Starting /dee2/code/volunteer_pipeline.sh SRR7692623 current disk space = 1523367976960 free memory = 1580544796 SRR7692623 SRAfilesize 7925f4f7c7e982231ece9be66a3db419 SRR7692623.sra SRR7692623.sra file validated SRR7692623 is paired end SRR7692623 is conventional basespace SRR7692623 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692623_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75125 33.0 33.0 34.0 32.0 34.0 2 32.78 33.0 33.0 34.0 32.0 34.0 3 32.82625 33.0 33.0 34.0 32.0 34.0 4 32.763 33.0 33.0 34.0 32.0 34.0 5 32.87575 33.0 33.0 34.0 32.0 34.0 6 37.04175 38.0 38.0 38.0 36.0 38.0 7 36.8935 38.0 38.0 38.0 36.0 38.0 8 36.881 38.0 38.0 38.0 36.0 38.0 9 36.83725 38.0 38.0 38.0 35.0 38.0 10-11 36.9815 38.0 38.0 38.0 36.0 38.0 12-13 36.971875 38.0 38.0 38.0 36.0 38.0 14-15 36.812375 38.0 38.0 38.0 35.5 38.0 16-17 36.902875 38.0 38.0 38.0 36.0 38.0 18-19 36.847875 38.0 38.0 38.0 36.0 38.0 20-21 36.876875 38.0 38.0 38.0 36.0 38.0 22-23 36.901375 38.0 38.0 38.0 36.0 38.0 24-25 36.940375 38.0 38.0 38.0 36.0 38.0 26-27 36.926625 38.0 38.0 38.0 36.0 38.0 28-29 36.97175 38.0 38.0 38.0 36.0 38.0 30-31 37.006249999999994 38.0 38.0 38.0 36.0 38.0 32-33 36.996625 38.0 38.0 38.0 36.0 38.0 34-35 37.0205 38.0 38.0 38.0 36.0 38.0 36-37 37.023125 38.0 38.0 38.0 36.0 38.0 38-39 37.080749999999995 38.0 38.0 38.0 36.0 38.0 40-41 37.104875 38.0 38.0 38.0 37.0 38.0 42-43 37.118625 38.0 38.0 38.0 36.5 38.0 44-45 37.058125000000004 38.0 38.0 38.0 36.0 38.0 46-47 37.06375 38.0 38.0 38.0 36.0 38.0 48-49 37.03475 38.0 38.0 38.0 36.0 38.0 50-51 37.047625 38.0 38.0 38.0 36.0 38.0 52-53 37.111125 38.0 38.0 38.0 36.5 38.0 54-55 37.094375 38.0 38.0 38.0 36.5 38.0 56-57 37.0505 38.0 38.0 38.0 36.0 38.0 58-59 37.067750000000004 38.0 38.0 38.0 36.0 38.0 60-61 37.0895 38.0 38.0 38.0 36.0 38.0 62-63 37.058375 38.0 38.0 38.0 36.0 38.0 64-65 37.068875000000006 38.0 38.0 38.0 36.0 38.0 66-67 37.007374999999996 38.0 38.0 38.0 35.5 38.0 68-69 36.97875 38.0 38.0 38.0 36.0 38.0 70-71 36.982625 38.0 38.0 38.0 36.0 38.0 72-73 37.021874999999994 38.0 38.0 38.0 36.0 38.0 74-75 36.984375 38.0 38.0 38.0 36.0 38.0 76-77 36.908625 38.0 38.0 38.0 35.5 38.0 78-79 36.945125000000004 38.0 38.0 38.0 35.5 38.0 80-81 36.87975 38.0 38.0 38.0 35.5 38.0 82-83 36.946124999999995 38.0 38.0 38.0 35.5 38.0 84-85 36.782 38.0 38.0 38.0 35.0 38.0 86-87 36.814499999999995 38.0 38.0 38.0 35.0 38.0 88-89 36.7415 38.0 38.0 38.0 35.0 38.0 90-91 36.830625 38.0 38.0 38.0 35.0 38.0 92-93 36.759 38.0 38.0 38.0 35.0 38.0 94-95 36.7475 38.0 38.0 38.0 35.0 38.0 96-97 36.788125 38.0 38.0 38.0 35.0 38.0 98-99 36.60125 38.0 38.0 38.0 34.0 38.0 100-101 36.58525 38.0 38.0 38.0 34.0 38.0 102-103 36.519375 38.0 38.0 38.0 34.0 38.0 104-105 36.5055 38.0 38.0 38.0 34.0 38.0 106-107 36.4415 38.0 38.0 38.0 34.0 38.0 108-109 36.417874999999995 38.0 38.0 38.0 34.0 38.0 110-111 36.440375 38.0 38.0 38.0 34.0 38.0 112-113 36.187125 38.0 38.0 38.0 33.5 38.0 114-115 36.163 38.0 37.0 38.0 33.0 38.0 116-117 35.9295 38.0 37.0 38.0 32.5 38.0 118-119 36.0865 38.0 37.5 38.0 32.5 38.0 120-121 35.9965 38.0 37.5 38.0 32.0 38.0 122-123 35.601375000000004 38.0 36.0 38.0 31.0 38.0 124-125 35.376374999999996 38.0 36.0 38.0 30.0 38.0 126 30.38525 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 4.0 18 10.0 19 8.0 20 7.0 21 5.0 22 8.0 23 10.0 24 3.0 25 6.0 26 11.0 27 14.0 28 21.0 29 16.0 30 40.0 31 48.0 32 49.0 33 76.0 34 101.0 35 200.0 36 445.0 37 2913.