Starting /dee2/code/volunteer_pipeline.sh SRR7692625 current disk space = 1523284914176 free memory = 1605431624 SRR7692625 SRAfilesize 9f3109a70b7682b4381fbe0fd8e986d6 SRR7692625.sra SRR7692625.sra file validated SRR7692625 is paired end SRR7692625 is conventional basespace SRR7692625 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692625_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.88675 28.0 18.0 32.0 18.0 33.0 2 29.0575 31.0 27.0 33.0 18.0 33.0 3 30.92375 31.0 30.0 33.0 27.0 33.0 4 32.2345 33.0 33.0 33.0 31.0 33.0 5 32.8205 33.0 33.0 34.0 32.0 34.0 6 36.333 38.0 36.0 38.0 33.0 38.0 7 36.8195 38.0 37.0 38.0 34.0 38.0 8 37.05075 38.0 38.0 38.0 35.0 38.0 9 37.3095 38.0 38.0 38.0 36.0 38.0 10-11 37.3635 38.0 38.0 38.0 37.0 38.0 12-13 37.42775 38.0 38.0 38.0 37.0 38.0 14-15 37.427375 38.0 38.0 38.0 37.0 38.0 16-17 37.444874999999996 38.0 38.0 38.0 37.0 38.0 18-19 37.382125 38.0 38.0 38.0 37.0 38.0 20-21 37.366625 38.0 38.0 38.0 37.0 38.0 22-23 37.39575 38.0 38.0 38.0 37.0 38.0 24-25 37.50125 38.0 38.0 38.0 37.0 38.0 26-27 37.367999999999995 38.0 38.0 38.0 37.0 38.0 28-29 37.397125 38.0 38.0 38.0 37.0 38.0 30-31 37.472875 38.0 38.0 38.0 37.0 38.0 32-33 37.47087500000001 38.0 38.0 38.0 37.0 38.0 34-35 37.262875 38.0 38.0 38.0 37.0 38.0 36-37 37.356375 38.0 38.0 38.0 37.0 38.0 38-39 37.389875 38.0 38.0 38.0 37.0 38.0 40-41 37.337500000000006 38.0 38.0 38.0 37.0 38.0 42-43 37.283500000000004 38.0 38.0 38.0 36.5 38.0 44-45 37.344375 38.0 38.0 38.0 37.0 38.0 46-47 37.307625 38.0 38.0 38.0 37.0 38.0 48-49 37.30275 38.0 38.0 38.0 37.0 38.0 50-51 37.392875000000004 38.0 38.0 38.0 37.0 38.0 52-53 37.362875 38.0 38.0 38.0 37.0 38.0 54-55 37.416875000000005 38.0 38.0 38.0 37.0 38.0 56-57 37.341499999999996 38.0 38.0 38.0 37.0 38.0 58-59 37.34675 38.0 38.0 38.0 37.0 38.0 60-61 37.376000000000005 38.0 38.0 38.0 37.0 38.0 62-63 37.37675 38.0 38.0 38.0 37.0 38.0 64-65 37.288624999999996 38.0 38.0 38.0 37.0 38.0 66-67 37.2825 38.0 38.0 38.0 36.5 38.0 68-69 37.330875000000006 38.0 38.0 38.0 37.0 38.0 70-71 37.314625 38.0 38.0 38.0 36.5 38.0 72-73 37.332 38.0 38.0 38.0 37.0 38.0 74-75 37.154125 38.0 38.0 38.0 36.0 38.0 76-77 37.17975 38.0 38.0 38.0 36.0 38.0 78-79 37.201375 38.0 38.0 38.0 36.0 38.0 80-81 37.222875 38.0 38.0 38.0 36.0 38.0 82-83 37.147499999999994 38.0 38.0 38.0 36.0 38.0 84-85 37.138875 38.0 38.0 38.0 36.0 38.0 86-87 37.174375 38.0 38.0 38.0 36.0 38.0 88-89 37.10875 38.0 38.0 38.0 35.5 38.0 90-91 37.113875 38.0 38.0 38.0 36.0 38.0 92-93 37.04775 38.0 38.0 38.0 35.5 38.0 94-95 36.95075 38.0 38.0 38.0 35.0 38.0 96-97 36.976375000000004 38.0 38.0 38.0 35.0 38.0 98-99 36.8055 38.0 38.0 38.0 35.0 38.0 100-101 36.929125 38.0 38.0 38.0 35.0 38.0 102-103 36.718875 38.0 38.0 38.0 34.5 38.0 104-105 36.674 38.0 38.0 38.0 34.0 38.0 106-107 36.4845 38.0 38.0 38.0 34.0 38.0 108-109 36.371625 38.0 38.0 38.0 34.0 38.0 110-111 36.39775 38.0 37.5 38.0 34.0 38.0 112-113 36.582875 38.0 38.0 38.0 34.0 38.0 114-115 36.38475 38.0 37.5 38.0 33.5 38.0 116-117 36.457375 38.0 38.0 38.0 34.0 38.0 118-119 36.232749999999996 38.0 37.0 38.0 33.0 38.0 120-121 36.358125 38.0 38.0 38.0 33.5 38.0 122-123 36.204 38.0 37.0 38.0 33.0 38.0 124-125 36.299 38.0 37.5 38.0 33.5 38.0 126 31.8135 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.0 25 3.0 26 6.0 27 12.0 28 11.0 29 21.0 30 26.0 31 35.0 32 48.0 33 86.0 34 113.0 35 194.0 36 629.0 37 2811.