% 64 111 0.00% 65 124 0.00% 66 113 0.00% 67 120 0.00% 68 142 0.00% 69 193 0.00% 70 198 0.00% 71 204 0.00% 72 241 0.00% 73 290 0.00% 74 330 0.00% 75 415 0.00% 76 447 0.01% 77 528 0.01% 78 589 0.01% 79 599 0.01% 80 675 0.01% 81 789 0.01% 82 947 0.01% 83 1132 0.01% 84 1220 0.01% 85 1407 0.02% 86 1552 0.02% 87 1777 0.02% 88 1925 0.02% 89 2083 0.02% 90 2470 0.03% 91 2697 0.03% 92 3085 0.04% 93 3544 0.04% 94 3907 0.05% 95 4439 0.05% 96 4838 0.06% 97 5402 0.06% 98 5842 0.07% 99 6344 0.07% 100 6874 0.08% 101 7554 0.09% 102 8286 0.10% 103 9376 0.11% 104 10267 0.12% 105 11152 0.13% 106 12177 0.14% 107 13090 0.15% 108 14661 0.17% 109 15480 0.18% 110 17334 0.20% 111 18675 0.22% 112 20642 0.24% 113 22410 0.26% 114 24119 0.28% 115 27236 0.32% 116 28779 0.34% 117 31095 0.37% 118 33603 0.39% 119 35202 0.41% 120 37383 0.44% 121 39625 0.47% 122 41555 0.49% 123 44432 0.52% 124 47004 0.55% 125 50202 0.59% 126 7820985 91.90% 8510585 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=18 prefix-density=0.54 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=82.48 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.1 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=2.3 sequence=CCTAAGCAAGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=82.50 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.7 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR7692622 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:15:51 Started mapping on | Dec 12 03:15:51 Finished on | Dec 12 03:16:24 Mapping speed, Million of reads per hour | 928.43 Number of input reads | 8510585 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 8270217 Uniquely mapped reads % | 97.18% Average mapped length | 249.54 Number of splices: Total | 7465062 Number of splices: Annotated (sjdb) | 7090879 Number of splices: GT/AG | 7364240 Number of splices: GC/AG | 89749 Number of splices: AT/AC | 2847 Number of splices: Non-canonical | 8226 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 99322 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 7814 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.11% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 141046 141046 141046 N_multimapping 99322 99322 99322 N_noFeature 318974 8077681 367335 N_ambiguous 170687 861 26650 UnstrandedReadsAssigned:7780556 PositiveStrandReadsAssigned:191675 NegativeStrandReadsAssigned:7876232 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692622 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692622-trimmed-pair1.fastq SRR7692622-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,510,585 reads, 7,943,128 reads pseudoaligned [quant] estimated average fragment length: 165.827 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52973 SRR7692622.ke.tsv 35125 SRR7692622.se.tsv 88098 total ==> SRR7692622.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.354 0 0 PNS24247 1044 879.173 11.5556 2.49165 PNS24249 1928 1763.17 42.5243 4.57205 PNS24246 1044 879.173 11.5556 2.49165 PNS24248 1044 879.173 11.5556 2.49165 PNS24244 1471 1306.17 15.809 2.29441 PNS24243 293 129.943 0 0 KQK14069 1603 1438.17 314.692 41.4804 KQK14071 474 310.238 14.6751 8.96715 ==> SRR7692622.se.tsv <== BRADI_1g14170v3 363 BRADI_1g53295v3 38 BRADI_1g59795v3 197 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 57 BRADI_1g74790v3 79 BRADI_1g09890v3 0 BRADI_1g77505v3 122 BRADI_1g48960v3 0 SRR7692622 completed mapping pipeline successfully