Starting /dee2/code/volunteer_pipeline.sh SRR7692626 current disk space = 1523290742784 free memory = 1368503020 SRR7692626 SRAfilesize 8195390523bf7eeb4575e3756fb62df8 SRR7692626.sra SRR7692626.sra file validated SRR7692626 is paired end SRR7692626 is conventional basespace SRR7692626 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692626_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79675 33.0 33.0 34.0 32.0 34.0 2 32.81 33.0 33.0 34.0 32.0 34.0 3 32.81625 33.0 33.0 34.0 32.0 34.0 4 32.81 34.0 33.0 34.0 32.0 34.0 5 32.7435 33.0 33.0 34.0 32.0 34.0 6 36.83325 38.0 38.0 38.0 36.0 38.0 7 36.83025 38.0 38.0 38.0 36.0 38.0 8 36.848 38.0 38.0 38.0 36.0 38.0 9 36.815 38.0 38.0 38.0 35.0 38.0 10-11 36.928625 38.0 38.0 38.0 36.0 38.0 12-13 36.942875 38.0 38.0 38.0 36.0 38.0 14-15 36.76875 38.0 38.0 38.0 35.0 38.0 16-17 36.9475 38.0 38.0 38.0 36.0 38.0 18-19 36.873000000000005 38.0 38.0 38.0 36.0 38.0 20-21 36.983875 38.0 38.0 38.0 36.0 38.0 22-23 36.83025 38.0 38.0 38.0 36.0 38.0 24-25 36.844750000000005 38.0 38.0 38.0 36.0 38.0 26-27 36.939 38.0 38.0 38.0 36.0 38.0 28-29 37.015875 38.0 38.0 38.0 36.0 38.0 30-31 37.004125 38.0 38.0 38.0 36.0 38.0 32-33 36.982124999999996 38.0 38.0 38.0 36.0 38.0 34-35 37.07175 38.0 38.0 38.0 36.0 38.0 36-37 37.107124999999996 38.0 38.0 38.0 36.0 38.0 38-39 37.062625 38.0 38.0 38.0 36.5 38.0 40-41 37.10625 38.0 38.0 38.0 37.0 38.0 42-43 37.033375 38.0 38.0 38.0 36.0 38.0 44-45 37.030249999999995 38.0 38.0 38.0 36.5 38.0 46-47 37.088 38.0 38.0 38.0 36.5 38.0 48-49 37.003875 38.0 38.0 38.0 36.0 38.0 50-51 37.048874999999995 38.0 38.0 38.0 36.0 38.0 52-53 37.092124999999996 38.0 38.0 38.0 36.0 38.0 54-55 37.082750000000004 38.0 38.0 38.0 36.0 38.0 56-57 37.058875 38.0 38.0 38.0 36.0 38.0 58-59 37.03937500000001 38.0 38.0 38.0 36.0 38.0 60-61 37.039875 38.0 38.0 38.0 36.0 38.0 62-63 36.931250000000006 38.0 38.0 38.0 36.0 38.0 64-65 36.982875 38.0 38.0 38.0 36.0 38.0 66-67 36.989125 38.0 38.0 38.0 36.0 38.0 68-69 36.88875 38.0 38.0 38.0 36.0 38.0 70-71 36.87 38.0 38.0 38.0 36.0 38.0 72-73 36.90837500000001 38.0 38.0 38.0 36.0 38.0 74-75 36.878874999999994 38.0 38.0 38.0 36.0 38.0 76-77 36.864374999999995 38.0 38.0 38.0 35.5 38.0 78-79 36.861000000000004 38.0 38.0 38.0 35.5 38.0 80-81 36.791 38.0 38.0 38.0 35.0 38.0 82-83 36.805625 38.0 38.0 38.0 35.0 38.0 84-85 36.75 38.0 38.0 38.0 35.0 38.0 86-87 36.8575 38.0 38.0 38.0 35.5 38.0 88-89 36.81325 38.0 38.0 38.0 35.0 38.0 90-91 36.722375 38.0 38.0 38.0 35.0 38.0 92-93 36.594750000000005 38.0 38.0 38.0 34.5 38.0 94-95 36.670500000000004 38.0 38.0 38.0 35.0 38.0 96-97 36.638125 38.0 38.0 38.0 34.5 38.0 98-99 36.6165 38.0 38.0 38.0 35.0 38.0 100-101 36.465125 38.0 38.0 38.0 34.0 38.0 102-103 36.5235 38.0 38.0 38.0 34.5 38.0 104-105 36.409 38.0 38.0 38.0 34.0 38.0 106-107 36.41275 38.0 38.0 38.0 34.0 38.0 108-109 36.31225 38.0 38.0 38.0 34.0 38.0 110-111 36.28425 38.0 38.0 38.0 34.0 38.0 112-113 36.22925 38.0 38.0 38.0 33.5 38.0 114-115 36.229 38.0 38.0 38.0 33.5 38.0 116-117 35.881874999999994 38.0 37.0 38.0 32.5 38.0 118-119 36.172625 38.0 38.0 38.0 33.0 38.0 120-121 36.067 38.0 38.0 38.0 32.5 38.0 122-123 35.6805 38.0 36.0 38.0 31.0 38.0 124-125 35.509625 38.0 36.0 38.0 30.0 38.0 126 30.48675 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 7.0 18 11.0 19 11.0 20 6.0 21 5.0 22 5.0 23 8.0 24 9.0 25 11.0 26 19.0 27 16.0 28 22.0 29 25.0 30 29.0 31 38.0 32 58.0 33 61.0 34 94.0 35 199.0 36 435.0 37 2928.