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.16161616161616 9.823232323232322 9.343434343434344 44.67171717171718 2 22.25 13.575000000000001 37.45 26.724999999999998 3 22.675 17.1 22.900000000000002 37.325 4 27.275 24.6 21.025 27.1 5 26.85 29.849999999999998 23.625 19.675 6 21.95 31.35 24.525 22.175 7 19.125 22.525000000000002 38.05 20.3 8 20.1 23.575 29.725 26.6 9 21.0 20.875 32.975 25.15 10-11 24.3625 30.112499999999997 22.9875 22.537499999999998 12-13 24.0125 23.599999999999998 26.237500000000004 26.150000000000002 14-15 22.525000000000002 25.1 26.674999999999997 25.7 16-17 24.45 24.4375 26.1 25.0125 18-19 23.95 25.174999999999997 24.775 26.1 20-21 23.375 26.0375 26.25 24.337500000000002 22-23 24.15 25.025 25.55 25.275 24-25 23.3 24.875 25.7875 26.0375 26-27 23.5625 25.174999999999997 26.3625 24.9 28-29 24.0375 25.5125 24.5375 25.912499999999998 30-31 23.7 25.7875 24.962500000000002 25.55 32-33 24.425 24.5625 25.5375 25.474999999999998 34-35 24.025567113673393 24.55194886577265 25.79270585286377 25.629778167690187 36-37 24.625 25.2625 24.1625 25.95 38-39 24.912368552829246 24.89984977466199 25.137706559839764 25.050075112669003 40-41 23.95 25.3125 24.25 26.487500000000004 42-43 24.65 24.8625 25.0125 25.474999999999998 44-45 23.962500000000002 25.624999999999996 25.55 24.8625 46-47 23.99349837459365 25.568892223055762 24.8062015503876 25.63140785196299 48-49 24.001502441467384 25.153374233128833 25.103292850882685 25.741830474521098 50-51 23.93344176154135 25.609908670086323 25.184536469410734 25.27211309896159 52-53 24.33379206805955 25.2596021518829 24.533967221318655 25.8726385587389 54-55 23.911955977988995 25.175087543771884 25.250125062531264 25.662831415707853 56-57 24.00300037504688 24.57807225903238 25.57819727465933 25.84073009126141 58-59 24.377736085053158 26.20387742338962 23.877423389618514 25.54096310193871 60-61 23.625 24.6 25.55 26.224999999999998 62-63 25.03125781445361 25.23130782695674 24.90622655663916 24.831207801950487 64-65 24.096536201075402 24.97186444916844 25.872202075778418 25.05939727397774 66-67 23.999499749874936 24.562281140570285 24.912456228114056 26.525762881440716 68-69 24.006001500375092 25.03125781445361 25.36884221055264 25.593898474618655 70-71 24.96248124062031 25.050025012506254 24.899949974987493 25.087543771885944 72-73 24.2 24.6 24.349999999999998 26.85 74-75 24.325 24.9375 24.325 26.4125 76-77 24.7 25.724999999999998 24.3875 25.1875 78-79 23.875 24.462500000000002 25.112499999999997 26.55 80-81 24.637500000000003 24.4 25.362499999999997 25.6 82-83 24.875 24.9375 24.3 25.887500000000003 84-85 25.1 25.112499999999997 24.3875 25.4 