Starting /dee2/code/volunteer_pipeline.sh SRR7692624 current disk space = 1523244691456 free memory = 1581154528 SRR7692624 SRAfilesize f7a29f2f46c69a96b56d6935a3875d77 SRR7692624.sra SRR7692624.sra file validated SRR7692624 is paired end SRR7692624 is conventional basespace SRR7692624 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692624_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70225 33.0 33.0 34.0 32.0 34.0 2 32.67325 33.0 33.0 34.0 31.0 34.0 3 32.668 33.0 33.0 34.0 31.0 34.0 4 32.657 33.0 33.0 34.0 31.0 34.0 5 32.70075 33.0 33.0 34.0 32.0 34.0 6 36.77825 38.0 38.0 38.0 35.0 38.0 7 36.76075 38.0 38.0 38.0 35.0 38.0 8 36.72125 38.0 38.0 38.0 35.0 38.0 9 36.76 38.0 38.0 38.0 35.0 38.0 10-11 36.803125 38.0 38.0 38.0 35.0 38.0 12-13 36.862375 38.0 38.0 38.0 35.5 38.0 14-15 36.683499999999995 38.0 38.0 38.0 34.5 38.0 16-17 36.785124999999994 38.0 38.0 38.0 35.0 38.0 18-19 36.721000000000004 38.0 38.0 38.0 35.0 38.0 20-21 36.827875000000006 38.0 38.0 38.0 35.0 38.0 22-23 36.84125 38.0 38.0 38.0 35.5 38.0 24-25 36.89275000000001 38.0 38.0 38.0 36.0 38.0 26-27 36.875625 38.0 38.0 38.0 36.0 38.0 28-29 36.882625000000004 38.0 38.0 38.0 35.5 38.0 30-31 36.93025 38.0 38.0 38.0 36.0 38.0 32-33 36.81525 38.0 38.0 38.0 36.0 38.0 34-35 36.917249999999996 38.0 38.0 38.0 36.0 38.0 36-37 36.959875 38.0 38.0 38.0 36.0 38.0 38-39 36.954125000000005 38.0 38.0 38.0 36.0 38.0 40-41 36.938125 38.0 38.0 38.0 36.0 38.0 42-43 36.976625 38.0 38.0 38.0 36.0 38.0 44-45 36.969125000000005 38.0 38.0 38.0 36.0 38.0 46-47 36.904250000000005 38.0 38.0 38.0 36.0 38.0 48-49 36.95625 38.0 38.0 38.0 36.0 38.0 50-51 36.915499999999994 38.0 38.0 38.0 36.0 38.0 52-53 37.030375 38.0 38.0 38.0 36.0 38.0 54-55 36.93 38.0 38.0 38.0 36.0 38.0 56-57 36.8955 38.0 38.0 38.0 36.0 38.0 58-59 36.94725 38.0 38.0 38.0 36.0 38.0 60-61 36.949 38.0 38.0 38.0 36.0 38.0 62-63 36.897125 38.0 38.0 38.0 36.0 38.0 64-65 36.911 38.0 38.0 38.0 36.0 38.0 66-67 36.8945 38.0 38.0 38.0 36.0 38.0 68-69 36.851 38.0 38.0 38.0 35.0 38.0 70-71 36.75675 38.0 38.0 38.0 35.0 38.0 72-73 36.876625000000004 38.0 38.0 38.0 36.0 38.0 74-75 36.762125 38.0 38.0 38.0 35.0 38.0 76-77 36.724625 38.0 38.0 38.0 35.0 38.0 78-79 36.664375 38.0 38.0 38.0 35.0 38.0 80-81 36.694500000000005 38.0 38.0 38.0 35.0 38.0 82-83 36.716625 38.0 38.0 38.0 35.0 38.0 84-85 36.62225 38.0 38.0 38.0 35.0 38.0 86-87 36.6755 38.0 38.0 38.0 35.0 38.0 88-89 36.585875 38.0 38.0 38.0 34.5 38.0 90-91 36.494249999999994 38.0 38.0 38.0 34.0 38.0 92-93 36.532125 38.0 38.0 38.0 34.0 38.0 94-95 36.57575 38.0 38.0 38.0 34.5 38.0 96-97 36.55375 38.0 38.0 38.0 34.0 38.0 98-99 36.541375 38.0 38.0 38.0 34.0 38.0 100-101 36.42875 38.0 38.0 38.0 34.0 38.0 102-103 36.348 38.0 38.0 38.0 34.0 38.0 104-105 36.32225 38.0 38.0 38.0 34.0 38.0 106-107 36.24325 38.0 37.5 38.0 33.5 38.0 108-109 36.0085 38.0 37.5 38.0 33.0 38.0 110-111 36.12325 38.0 38.0 38.0 33.0 38.0 112-113 36.035625 38.0 37.5 38.0 33.0 38.0 114-115 35.908125 38.0 37.0 38.0 32.0 38.0 116-117 35.672625 38.0 36.0 38.0 31.0 38.0 118-119 35.786 38.0 36.5 38.0 31.0 38.0 120-121 35.787375 38.0 36.5 38.0 31.0 38.0 122-123 35.394000000000005 38.0 36.0 38.0 29.5 38.0 124-125 35.197375 38.0 35.5 38.0 29.5 38.0 126 30.41775 33.0 26.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 3.0 17 6.0 18 12.0 19 6.0 20 6.0 21 4.0 22 9.0 23 5.0 24 12.0 25 18.0 26 16.0 27 11.0 28 36.0 29 20.0 30 43.0 31 46.0 32 57.0 33 89.0 34 120.0 35 206.0 36 494.0 37 2779.