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.525 17.775 11.725 37.974999999999994 2 29.675 23.45 27.625 19.25 3 22.925 25.85 25.6 25.624999999999996 4 26.775 29.349999999999998 19.5 24.375 5 26.650000000000002 33.225 18.925 21.2 6 24.224999999999998 34.2 19.975 21.6 7 22.525000000000002 19.85 32.0 25.624999999999996 8 23.0 22.175 25.25 29.575000000000003 9 24.25 21.625 27.450000000000003 26.674999999999997 10-11 25.587500000000002 27.900000000000002 21.475 25.0375 12-13 26.3 22.912499999999998 23.9375 26.85 14-15 25.912499999999998 25.3 23.7625 25.025 16-17 26.337500000000002 24.25 23.9375 25.474999999999998 18-19 26.25 24.349999999999998 24.3625 25.0375 20-21 25.4875 25.650000000000002 24.4 24.462500000000002 22-23 26.5875 24.25 22.9625 26.200000000000003 24-25 26.05 25.4 24.275 24.275 26-27 25.9875 24.625 23.6625 25.724999999999998 28-29 25.5125 24.9 24.075 25.5125 30-31 25.575 24.7 24.7375 24.9875 32-33 26.224999999999998 25.662499999999998 23.474999999999998 24.637500000000003 34-35 27.474999999999998 24.6625 23.474999999999998 24.3875 36-37 26.55 25.137500000000003 23.1875 25.124999999999996 38-39 25.912499999999998 25.974999999999998 23.75 24.3625 40-41 25.7875 24.55 23.275000000000002 26.387500000000003 42-43 25.900000000000002 24.65 24.224999999999998 25.224999999999998 44-45 25.974999999999998 24.9375 24.125 24.962500000000002 46-47 25.2625 25.5375 23.3375 25.8625 48-49 26.224999999999998 25.587500000000002 23.6625 24.525 50-51 25.6125 24.6125 24.2875 25.4875 52-53 25.837500000000002 24.712500000000002 24.2375 25.2125 54-55 25.112499999999997 25.2125 24.425 25.25 56-57 25.662499999999998 25.0375 24.349999999999998 24.95 58-59 26.0 24.925 23.9125 25.162499999999998 60-61 25.412499999999998 25.112499999999997 24.725 24.75 62-63 25.75 25.2 24.275 24.775 64-65 26.525 24.5375 23.7375 25.2 66-67 25.087500000000002 25.6 24.212500000000002 25.1 68-69 26.0375 24.637500000000003 25.1875 24.1375 70-71 25.95 24.625 25.1 24.325 72-73 25.650000000000002 24.6125 24.9125 24.825 74-75 25.650000000000002 25.424999999999997 24.6625 24.2625 76-77 25.0375 25.124999999999996 24.425 25.412499999999998 78-79 25.912499999999998 24.8625 25.2375 23.9875 80-81 26.75 24.45 23.8125 24.9875 82-83 26.2125 24.925 24.5375 24.325 84-85 26.237500000000004 24.2625 24.637500000000003 24.8625 86-87 25.25 24.762500000000003 25.5 24.4875 88-89 26.724999999999998 25.224999999999998 24.175 23.875 90-91 25.7125 25.0 24.587500000000002 24.7 92-93 26.1625 25.2 24.625 24.0125 94-95 26.900000000000002 25.624999999999996 23.5 23.974999999999998 96-97 26.400000000000002 24.1125 25.5625 23.925 98-99 26.437500000000004 24.825 24.15 24.587500000000002 100-101 26.55 24.0125 24.5125 24.925 102-103 25.1875 25.1 25.575 24.1375 104-105 25.8625 25.087500000000002 24.712500000000002 24.337500000000002 106-107 26.525 24.8625 24.2375 24.375 108-109 25.025 25.3125 25.662499999999998 24.0 110-111 26.450000000000003 25.424999999999997 24.3 23.825 112-113 26.8625 25.4625 24.1125 23.5625 114-115 25.5625 25.387500000000003 24.4375 24.6125 116-117 26.424999999999997 26.087500000000002 23.375 24.1125 118-119 26.8375 25.412499999999998 