86-87 23.962500000000002 25.0375 24.4375 26.5625 88-89 24.375 25.587500000000002 24.9125 25.124999999999996 90-91 24.762500000000003 23.075000000000003 25.474999999999998 26.687499999999996 92-93 24.543635908977244 24.243560890222557 25.506376594148538 25.70642660665166 94-95 24.421658121795673 25.209453545079402 24.27160185069401 26.09728648243091 96-97 23.85596399099775 25.28132033008252 24.343585896474117 26.51912978244561 98-99 24.93123280820205 24.10602650662666 25.156289072268066 25.806451612903224 100-101 24.678084760595073 25.078134766845857 24.40305038129766 25.84073009126141 102-103 25.324999999999996 24.7 24.625 25.35 104-105 24.2875 25.124999999999996 25.1875 25.4 106-107 24.8125 24.875 24.725 25.587500000000002 108-109 25.2 25.362499999999997 23.599999999999998 25.837500000000002 110-111 25.0125 24.25 25.374999999999996 25.362499999999997 112-113 24.9125 24.1625 25.4625 25.4625 114-115 24.6625 25.1 24.637500000000003 25.6 116-117 25.074999999999996 25.4 24.2 25.324999999999996 118-119 24.975 25.174999999999997 24.4875 25.362499999999997 120-121 24.3625 24.925 24.349999999999998 26.3625 122-123 24.975 25.474999999999998 24.3 25.25 124-125 25.687500000000004 26.200000000000003 23.4875 24.625 126 25.575 25.674999999999997 23.1 25.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.5 26 2.5 27 3.5 28 4.5 29 4.0 30 7.5 31 15.0 32 19.0 33 23.0 34 27.5 35 31.5 36 46.0 37 66.0 38 85.0 39 101.5 40 135.5 41 158.0 42 161.0 43 181.0 44 188.0 45 197.0 46 197.0 47 179.0 48 167.5 49 161.5 50 158.0 51 148.5 52 118.0 53 92.0 54 92.5 55 84.5 56 77.0 57 75.0 58 74.5 59 70.5 60 69.0 61 68.0 62 69.5 63 72.5 64 69.5 65 63.5 66 57.5 67 59.5 68 60.5 69 52.0 70 41.0 71 37.0 72 27.0 73 20.5 74 19.0 75 20.0 76 14.5 77 7.0 78 4.5 79 1.5 80 2.5 81 4.0 82 2.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.2625 36-37 0.0 38-39 0.15 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.025 48-49 0.1625 50-51 0.08750000000000001 52-53 0.08750000000000001 54-55 0.05 56-57 0.0125 58-59 0.0625 60-61 0.0 62-63 0.025 64-65 0.0375 66-67 0.05 68-69 0.025 70-71 0.05 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0375 96-97 0.025 98-99 0.025 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.6801007556675063 1.35 3 0.0 0.0 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.7125000000000004 0.0 0.0 0.0 0.0 114 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692625 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692625_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.545 33.0 33.0 34.0 31.0 34.0 2 32.5795 33.0 33.0 34.0 31.0 34.0 3 32.61575 33.0 33.0 34.0 31.0 34.0 4 32.53325 33.0 33.0 34.0 31.0 34.0 5 32.537 33.0 33.0 34.0 31.0 34.0 6 36.6815 38.0 38.0 38.0 34.0 38.0 7 36.53075 38.0 38.0 38.0 34.0 38.0 8 36.5535 38.0 38.0 38.0 34.0 38.0 9 36.3845 38.0 38.0 38.0 34.0 38.0 10-11 36.682249999999996 38.0 38.0 38.0 34.5 38.0 12-13 36.774 38.0 38.0 38.0 35.0 38.0 14-15 36.37675 38.0 38.0 38.0 34.0 38.0 16-17 36.616125 38.0 38.0 38.0 34.5 38.0 18-19 