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.525 17.025000000000002 11.975 35.475 2 29.475 24.075 27.825 18.625 3 23.25 25.724999999999998 25.575 25.45 4 26.075 30.225 19.825 23.875 5 27.0 31.924999999999997 19.8 21.275 6 23.474999999999998 33.6 20.4 22.525000000000002 7 23.674999999999997 17.299999999999997 32.824999999999996 26.200000000000003 8 22.35 23.45 24.05 30.15 9 23.724999999999998 21.925 27.425 26.924999999999997 10-11 26.5125 27.075 21.3875 25.025 12-13 26.487500000000004 22.8125 24.2875 26.4125 14-15 25.974999999999998 24.349999999999998 24.4125 25.2625 16-17 26.8 24.349999999999998 23.65 25.2 18-19 26.375 25.112499999999997 23.5125 25.0 20-21 26.8125 24.5 24.2875 24.4 22-23 26.3 24.087500000000002 24.4875 25.124999999999996 24-25 25.575 24.3625 23.9 26.1625 26-27 25.9625 23.6125 25.087500000000002 25.337500000000002 28-29 26.0125 24.875 23.1625 25.95 30-31 26.875 24.462500000000002 23.9125 24.75 32-33 25.825 25.2375 24.4125 24.525 34-35 26.6625 24.2875 23.0125 26.0375 36-37 25.8625 25.0 24.2 24.9375 38-39 25.887500000000003 25.424999999999997 24.1125 24.575 40-41 26.0125 24.637500000000003 24.175 25.174999999999997 42-43 26.450000000000003 24.224999999999998 24.224999999999998 25.1 44-45 26.5375 24.887500000000003 24.637500000000003 23.9375 46-47 26.7125 23.9 24.75 24.637500000000003 48-49 26.187500000000004 23.825 25.5 24.4875 50-51 25.624999999999996 24.75 24.5625 25.0625 52-53 26.987499999999997 23.7 25.1 24.212500000000002 54-55 26.025 24.5375 24.8625 24.575 56-57 26.775 24.2375 23.7875 25.2 58-59 26.487500000000004 24.224999999999998 24.0625 25.224999999999998 60-61 26.700000000000003 24.3875 23.875 25.0375 62-63 26.575 23.7375 24.6875 25.0 64-65 26.2625 24.2875 24.337500000000002 25.112499999999997 66-67 26.337500000000002 24.3625 24.212500000000002 25.087500000000002 68-69 26.1125 24.9 24.837500000000002 24.15 70-71 26.8125 25.0625 23.8625 24.2625 72-73 26.400000000000002 24.8 24.85 23.95 74-75 25.8 24.525 25.362499999999997 24.3125 76-77 26.775 23.7875 23.5375 25.900000000000002 78-79 25.324999999999996 24.125 24.775 25.775 80-81 25.85 23.5 26.0125 24.637500000000003 82-83 26.2625 23.6875 24.875 25.174999999999997 84-85 26.487500000000004 25.275 24.2375 24.0 86-87 25.5625 24.887500000000003 25.55 24.0 88-89 26.7625 24.337500000000002 24.4 24.5 90-91 25.8125 25.162499999999998 24.6 24.425 92-93 26.375 25.525 24.175 23.925 94-95 27.5625 24.2375 24.4875 23.7125 96-97 26.1125 25.0625 24.8 24.025 98-99 26.575 24.7875 25.0 23.6375 100-101 27.125 24.637500000000003 23.775 24.462500000000002 102-103 25.5 24.474999999999998 25.874999999999996 24.15 104-105 26.25 24.825 24.9125 24.0125 