23.724999999999998 24.025 120-121 26.974999999999998 25.374999999999996 23.7625 23.8875 122-123 26.069552164123095 26.432324243182386 23.642732049036777 23.855391543657746 124-125 27.0625 24.7375 24.3875 23.8125 126 25.85 27.500000000000004 23.625 23.025000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 2.0 23 0.5 24 0.5 25 1.0 26 2.0 27 2.5 28 5.0 29 6.0 30 6.5 31 12.0 32 16.0 33 19.5 34 21.5 35 27.0 36 42.5 37 60.0 38 70.5 39 85.5 40 114.0 41 132.5 42 153.0 43 166.5 44 173.0 45 177.5 46 186.5 47 183.0 48 159.5 49 153.0 50 141.0 51 126.5 52 120.5 53 116.5 54 98.5 55 94.5 56 98.0 57 95.0 58 98.0 59 83.5 60 87.5 61 97.0 62 87.0 63 75.0 64 77.0 65 66.0 66 48.0 67 57.0 68 59.5 69 56.0 70 52.0 71 42.0 72 29.0 73 27.5 74 26.0 75 17.0 76 17.5 77 13.5 78 5.5 79 3.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.075 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692623 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692623_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3115 32.0 25.0 33.0 18.0 33.0 2 27.13175 29.0 25.0 31.0 18.0 33.0 3 29.7695 31.0 29.0 33.0 25.0 33.0 4 31.21675 33.0 31.0 33.0 29.0 33.0 5 32.2645 33.0 32.0 33.0 32.0 33.0 6 35.61 38.0 35.0 38.0 31.0 38.0 7 36.49075 38.0 37.0 38.0 34.0 38.0 8 37.0605 38.0 38.0 38.0 36.0 38.0 9 37.282 38.0 38.0 38.0 36.0 38.0 10-11 37.33425 38.0 38.0 38.0 36.5 38.0 12-13 37.4765 38.0 38.0 38.0 37.0 38.0 14-15 37.422 38.0 38.0 38.0 37.0 38.0 16-17 37.44862500000001 38.0 38.0 38.0 37.0 38.0 18-19 37.476124999999996 38.0 38.0 38.0 37.0 38.0 20-21 37.462 38.0 38.0 38.0 37.0 38.0 22-23 37.445125 38.0 38.0 38.0 37.0 38.0 24-25 37.562125 38.0 38.0 38.0 38.0 38.0 26-27 37.49025 38.0 38.0 38.0 37.0 38.0 28-29 37.487625 38.0 38.0 38.0 37.5 38.0 30-31 37.548 38.0 38.0 38.0 38.0 38.0 32-33 37.488875 38.0 38.0 38.0 37.0 38.0 34-35 37.3435 38.0 38.0 38.0 37.0 38.0 36-37 37.4105 38.0 38.0 38.0 37.0 38.0 38-39 37.454 38.0 38.0 38.0 37.0 38.0 40-41 37.465125 38.0 38.0 38.0 37.0 38.0 42-43 37.368750000000006 38.0 38.0 38.0 37.0 38.0 44-45 37.45 38.0 38.0 38.0 37.0 38.0 46-47 37.357625 38.0 38.0 38.0 37.0 38.0 48-49 37.419250000000005 38.0 38.0 38.0 37.0 38.0 50-51 37.3605 38.0 38.0 38.0 37.0 38.0 52-53 37.382125 38.0 38.0 38.0 37.0 38.0 54-55 37.38175 38.0 38.0 38.0 37.0 38.0 56-57 37.29775 38.0 38.0 38.0 37.0 38.0 58-59 37.314875 38.0 38.0 38.0 37.0 38.0 60-61 37.3425 38.0 38.0 38.0 37.0 38.0 62-63 37.315625 38.0 38.0 38.0 37.0 38.0 64-65 37.357 38.0 38.0 38.0 37.0 38.0 66-67 37.286 38.0 38.0 38.0 37.0 38.0 68-69 37.282875000000004 38.0 38.0 38.0 36.5 38.0 70-71 37.21275 38.0 38.0 38.0 36.5 38.0 72-73 37.208875 38.0 38.0 38.0 36.0 38.0 74-75 37.134 38.0 38.0 38.0 36.0 38.0 76-77 37.187125 38.0 38.0 38.0 36.0 38.0 78-79 37.223625 38.0 38.0 38.0 36.0 38.0 80-81 37.169875000000005 38.0 38.0 38.0 36.0 38.0 82-83 37.163375 38.0 38.0 38.0 36.0 38.0 84-85 37.16275 38.0 38.0 38.0 36.0 38.0 86-87 37.104 38.0 38.0 38.0 36.0 38.0 88-89 37.08125 38.0 38.0 38.0 36.0 38.0 90-91 37.028625 38.0 38.0 38.0 35.5 38.0 92-93 36.93475 38.0 38.0 38.0 35.0 38.0 94-95 36.895250000000004 38.0 38.0 38.0 35.0 38.0 96-97 36.929500000000004 38.0 38.0 38.0 35.0 38.0 98-99 36.801125 38.0 38.0 38.0 35.0 38.0 100-101 36.83775 38.0 38.0 38.0 35.0 38.0 102-103 36.73325 38.0 38.0 38.0 34.5 38.0 104-105 36.604625 