36.544875000000005 38.0 38.0 38.0 34.0 38.0 20-21 36.747375 38.0 38.0 38.0 35.0 38.0 22-23 36.629125 38.0 38.0 38.0 34.5 38.0 24-25 36.661249999999995 38.0 38.0 38.0 34.5 38.0 26-27 36.678250000000006 38.0 38.0 38.0 35.0 38.0 28-29 36.7885 38.0 38.0 38.0 35.0 38.0 30-31 36.920375 38.0 38.0 38.0 36.0 38.0 32-33 36.825375 38.0 38.0 38.0 35.0 38.0 34-35 36.9055 38.0 38.0 38.0 35.5 38.0 36-37 36.870625000000004 38.0 38.0 38.0 35.5 38.0 38-39 36.833749999999995 38.0 38.0 38.0 35.0 38.0 40-41 36.883125 38.0 38.0 38.0 36.0 38.0 42-43 36.878375000000005 38.0 38.0 38.0 35.5 38.0 44-45 36.852000000000004 38.0 38.0 38.0 35.5 38.0 46-47 36.886125 38.0 38.0 38.0 35.5 38.0 48-49 36.76075 38.0 38.0 38.0 35.0 38.0 50-51 36.78975 38.0 38.0 38.0 35.0 38.0 52-53 36.915375 38.0 38.0 38.0 35.5 38.0 54-55 36.900499999999994 38.0 38.0 38.0 35.5 38.0 56-57 36.783625 38.0 38.0 38.0 35.0 38.0 58-59 36.8815 38.0 38.0 38.0 36.0 38.0 60-61 36.947500000000005 38.0 38.0 38.0 36.0 38.0 62-63 36.818124999999995 38.0 38.0 38.0 35.0 38.0 64-65 36.842375000000004 38.0 38.0 38.0 35.0 38.0 66-67 36.810249999999996 38.0 38.0 38.0 35.0 38.0 68-69 36.70075 38.0 38.0 38.0 35.0 38.0 70-71 36.691 38.0 38.0 38.0 34.5 38.0 72-73 36.7085 38.0 38.0 38.0 34.5 38.0 74-75 36.60475 38.0 38.0 38.0 34.0 38.0 76-77 36.5835 38.0 38.0 38.0 34.0 38.0 78-79 36.516375 38.0 38.0 38.0 34.0 38.0 80-81 36.582125 38.0 38.0 38.0 34.0 38.0 82-83 36.55575 38.0 38.0 38.0 34.0 38.0 84-85 36.436 38.0 38.0 38.0 34.0 38.0 86-87 36.457750000000004 38.0 38.0 38.0 34.0 38.0 88-89 36.47225 38.0 38.0 38.0 34.0 38.0 90-91 36.331125 38.0 38.0 38.0 34.0 38.0 92-93 36.319125 38.0 38.0 38.0 34.0 38.0 94-95 36.303250000000006 38.0 38.0 38.0 34.0 38.0 96-97 36.3655 38.0 38.0 38.0 34.0 38.0 98-99 36.229375000000005 38.0 38.0 38.0 33.0 38.0 100-101 36.171625 38.0 37.5 38.0 33.0 38.0 102-103 36.123875 38.0 37.5 38.0 33.0 38.0 104-105 35.96775 38.0 37.0 38.0 32.5 38.0 106-107 35.98175 38.0 37.0 38.0 32.0 38.0 108-109 35.792249999999996 38.0 36.5 38.0 31.5 38.0 110-111 35.922375 38.0 37.0 38.0 32.0 38.0 112-113 35.679625 38.0 36.0 38.0 31.0 38.0 114-115 35.696124999999995 38.0 36.0 38.0 31.0 38.0 116-117 35.557249999999996 38.0 36.0 38.0 31.0 38.0 118-119 35.566 38.0 36.0 38.0 30.0 38.0 120-121 35.531 38.0 36.0 38.0 31.0 38.0 122-123 35.055125000000004 38.0 35.0 38.0 28.0 38.0 124-125 34.913125 38.0 35.0 38.0 28.0 38.0 126 29.4615 33.0 23.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 4.0 18 6.0 19 11.0 20 2.0 21 6.0 22 7.0 23 13.0 24 11.0 25 10.0 26 25.0 27 24.0 28 31.0 29 47.0 30 47.0 31 47.0 32 84.0 33 90.0 34 135.0 35 217.0 36 600.0 37 2580.