106-107 26.487500000000004 24.7 24.5125 24.3 108-109 26.7625 24.725 25.0375 23.474999999999998 110-111 26.5 24.8 24.45 24.25 112-113 27.0625 25.35 24.712500000000002 22.875 114-115 27.275 24.5625 24.4 23.7625 116-117 26.424999999999997 25.15 24.325 24.099999999999998 118-119 26.887499999999996 25.05 24.462500000000002 23.599999999999998 120-121 26.737499999999997 24.825 24.7 23.7375 122-123 28.1 25.337500000000002 23.7875 22.775000000000002 124-125 26.900000000000002 25.275 23.65 24.175 126 27.625 25.374999999999996 24.85 22.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 2.0 26 2.5 27 2.0 28 2.5 29 6.0 30 9.0 31 10.0 32 10.0 33 11.0 34 21.0 35 32.0 36 43.0 37 63.0 38 80.5 39 83.5 40 89.5 41 123.0 42 156.5 43 166.0 44 170.0 45 174.0 46 170.0 47 180.5 48 181.0 49 163.0 50 156.5 51 146.0 52 125.5 53 110.5 54 105.5 55 99.5 56 86.0 57 81.0 58 82.5 59 80.0 60 82.5 61 77.5 62 79.5 63 85.5 64 82.5 65 73.5 66 68.5 67 72.5 68 67.5 69 56.5 70 48.0 71 36.0 72 31.5 73 32.0 74 23.0 75 16.0 76 15.5 77 11.5 78 5.0 79 3.0 80 2.5 81 0.5 82 1.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.6301991429291656 1.25 3 0.025207965717166627 0.075 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692626 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692626_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.9465 18.0 18.0 25.0 18.0 32.0 2 29.673 30.0 27.0 31.0 27.0 33.0 3 31.5175 33.0 31.0 33.0 29.0 33.0 4 32.4 33.0 33.0 33.0 31.0 34.0 5 33.10925 33.0 33.0 34.0 33.0 34.0 6 36.90625 38.0 38.0 38.0 35.0 38.0 7 37.16025 38.0 38.0 38.0 36.0 38.0 8 37.14575 38.0 38.0 38.0 36.0 38.0 9 37.26425 38.0 38.0 38.0 37.0 38.0 10-11 37.3755 38.0 38.0 38.0 37.0 38.0 12-13 37.395250000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.41475 38.0 38.0 38.0 37.0 38.0 16-17 37.387875 38.0 38.0 38.0 37.0 38.0 18-19 37.454125 38.0 38.0 38.0 37.0 38.0 20-21 37.340625 38.0 38.0 38.0 37.0 38.0 22-23 37.426375 38.0 38.0 38.0 37.0 38.0 24-25 37.417 38.0 38.0 38.0 37.0 38.0 26-27 37.4765 38.0 38.0 38.0 37.0 38.0 28-29 37.445750000000004 38.0 38.0 38.0 37.0 38.0 30-31 37.478125000000006 38.0 38.0 38.0 37.0 38.0 32-33 37.457375 38.0 38.0 38.0 37.0 38.0 34-35 37.313 38.0 38.0 38.0 37.0 38.0 36-37 37.438125 38.0 38.0 38.0 37.0 38.0 38-39 37.42975 38.0 38.0 38.0 37.0 38.0 40-41 37.41 38.0 38.0 38.0 37.0 38.0 42-43 37.392125 38.0 38.0 38.0 37.0 38.0 44-45 37.399 38.0 38.0 38.0 37.0 38.0 46-47 37.388 38.0 38.0 38.0 37.0 38.0 48-49 37.328125 38.0 38.0 38.0 37.0 38.0 50-51 37.372 38.0 38.0 38.0 37.0 38.0 52-53 37.369375 38.0 38.0 38.0 37.0 38.0 54-55 37.385000000000005 38.0 38.0 38.0 37.0 38.0 56-57 37.308 38.0 38.0 38.0 37.0 38.0 58-59 37.332750000000004 38.0 38.0 38.0 37.0 38.0 60-61 37.374625 38.0 38.0 38.0 37.0 38.0 62-63 37.3545 38.0 38.0 38.0 37.0 38.0 64-65 37.268125 38.0 38.0 38.0 36.0 38.0 66-67 37.35125 38.0 38.0 38.0 37.0 38.0 68-69 37.323875 38.0 38.0 38.0 37.0 38.0 70-71 37.263875 38.0 38.0 38.0 36.5 38.0 72-73 37.237624999999994 38.0 38.0 38.0 36.0 38.0 74-75 37.225875 38.0 38.0 38.0 36.0 38.0 76-77 37.19475 38.0 38.0 