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.449999999999996 17.95 11.825 35.775 2 30.025000000000002 22.475 26.275 21.224999999999998 3 22.775000000000002 25.55 24.75 26.924999999999997 4 27.250000000000004 28.7 20.075000000000003 23.974999999999998 5 28.749999999999996 29.7 19.6 21.95 6 23.35 32.1 19.900000000000002 24.65 7 22.275 18.175 33.675 25.874999999999996 8 23.974999999999998 21.85 23.075000000000003 31.1 9 25.2 21.349999999999998 26.5 26.950000000000003 10-11 27.4125 26.150000000000002 20.075000000000003 26.3625 12-13 26.887499999999996 22.3 23.275000000000002 27.537499999999998 14-15 26.0375 24.025 23.2625 26.674999999999997 16-17 26.8125 23.8625 22.4375 26.887499999999996 18-19 28.050000000000004 23.8625 22.925 25.162499999999998 20-21 27.150000000000002 23.4875 23.400000000000002 25.9625 22-23 25.95 24.2 23.5625 26.2875 24-25 26.325 24.337500000000002 23.474999999999998 25.8625 26-27 26.437500000000004 24.0375 23.2875 26.237500000000004 28-29 26.924999999999997 24.725 22.237499999999997 26.1125 30-31 25.724999999999998 24.3875 23.625 26.2625 32-33 25.7375 25.0625 23.5625 25.637500000000003 34-35 27.037499999999998 22.9875 23.962500000000002 26.0125 36-37 25.275 24.325 23.674999999999997 26.724999999999998 38-39 25.9875 24.4 23.75 25.8625 40-41 25.8125 24.462500000000002 23.2875 26.437500000000004 42-43 27.200000000000003 23.875 23.1 25.825 44-45 26.7125 24.5 22.7375 26.05 46-47 26.7625 25.0375 22.1375 26.0625 48-49 27.1 23.95 23.599999999999998 25.35 50-51 25.587500000000002 23.825 24.125 26.4625 52-53 26.937499999999996 23.9125 22.9375 26.2125 54-55 26.3125 24.637500000000003 23.2375 25.8125 56-57 26.6625 24.55 23.225 25.5625 58-59 27.025 23.75 23.4875 25.7375 60-61 26.2875 23.5375 24.4 25.775 62-63 26.224999999999998 23.4125 24.1375 26.224999999999998 64-65 27.275 23.9375 23.025000000000002 25.7625 66-67 26.275 24.224999999999998 23.35 26.150000000000002 68-69 26.437500000000004 23.9125 23.65 26.0 70-71 27.525 24.175 22.5125 25.7875 72-73 26.1125 24.0375 24.95 24.9 74-75 26.650000000000002 23.974999999999998 23.9 25.474999999999998 76-77 27.1625 23.8125 23.474999999999998 25.55 78-79 26.174999999999997 24.2625 24.337500000000002 25.224999999999998 80-81 26.724999999999998 25.0625 23.4625 24.75 82-83 26.825 24.925 23.4875 24.762500000000003 84-85 26.2875 25.05 23.5375 25.124999999999996 86-87 26.637499999999996 24.4875 24.3125 24.5625 88-89 26.2125 24.075 23.3875 26.325 90-91 26.174999999999997 25.2375 23.4625 25.124999999999996 92-93 25.637500000000003 25.7375 23.849999999999998 24.775 94-95 27.1375 23.9375 23.575 25.35 96-97 25.4 24.725 24.7 25.174999999999997 98-99 26.775 24.85 23.549999999999997 24.825 100-101 25.7125 24.837500000000002 23.962500000000002 25.4875 102-103 26.2625 26.05 23.3 24.3875 104-105 26.687499999999996 24.337500000000002 24.125 24.85 106-107 26.0125 25.4375 23.6375 24.9125 108-109 27.0125 23.75 24.3 24.9375 110-111 26.0375 24.625 23.8875 25.45 112-113 27.1 23.875 23.799999999999997 25.224999999999998 114-115 26.5875 25.1 24.087500000000002 24.224999999999998 116-117 26.650000000000002 25.2625 23.9375 24.15 118-119 27.3625 24.975 23.875 23.7875 120-121 26.275 24.925 24.1375 24.6625 122-123 27.085156933850197 25.54708015505815 23.571339252219584 23.796423658872076 124-125 26.9125 25.275 23.599999999999998 