38.0 38.0 38.0 34.0 38.0 106-107 36.520624999999995 38.0 38.0 38.0 34.0 38.0 108-109 36.51075 38.0 38.0 38.0 34.0 38.0 110-111 36.408625 38.0 38.0 38.0 34.0 38.0 112-113 36.607625 38.0 38.0 38.0 34.0 38.0 114-115 36.431375 38.0 38.0 38.0 34.0 38.0 116-117 36.438625 38.0 38.0 38.0 34.0 38.0 118-119 36.18675 38.0 37.0 38.0 33.0 38.0 120-121 36.38875 38.0 38.0 38.0 34.0 38.0 122-123 36.28675 38.0 37.5 38.0 33.5 38.0 124-125 36.233999999999995 38.0 37.5 38.0 33.5 38.0 126 32.06775 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 2.0 23 1.0 24 1.0 25 4.0 26 9.0 27 9.0 28 13.0 29 21.0 30 33.0 31 33.0 32 33.0 33 85.0 34 83.0 35 231.0 36 609.0 37 2830.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5676965586536 9.570459683496608 7.81210751067571 42.049736247174074 2 24.175 12.5 35.275 28.050000000000004 3 20.625 15.85 24.175 39.35 4 25.6 22.15 22.225 30.025000000000002 5 26.650000000000002 27.925 22.400000000000002 23.025000000000002 6 23.325000000000003 30.925000000000004 23.05 22.7 7 19.975 23.3 36.7 20.025000000000002 8 20.974999999999998 23.35 30.225 25.45 9 20.549999999999997 21.6 33.15 24.7 10-11 24.762500000000003 28.375 22.725 24.1375 12-13 23.400000000000002 23.1 26.700000000000003 26.8 14-15 23.7625 24.9125 26.05 25.275 16-17 24.587500000000002 24.725 25.650000000000002 25.0375 18-19 24.15 25.0125 25.35 25.4875 20-21 24.25 24.337500000000002 26.2875 25.124999999999996 22-23 24.275 24.875 25.7875 25.0625 24-25 23.4875 24.75 25.25 26.5125 26-27 23.7625 25.124999999999996 24.7375 26.375 28-29 23.674999999999997 25.074999999999996 25.412499999999998 25.837500000000002 30-31 23.8375 25.2 25.4875 25.474999999999998 32-33 23.2625 24.65 26.4625 25.624999999999996 34-35 24.3175557225144 25.0313047833709 25.156523916854496 25.494615577260205 36-37 23.5875 24.887500000000003 24.9125 26.6125 38-39 23.39466766804356 24.746526473901614 25.284766554011767 26.57403930404306 40-41 24.0625 25.45 25.275 25.2125 42-43 23.25 24.15 25.1875 27.4125 44-45 23.549999999999997 25.2875 25.575 25.587500000000002 46-47 23.40292536567071 25.240655081885237 25.428178522315285 25.928241030128767 48-49 24.234087782918596 24.284106539952482 25.497061398024258 25.984744279104667 50-51 23.905976494123532 24.88122030507627 25.70642660665166 25.506376594148538 52-53 23.502937867233403 25.19064883110389 24.278034754344294 27.028378547318415 54-55 23.329997498123593 25.03127345509132 25.193895421566175 26.444833625218916 56-57 24.168542135533883 24.643660915228807 25.206301575393848 25.98149537384346 58-59 23.76126126126126 24.8998998998999 25.625625625625624 25.713213213213216 60-61 24.1125 24.4 25.3 26.187500000000004 62-63 24.046517444041516 24.58421908215581 25.109416031011627 26.259847442791045 64-65 24.69984992496248 24.149574787393696 24.54977488744372 26.600800400200097 66-67 24.230673004753562 24.768576432324245 24.91868901676257 26.08206154615962 68-69 23.94647992997374 23.95898461923221 26.522445917218956 25.57208953357509 70-71 24.66541588492808 24.027517198248905 25.240775484677926 26.06629143214509 72-73 24.825 24.65 24.25 26.275 74-75 24.337500000000002 24.45 24.762500000000003 26.450000000000003 76-77 24.5375 24.125 25.224999999999998 26.1125 78-79 24.9125 24.7875 23.962500000000002 26.337500000000002 80-81 23.8625 24.9375 25.35 25.85 