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.300000000000004 15.275 13.100000000000001 38.324999999999996 2 28.475 22.575 29.15 19.8 3 22.425 25.474999999999998 26.5 25.6 4 26.900000000000002 28.849999999999998 19.5 24.75 5 28.000000000000004 31.974999999999998 19.775000000000002 20.25 6 22.675 34.449999999999996 20.674999999999997 22.2 7 23.1 17.275 35.075 24.55 8 24.575 22.175 25.474999999999998 27.775 9 23.95 21.875 27.700000000000003 26.474999999999998 10-11 26.487500000000004 27.5125 20.8 25.2 12-13 26.775 22.1 24.075 27.05 14-15 25.074999999999996 25.162499999999998 24.4875 25.275 16-17 26.674999999999997 24.375 23.3875 25.5625 18-19 25.4875 24.6125 24.462500000000002 25.4375 20-21 25.6125 24.3125 25.3 24.775 22-23 25.674999999999997 24.1625 25.0375 25.124999999999996 24-25 25.874999999999996 25.1875 24.2625 24.675 26-27 26.0 26.75 23.3625 23.8875 28-29 26.150000000000002 24.474999999999998 24.5125 24.8625 30-31 25.8 24.6625 24.425 25.112499999999997 32-33 25.35 25.137500000000003 24.5375 24.975 34-35 26.325 24.875 23.5375 25.2625 36-37 25.0125 24.975 25.112499999999997 24.9 38-39 26.2125 25.3 24.6 23.8875 40-41 25.937500000000004 24.4375 24.825 24.8 42-43 26.224999999999998 24.65 24.087500000000002 25.0375 44-45 25.7625 25.4625 24.1375 24.637500000000003 46-47 26.7625 24.7875 24.337500000000002 24.1125 48-49 26.437500000000004 23.8375 24.962500000000002 24.762500000000003 50-51 26.687499999999996 24.175 25.3125 23.825 52-53 25.637500000000003 25.337500000000002 23.4375 25.587500000000002 54-55 25.8 24.575 25.637500000000003 23.9875 56-57 25.674999999999997 25.5375 24.3625 24.425 58-59 25.4875 24.5125 25.025 24.975 60-61 25.7125 25.0375 24.6625 24.587500000000002 62-63 25.2125 25.662499999999998 24.762500000000003 24.3625 64-65 25.775 25.2375 24.775 24.212500000000002 66-67 25.687500000000004 24.7875 24.462500000000002 25.0625 68-69 25.45 24.925 24.85 24.775 70-71 26.224999999999998 24.025 24.762500000000003 24.9875 72-73 26.174999999999997 24.825 25.224999999999998 23.775 74-75 25.412499999999998 25.3125 25.25 24.025 76-77 26.5 24.2 24.887500000000003 24.4125 78-79 25.674999999999997 25.0125 24.55 24.762500000000003 80-81 25.324999999999996 25.387500000000003 25.4875 23.799999999999997 82-83 26.737499999999997 24.9375 24.3875 23.9375 84-85 26.1625 23.4125 25.775 24.65 86-87 26.0625 25.474999999999998 24.825 23.6375 88-89 26.474999999999998 24.5125 24.099999999999998 24.9125 90-91 25.587500000000002 24.6875 24.9375 24.7875 92-93 24.825 25.0 25.6125 24.5625 94-95 25.424999999999997 24.887500000000003 24.925 24.762500000000003 96-97 26.137500000000003 25.0375 25.124999999999996 23.7 98-99 26.3125 25.2375 24.975 23.474999999999998 100-101 26.687499999999996 23.925 24.6125 24.775 102-103 26.525 24.3125 24.65 24.5125 104-105 25.4375 25.087500000000002 26.1 23.375 106-107 26.375 24.5625 24.375 24.6875 108-109 25.35 25.924999999999997 24.6125 24.1125 110-111 25.7625 25.75 25.174999999999997 23.3125 112-113 25.7875 24.8625 24.55 24.8 114-115 25.837500000000002 26.424999999999997 24.25 23.4875 116-117 26.150000000000002 26.0 24.474999999999998 23.375 118-119 25.474999999999998 25.362499999999997 24.8125 24.349999999999998 120-121 26.025 25.837500000000002 24.2375 23.9 122-123 26.525762881440716 26.688344172086044 24.212106053026513 22.573786893446723 124-125 27.800000000000004 25.362499999999997 24.0 22.8375 126 25.8 27.1 24.85 22.