24.212500000000002 126 27.150000000000002 24.45 24.05 24.349999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 1.5 27 0.0 28 0.5 29 1.0 30 1.5 31 2.5 32 4.0 33 6.0 34 9.5 35 17.5 36 25.5 37 36.5 38 51.0 39 72.0 40 96.5 41 118.5 42 140.0 43 153.0 44 166.5 45 183.5 46 188.0 47 176.0 48 168.5 49 159.5 50 143.0 51 144.0 52 137.5 53 121.5 54 109.0 55 109.0 56 109.0 57 94.0 58 88.5 59 93.0 60 96.5 61 92.5 62 81.0 63 81.0 64 87.5 65 73.5 66 70.0 67 67.0 68 62.5 69 67.0 70 56.0 71 46.5 72 37.5 73 30.0 74 31.5 75 26.0 76 16.0 77 12.5 78 11.5 79 8.5 80 4.5 81 2.5 82 2.5 83 1.5 84 1.5 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0375 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.025 102-103 0.65 0.0 0.0 0.0 0.025 104-105 0.8 0.0 0.0 0.0 0.025 106-107 0.9375 0.0 0.0 0.0 0.025 108-109 1.1625 0.0 0.0 0.0 0.025 110-111 1.2875 0.0 0.0 0.0 0.025 112-113 1.4625 0.0 0.0 0.0 0.025 114 1.8 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692624 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692624_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.539 25.0 18.0 30.0 18.0 32.0 2 27.319 29.0 25.0 31.0 18.0 33.0 3 25.827 28.0 18.0 31.0 18.0 33.0 4 29.4695 31.0 29.0 33.0 25.0 33.0 5 31.21075 32.0 32.0 33.0 28.0 33.0 6 35.336 37.0 35.0 38.0 31.0 38.0 7 36.58525 38.0 37.0 38.0 34.0 38.0 8 36.54225 38.0 37.0 38.0 34.0 38.0 9 37.00675 38.0 38.0 38.0 35.0 38.0 10-11 37.23725 38.0 38.0 38.0 36.0 38.0 12-13 37.341375 38.0 38.0 38.0 36.5 38.0 14-15 37.369249999999994 38.0 38.0 38.0 36.5 38.0 16-17 37.384249999999994 38.0 38.0 38.0 37.0 38.0 18-19 37.38849999999999 38.0 38.0 38.0 37.0 38.0 20-21 37.402875 38.0 38.0 38.0 37.0 38.0 22-23 37.404875000000004 38.0 38.0 38.0 37.0 38.0 24-25 37.4525 38.0 38.0 38.0 37.0 38.0 26-27 37.405 38.0 38.0 38.0 37.0 38.0 28-29 37.453625 38.0 38.0 38.0 37.0 38.0 30-31 37.446875 38.0 38.0 38.0 37.0 38.0 32-33 37.458375000000004 38.0 38.0 38.0 37.0 38.0 34-35 37.26625 38.0 38.0 38.0 37.0 38.0 36-37 37.379125 38.0 38.0 38.0 37.0 38.0 38-39 37.37825 38.0 38.0 38.0 37.0 38.0 40-41 37.306375 38.0 38.0 38.0 37.0 38.0 42-43 37.296125 38.0 38.0 38.0 37.0 38.0 44-45 37.40975 38.0 38.0 38.0 37.0 38.0 46-47 37.2945 38.0 38.0 38.0 37.0 38.0 48-49 37.29575 38.0 38.0 38.0 37.0 38.0 50-51 37.26175 38.0 38.0 38.0 37.0 38.0 52-53 37.320750000000004 38.0 38.0 38.0 37.0 38.0 54-55 37.325874999999996 38.0 38.0 38.0 37.0 38.0 56-57 37.215374999999995 38.0 38.0 38.0 36.5 38.0 58-59 37.283875 38.0 38.0 38.0 36.5 38.0 60-61 37.293499999999995 38.0 38.0 38.0 36.5 38.0 62-63 37.294624999999996 38.0 38.0 38.0 36.0 38.0 64-65 37.2605 38.0 38.0 38.0 36.0 38.0 66-67 37.241625 38.0 38.0 38.0 36.0 38.0 68-69 37.20525 38.0 38.0 38.0 36.0 38.0 70-71 37.209875 38.0 38.0 38.0 36.0 38.0 72-73 37.179375 38.0 38.0 38.0 36.0 38.0 74-75 37.152625 38.0 38.0 38.0 36.0 38.0 76-77 37.145624999999995 38.0 38.0 38.0 36.0 38.0 78-79 37.141999999999996 38.0 38.0 38.0 36.0 38.0 80-81 37.13675 38.0 38.0 38.0 36.0 38.0 82-83 37.15725 38.0 38.0 38.0 36.0 38.0 84-85 37.112624999999994 38.0 38.0 38.0 36.0 38.0 86-87 37.086 38.0 38.0 38.0 36.0 38.0 88-89 37.113875 38.0 38.0 38.0 36.0 38.0 90-91 36.97125 38.0 38.0 38.0 35.0 38.0 92-93 36.934 38.0 38.0 38.0 35.0 38.0 94-95 36.871624999999995 38.0 38.0 38.0 35.0 38.0 96-97 36.911 38.0 38.0 38.0 35.0 38.0 98-99 36.831625 38.0 38.0 38.0 35.0 38.0 100-101 36.888 38.0 38.0 38.0 35.0 38.0 