82-83 24.712500000000002 24.5125 25.174999999999997 25.6 84-85 24.875 25.337500000000002 24.224999999999998 25.5625 86-87 23.95 24.15 25.337500000000002 26.5625 88-89 24.9375 24.4125 24.7875 25.8625 90-91 24.9875 25.5125 24.6125 24.887500000000003 92-93 24.821808178066775 25.472052019507313 24.409153432537202 25.296986369888707 94-95 25.515947467166978 24.47779862414009 24.190118824265166 25.816135084427767 96-97 24.58421908215581 24.134050268850817 25.32199574840565 25.959734900587723 98-99 24.721770663999 23.6963861448043 25.159434788045516 26.42240840315118 100-101 24.815601950243778 24.0780097512189 24.94061757719715 26.16577072134017 102-103 25.2625 24.5375 24.75 25.45 104-105 24.8125 24.65 25.5125 25.025 106-107 25.124999999999996 24.2625 25.0375 25.575 108-109 25.0375 24.7875 23.9375 26.237500000000004 110-111 23.3125 24.675 26.150000000000002 25.8625 112-113 24.95 24.0125 24.887500000000003 26.150000000000002 114-115 26.424999999999997 24.1375 23.5375 25.900000000000002 116-117 23.8625 25.2375 25.387500000000003 25.5125 118-119 25.2 24.525 24.075 26.200000000000003 120-121 24.5625 24.275 24.4125 26.75 122-123 24.825 24.6625 24.6875 25.825 124-125 25.5375 24.575 24.474999999999998 25.412499999999998 126 26.200000000000003 23.724999999999998 24.75 25.324999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 3.0 29 6.5 30 8.5 31 12.0 32 16.5 33 16.5 34 23.0 35 36.0 36 45.0 37 60.5 38 79.5 39 99.0 40 116.5 41 129.5 42 148.5 43 175.5 44 198.0 45 207.5 46 195.5 47 187.5 48 181.0 49 149.0 50 150.0 51 152.0 52 121.0 53 100.0 54 91.5 55 94.0 56 83.0 57 81.0 58 89.5 59 83.0 60 80.5 61 83.0 62 73.5 63 68.0 64 76.0 65 72.0 66 63.5 67 53.5 68 48.0 69 44.0 70 40.0 71 31.5 72 29.0 73 27.5 74 17.5 75 15.5 76 10.5 77 10.5 78 8.5 79 3.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.17500000000000002 36-37 0.0 38-39 0.13749999999999998 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0375 50-51 0.025 52-53 0.0125 54-55 0.075 56-57 0.025 58-59 0.1 60-61 0.0 62-63 0.0375 64-65 0.05 66-67 0.075 68-69 0.0375 70-71 0.0625 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0375 94-95 0.0625 96-97 0.0375 98-99 0.0375 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293487 spots for SRR7692623.sra Written 293487 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra Read 293485 spots for SRR7692623.sra Written 293485 spots for SRR7692623.sra SRR ids: ['SRR7692623.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t7fedgbl SRR7692623.sra spots: 5869702 blocks: [[1, 293485], [293486, 586970], [586971, 880455], [880456, 1173940], [1173941, 1467425], [1467426, 1760910], [1760911, 2054395], [2054396, 2347880], [2347881, 2641365], [2641366, 2934850], [2934851, 3228335], [3228336, 3521820], [3521821, 3815305], [3815306, 4108790], [4108791, 4402275], [4402276, 4695760], [4695761, 4989245], [4989246, 5282730], [5282731, 5576215], [5576216, 5869702]] SRR7692623 file size 1870380 SRR7692623 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692623 SRR7692623_1.fastq SRR7692623_2.fastq Input file: SRR7692623_1.fastq Paired file: SRR7692623_2.fastq trimmed: SRR7692623-trimmed-pair1.fastq, SRR7692623-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:35:53 2024 >> started Mon Dec 9 15:35:59 2024 >> done (5.950s) 5869702 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 5869702 (100.00%) read pairs available; of these: 230153 ( 3.92%) trimmed read pairs available after processing 5639549 (96.