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.0 22 1.0 23 0.0 24 1.0 25 3.5 26 4.0 27 4.0 28 3.0 29 3.0 30 4.0 31 8.0 32 13.0 33 16.5 34 26.5 35 37.5 36 48.5 37 64.0 38 79.5 39 106.5 40 125.5 41 131.5 42 159.5 43 173.5 44 170.0 45 168.0 46 172.0 47 184.5 48 171.0 49 152.0 50 146.0 51 134.0 52 127.5 53 117.0 54 104.5 55 95.5 56 84.5 57 81.5 58 83.0 59 91.5 60 92.0 61 74.0 62 64.0 63 70.0 64 61.5 65 57.0 66 58.5 67 59.0 68 66.5 69 64.0 70 52.5 71 38.5 72 25.5 73 20.5 74 23.5 75 19.5 76 13.0 77 11.0 78 9.5 79 6.5 80 3.0 81 4.0 82 3.5 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.05 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.5033979360684621 1.0 3 0.0 0.0 4 0.025169896803423106 0.1 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7874999999999996 0.0 0.0 0.0 0.0 114 3.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra Read 649966 spots for SRR7692625.sra Written 649966 spots for SRR7692625.sra Read 649950 spots for SRR7692625.sra Written 649950 spots for SRR7692625.sra SRR ids: ['SRR7692625.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cp7vkqzk SRR7692625.sra spots: 12999016 blocks: [[1, 649950], [649951, 1299900], [1299901, 1949850], [1949851, 2599800], [2599801, 3249750], [3249751, 3899700], [3899701, 4549650], [4549651, 5199600], [5199601, 5849550], [5849551, 6499500], [6499501, 7149450], [7149451, 7799400], [7799401, 8449350], [8449351, 9099300], [9099301, 9749250], [9749251, 10399200], [10399201, 11049150], [11049151, 11699100], [11699101, 12349050], [12349051, 12999016]] SRR7692625 file size 4146379 SRR7692625 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692625 SRR7692625_1.fastq SRR7692625_2.fastq Input file: SRR7692625_1.fastq Paired file: SRR7692625_2.fastq trimmed: SRR7692625-trimmed-pair1.fastq, SRR7692625-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:48:30 2024 >> started Mon Dec 9 15:48:52 2024 >> done (22.607s) 12999016 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 44 ( 0.00%) empty read pairs filtered out after trimming by size control 12998969 (100.00%) read pairs available; of these: 1260391 ( 9.70%) trimmed read pairs available after processing 11738578 (90.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 29 2 0.00% 30 1 0.00% 31 4 0.00% 32 3 0.00% 33 4 0.00% 34 2 0.00% 35 1 0.00% 36 8 0.00% 37 8 0.00% 38 2 0.00% 39 13 0.00% 40 7 0.00% 41 8 0.00% 42 6 0.00% 43 8 0.00% 44 8 0.00% 45 5 0.00% 46 8 0.00% 47 10 0.00% 48 11 0.00% 49 14 0.00% 50 11 0.00% 51 14 0.00% 52 21 0.00% 53 21 0.00% 54 21 0.00% 55 21 0.00% 56 21 0.00% 57 24 0.00% 58 37 0.00% 59 29 0.00% 60 47 0.00% 61 50 0.00% 62 60 0.00% 63 74 0.00% 64 64 0.00% 65 92 0.00% 66 107 0.00% 67 124 0.00% 68 161 0.00% 69 186 0.00% 70 203 0.00% 71 146 0.00% 72 156 0.00% 73 192 0.00% 74 196 0.00% 75 251 0.00% 76 284 0.00% 77 314 0.00% 78 371 0.00% 79 408 0.00% 80 419 0.00% 81 529 0.00% 82 621 0.00% 83 692 0.01% 84 811 0.01% 85 1002 0.01% 86 1085 0.01% 87 1289 0.01% 88 1530 0.01% 89 1734 0.01% 90 2057 0.02% 91 2371 0.02% 92 2694 0.02% 