102-103 36.723 38.0 38.0 38.0 34.5 38.0 104-105 36.685625 38.0 38.0 38.0 34.5 38.0 106-107 36.4645 38.0 38.0 38.0 34.0 38.0 108-109 36.508875 38.0 38.0 38.0 34.0 38.0 110-111 36.489625000000004 38.0 38.0 38.0 34.0 38.0 112-113 36.521875 38.0 38.0 38.0 34.0 38.0 114-115 36.417125 38.0 37.5 38.0 34.0 38.0 116-117 36.501999999999995 38.0 38.0 38.0 34.0 38.0 118-119 36.22387500000001 38.0 37.0 38.0 33.0 38.0 120-121 36.316625 38.0 37.0 38.0 34.0 38.0 122-123 36.175250000000005 38.0 37.0 38.0 33.0 38.0 124-125 36.27075 38.0 37.0 38.0 33.5 38.0 126 31.84875 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 5.0 25 2.0 26 9.0 27 6.0 28 8.0 29 18.0 30 31.0 31 33.0 32 50.0 33 89.0 34 113.0 35 260.0 36 854.0 37 2518.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.288088642659275 11.004784688995215 8.99017879627298 43.716947872072524 2 24.55 14.399999999999999 33.95 27.1 3 22.8 16.75 23.625 36.825 4 27.725 23.0 21.475 27.800000000000004 5 26.950000000000003 27.375 23.45 22.225 6 24.075 29.549999999999997 23.875 22.5 7 19.325 23.400000000000002 36.75 20.525 8 22.6 22.1 28.199999999999996 27.1 9 20.375 20.875 32.824999999999996 25.924999999999997 10-11 24.6125 27.875 22.225 25.2875 12-13 24.1625 22.2 26.0375 27.6 14-15 24.212500000000002 23.7375 25.3125 26.737499999999997 16-17 24.75 23.7 25.95 25.6 18-19 23.7375 24.775 25.55 25.937500000000004 20-21 24.1125 24.275 26.05 25.5625 22-23 23.974999999999998 25.3 24.837500000000002 25.887500000000003 24-25 24.65 23.425 25.162499999999998 26.7625 26-27 24.175 23.6375 25.087500000000002 27.1 28-29 24.637500000000003 24.8 24.9 25.662499999999998 30-31 24.175 24.212500000000002 25.7625 25.85 32-33 24.275 23.825 25.15 26.75 34-35 24.266733517172224 24.492353973426926 25.206818751566807 26.034093757834043 36-37 25.15 23.724999999999998 24.3625 26.7625 38-39 23.798197295943915 24.44917376064096 25.826239359038556 25.926389584376565 40-41 24.875 24.2875 24.224999999999998 26.6125 42-43 25.137500000000003 24.05 24.837500000000002 25.974999999999998 44-45 24.425 23.674999999999997 26.0 25.900000000000002 46-47 24.024512256128062 24.524762381190595 25.137568784392194 26.313156578289142 48-49 24.9248496993988 23.659819639278556 25.137775551102205 26.27755511022044 50-51 25.08758758758759 24.261761761761765 24.83733733733734 25.813313313313312 52-53 24.024024024024023 25.0 23.986486486486484 26.989489489489486 54-55 24.73427535325747 24.384144054020258 24.384144054020258 26.49743653870201 56-57 25.165645705713214 24.05300662582823 25.103137892236532 25.678209776222026 58-59 25.634930564243714 23.833354184911798 23.908419867383962 26.623295383460526 60-61 24.6125 24.125 24.5625 26.700000000000003 62-63 24.253031628953618 23.22790348793599 25.328166020752597 27.19089886235779 64-65 25.200100050025014 24.087043521760883 24.749874937468736 25.962981490745374 66-67 24.73736868434217 24.249624812406203 24.374687343671837 26.638319159579787 68-69 24.79059882485311 23.89048631078885 24.6530816352044 26.665833229153645 70-71 24.55613903475869 24.668667166791696 24.10602650662666 26.669167291822955 72-73 24.575 24.625 23.8125 26.987499999999997 74-75 25.1 23.724999999999998 24.9875 26.187500000000004 76-77 25.3 23.7375 25.4 25.5625 78-79 25.137500000000003 24.462500000000002 24.1875 26.2125 80-81 26.5 23.025000000000002 23.724999999999998 26.75 82-83 24.349999999999998 24.474999999999998 24.425 26.75 