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 110 3 0.00% 111 128 0.00% 112 2748 0.05% 113 10837 0.18% 114 11943 0.20% 115 13282 0.23% 116 13951 0.24% 117 15291 0.26% 118 16286 0.28% 119 17248 0.29% 120 18165 0.31% 121 19612 0.33% 122 20448 0.35% 123 21759 0.37% 124 23188 0.40% 125 25264 0.43% 126 5639549 96.08% 5869702 reads passed initial QC criterion=sequence-density sequence-density=1.71 sequence-density-rank=1 fanout-score=32.80 fanout-score-rank=4 prefix-density=1.77 prefix-fanout=31.8 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCTCGGTGGTCGCCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=74.73 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.4 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC criterion=sequence-density sequence-density=1.74 sequence-density-rank=1 fanout-score=46.94 fanout-score-rank=2 prefix-density=1.75 prefix-fanout=46.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=55.53 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.3 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT SRR7692623 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:36:57 Started mapping on | Dec 09 15:36:57 Finished on | Dec 09 15:37:42 Mapping speed, Million of reads per hour | 469.58 Number of input reads | 5869702 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 5634354 Uniquely mapped reads % | 95.99% Average mapped length | 250.52 Number of splices: Total | 5062954 Number of splices: Annotated (sjdb) | 4816621 Number of splices: GT/AG | 4995564 Number of splices: GC/AG | 59941 Number of splices: AT/AC | 1822 Number of splices: Non-canonical | 5627 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 74982 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 6152 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 160366 160366 160366 N_multimapping 74982 74982 74982 N_noFeature 198095 230048 5505498 N_ambiguous 115670 19014 497 UnstrandedReadsAssigned:5320589 PositiveStrandReadsAssigned:5385292 NegativeStrandReadsAssigned:128359 Dataset is classified positive stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692623 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692623-trimmed-pair1.fastq SRR7692623-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,869,702 reads, 5,476,868 reads pseudoaligned [quant] estimated average fragment length: 171.461 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52973 SRR7692623.ke.tsv 35125 SRR7692623.se.tsv 88098 total ==> SRR7692623.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.649 0.0604339 0.0213587 PNS24247 1044 873.539 10.6085 3.28622 PNS24249 1928 1757.54 30.6581 4.72024 PNS24246 1044 873.539 10.6085 3.28622 PNS24248 1044 873.539 10.6085 3.28622 PNS24244 1471 1300.54 6.4558 1.34323 PNS24243 293 124.37 0 0 KQK14069 1603 1432.54 980.887 185.283 KQK14071 474 304.776 56.5853 50.2397 ==> SRR7692623.se.tsv <== BRADI_1g14170v3 1121 BRADI_1g53295v3 20 BRADI_1g59795v3 157 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 37 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 91 BRADI_1g48960v3 0 SRR7692623 completed mapping pipeline successfully