93 3294 0.03% 94 3865 0.03% 95 4590 0.04% 96 5407 0.04% 97 6217 0.05% 98 7430 0.06% 99 8495 0.07% 100 9642 0.07% 101 11211 0.09% 102 12943 0.10% 103 14815 0.11% 104 17192 0.13% 105 19247 0.15% 106 22293 0.17% 107 24842 0.19% 108 27674 0.21% 109 30767 0.24% 110 33773 0.26% 111 36663 0.28% 112 40311 0.31% 113 44010 0.34% 114 48411 0.37% 115 52913 0.41% 116 57178 0.44% 117 60092 0.46% 118 65051 0.50% 119 68435 0.53% 120 72690 0.56% 121 77013 0.59% 122 80456 0.62% 123 85218 0.66% 124 91307 0.70% 125 96273 0.74% 126 11738578 90.30% 12998969 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=19.14 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.1 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=20 prefix-density=0.40 prefix-fanout=2.3 sequence=GCCACCAACTTCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=69.93 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.1 sequence=CCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAAAA SRR7692625 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:59:20 Started mapping on | Dec 09 15:59:20 Finished on | Dec 09 16:00:08 Mapping speed, Million of reads per hour | 974.92 Number of input reads | 12998969 Average input read length | 249 UNIQUE READS: Uniquely mapped reads number | 12592180 Uniquely mapped reads % | 96.87% Average mapped length | 249.45 Number of splices: Total | 10586973 Number of splices: Annotated (sjdb) | 10013453 Number of splices: GT/AG | 10444809 Number of splices: GC/AG | 124134 Number of splices: AT/AC | 4273 Number of splices: Non-canonical | 13757 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159928 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 10238 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 246861 246861 246861 N_multimapping 159928 159928 159928 N_noFeature 525309 12277391 607549 N_ambiguous 270668 1218 38688 UnstrandedReadsAssigned:11796203 PositiveStrandReadsAssigned:313571 NegativeStrandReadsAssigned:11945943 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692625 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692625-trimmed-pair1.fastq SRR7692625-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,998,969 reads, 12,059,967 reads pseudoaligned [quant] estimated average fragment length: 158.005 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52973 SRR7692625.ke.tsv 35125 SRR7692625.se.tsv 88098 total ==> SRR7692625.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.158 0 0 PNS24247 1044 886.995 37.9854 5.32657 PNS24249 1928 1770.99 52.0264 3.65391 PNS24246 1044 886.995 37.9854 5.32657 PNS24248 1044 886.995 37.9854 5.32657 PNS24244 1471 1313.99 45.0173 4.26125 PNS24243 293 137.889 0 0 KQK14069 1603 1445.99 8378.5 720.694 KQK14071 474 318.392 523.072 204.339 ==> SRR7692625.se.tsv <== BRADI_1g14170v3 9698 BRADI_1g53295v3 88 BRADI_1g59795v3 488 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 66 BRADI_1g74790v3 65 BRADI_1g09890v3 0 BRADI_1g77505v3 273 BRADI_1g48960v3 0 SRR7692625 completed mapping pipeline successfully