84-85 24.762500000000003 23.275000000000002 24.5125 27.450000000000003 86-87 24.8125 23.0625 25.650000000000002 26.474999999999998 88-89 25.775 23.674999999999997 24.637500000000003 25.912499999999998 90-91 25.362499999999997 23.425 24.212500000000002 27.0 92-93 25.278159769971246 24.40305038129766 24.778097262157768 25.54069258657332 94-95 26.16904226056514 22.99324831207802 24.793698424606152 26.04401100275069 96-97 25.328166020752597 23.165395674459308 24.590573821727716 26.915864483060382 98-99 25.703212901612705 24.30303787973497 23.527940992624078 26.465808226028255 100-101 25.428178522315285 24.765595699462434 24.428053506688336 25.378172271533945 102-103 26.575 22.625 23.674999999999997 27.125 104-105 25.7375 23.5375 24.55 26.174999999999997 106-107 25.474999999999998 24.15 23.9 26.474999999999998 108-109 25.974999999999998 23.474999999999998 23.7125 26.8375 110-111 25.924999999999997 23.0625 23.875 27.1375 112-113 26.0375 23.9875 23.8375 26.137500000000003 114-115 25.775 24.4375 23.4625 26.325 116-117 24.65 23.5625 24.224999999999998 27.5625 118-119 26.137500000000003 23.3625 24.587500000000002 25.912499999999998 120-121 25.35 24.3125 24.25 26.087500000000002 122-123 26.4625 24.2 23.0625 26.275 124-125 26.025 24.4375 23.1875 26.35 126 25.25 24.275 23.549999999999997 26.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 1.5 31 4.0 32 6.0 33 13.0 34 22.5 35 27.0 36 35.0 37 50.5 38 66.0 39 82.0 40 102.5 41 128.5 42 148.5 43 167.5 44 185.0 45 184.5 46 186.5 47 181.5 48 172.0 49 164.5 50 155.0 51 154.5 52 135.0 53 113.5 54 117.0 55 114.5 56 105.0 57 97.0 58 87.5 59 75.5 60 80.0 61 81.0 62 69.5 63 68.5 64 70.0 65 77.0 66 66.0 67 57.5 68 61.0 69 47.5 70 38.5 71 39.0 72 35.0 73 31.5 74 25.5 75 17.0 76 10.0 77 7.5 78 10.0 79 9.0 80 7.5 81 5.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.27499999999999997 36-37 0.0 38-39 0.15 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.05 48-49 0.2 50-51 0.1 52-53 0.1 54-55 0.0375 56-57 0.0125 58-59 0.08750000000000001 60-61 0.0 62-63 0.0125 64-65 0.05 66-67 0.05 68-69 0.0125 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.025 96-97 0.0125 98-99 0.0125 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96412329459324 97.925 2 1.010611419909045 2.0 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388477 spots for SRR7692624.sra Written 388477 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra Read 388469 spots for SRR7692624.sra Written 388469 spots for SRR7692624.sra SRR ids: ['SRR7692624.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_71r8k0ui SRR7692624.sra spots: 7769388 blocks: [[1, 388469], [388470, 776938], [776939, 1165407], [1165408, 1553876], [1553877, 1942345], [1942346, 2330814], [2330815, 2719283], [2719284, 3107752], [3107753, 3496221], [3496222, 3884690], [3884691, 4273159], [4273160, 4661628], [4661629, 5050097], [5050098, 5438566], [5438567, 5827035], [5827036, 6215504], [6215505, 6603973], [6603974, 6992442], [6992443, 7380911], [7380912, 7769388]] SRR7692624 file size 2476072 SRR7692624 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692624 SRR7692624_1.fastq SRR7692624_2.fastq Input file: SRR7692624_1.fastq Paired file: SRR7692624_2.fastq trimmed: SRR7692624-trimmed-pair1.fastq, SRR7692624-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:39:53 2024 >> started Mon Dec 9 15:40:01 2024 >> done (7.795s) 7769388 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 7769388 (100.00%) read pairs available; of these: 288561 ( 3.71%) trimmed read pairs available after processing 7480827 (96.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 8 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 6 0.00% 111 226 0.00% 112 3690 0.05% 113 13315 0.17% 114 14582 0.19% 115 16173 0.21% 116 17220 0.22% 117 18743 0.24% 118 19841 0.26% 119 21045 0.27% 120 22905 0.29% 121 24701 0.32% 122 25945 0.33% 123 27717 0.36% 124 29459 0.38% 125 32985 0.42% 126 7480827 96.29% 7769388 reads passed initial QC criterion=sequence-density sequence-density=1.53 sequence-density-rank=1 fanout-score=34.42 fanout-score-rank=3 prefix-density=1.59 prefix-fanout=33.1 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCTCGGTGGTCGCCGTATCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=101.92 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC criterion=sequence-density sequence-density=1.56 sequence-density-rank=1 fanout-score=45.48 fanout-score-rank=2 prefix-density=1.56 prefix-fanout=45.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=0.16 sequence-density-rank=18 fanout-score=50.60 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=11.1 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG SRR7692624 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:40:43 Started mapping on | Dec 09 15:40:43 Finished on | Dec 09 15:41:21 Mapping speed, Million of reads per hour | 736.05 Number of input reads | 7769388 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 7392705 Uniquely mapped reads % | 95.15% Average mapped length | 250.59 Number of splices: Total | 6965881 Number of splices: Annotated (sjdb) | 6624423 Number of splices: GT/AG | 6873656 Number of splices: GC/AG | 83003 Number of splices: AT/AC | 2441 Number of splices: Non-canonical | 6781 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128710 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 18180 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 1.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 247973 247973 247973 N_multimapping 128710 128710 128710 N_noFeature 184778 222980 7220953 N_ambiguous 158131 24583 669 UnstrandedReadsAssigned:7049796 PositiveStrandReadsAssigned:7145142 NegativeStrandReadsAssigned:171083 Dataset is classified positive stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692624 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692624-trimmed-pair1.fastq SRR7692624-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,769,388 reads, 7,255,048 reads pseudoaligned [quant] estimated average fragment length: 172.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52973 SRR7692624.ke.tsv 35125 SRR7692624.se.tsv 88098 total ==> SRR7692624.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 764.485 0 0 PNS24247 1044 872.26 17.4771 3.68771 PNS24249 1928 1756.26 44.5597 4.66968 PNS24246 1044 872.26 17.4771 3.68771 PNS24248 1044 872.26 17.4771 3.68771 PNS24244 1471 1299.26 19.009 2.69275 PNS24243 293 123.222 0 0 KQK14069 1603 1431.26 955.095 122.818 KQK14071 474 303.657 57.7592 35.0083 ==> SRR7692624.se.tsv <== BRADI_1g14170v3 1043 BRADI_1g53295v3 29 BRADI_1g59795v3 110 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 67 BRADI_1g74790v3 101 BRADI_1g09890v3 0 BRADI_1g77505v3 158 BRADI_1g48960v3 0 SRR7692624 completed mapping pipeline successfully