38.0 36.0 38.0 78-79 37.201875 38.0 38.0 38.0 36.0 38.0 80-81 37.144999999999996 38.0 38.0 38.0 36.0 38.0 82-83 37.22025 38.0 38.0 38.0 36.0 38.0 84-85 37.09025 38.0 38.0 38.0 36.0 38.0 86-87 37.11925 38.0 38.0 38.0 36.0 38.0 88-89 37.07575 38.0 38.0 38.0 36.0 38.0 90-91 37.09825 38.0 38.0 38.0 36.0 38.0 92-93 37.02175 38.0 38.0 38.0 36.0 38.0 94-95 37.00575 38.0 38.0 38.0 35.0 38.0 96-97 36.974125 38.0 38.0 38.0 35.5 38.0 98-99 36.9705 38.0 38.0 38.0 35.0 38.0 100-101 36.937375 38.0 38.0 38.0 35.0 38.0 102-103 36.762 38.0 38.0 38.0 35.0 38.0 104-105 36.705625 38.0 38.0 38.0 34.5 38.0 106-107 36.514624999999995 38.0 38.0 38.0 34.0 38.0 108-109 36.474374999999995 38.0 38.0 38.0 34.0 38.0 110-111 36.510374999999996 38.0 38.0 38.0 34.0 38.0 112-113 36.611875 38.0 38.0 38.0 34.0 38.0 114-115 36.51275 38.0 38.0 38.0 34.0 38.0 116-117 36.489000000000004 38.0 38.0 38.0 34.0 38.0 118-119 36.31075 38.0 37.5 38.0 33.5 38.0 120-121 36.3555 38.0 38.0 38.0 34.0 38.0 122-123 36.326375 38.0 37.0 38.0 33.0 38.0 124-125 36.394625 38.0 38.0 38.0 34.0 38.0 126 32.0965 35.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 5.0 25 2.0 26 6.0 27 10.0 28 17.0 29 22.0 30 21.0 31 33.0 32 54.0 33 59.0 34 112.0 35 202.0 36 608.0 37 2845.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.332827132371555 8.377625917489242 14.097696785623892 42.19185016451531 2 22.2 13.3 36.35 28.15 3 22.325 16.150000000000002 22.775000000000002 38.75 4 27.325 23.775 21.675 27.224999999999998 5 27.85 28.249999999999996 23.35 20.549999999999997 6 22.225 30.675 24.775 22.325 7 19.25 22.775000000000002 37.5 20.474999999999998 8 21.4 22.625 29.15 26.825 9 19.400000000000002 21.5 33.225 25.874999999999996 10-11 24.9 27.737499999999997 22.6875 24.675 12-13 22.9875 23.6625 25.75 27.6 14-15 22.900000000000002 24.375 26.1 26.625 16-17 23.849999999999998 24.525 25.8125 25.8125 18-19 23.3 24.075 25.2625 27.3625 20-21 23.7875 25.0375 25.424999999999997 25.75 22-23 24.1625 24.9 25.2125 25.724999999999998 24-25 23.4625 24.9125 24.212500000000002 27.4125 26-27 23.32791598949869 25.465683210401302 24.753094136767096 26.453306663332913 28-29 23.7875 25.337500000000002 25.1875 25.687500000000004 30-31 24.474999999999998 25.174999999999997 24.1625 26.187500000000004 32-33 23.5375 24.962500000000002 25.1 26.400000000000002 34-35 23.223461586664996 25.60471236997117 25.27885699962401 25.892969043739818 36-37 23.5375 24.5625 24.2875 27.6125 38-39 22.944048066090875 24.471147828263863 26.11090249092502 26.47390161472024 40-41 23.3625 25.412499999999998 25.374999999999996 25.85 42-43 23.525 24.099999999999998 25.412499999999998 26.9625 44-45 24.1375 24.55 25.3125 26.0 46-47 23.583843941478055 24.84681755658372 25.609603601350507 25.959734900587723 48-49 24.05412177399148 24.17940365823102 24.906038586820344 26.860435980957153 50-51 23.391739674593243 24.84355444305382 25.03128911138924 26.733416770963704 52-53 24.09261576971214 25.36921151439299 24.14267834793492 26.395494367959948 54-55 23.9 24.349999999999998 25.2875 26.4625 56-57 23.2875 24.425 26.0375 26.25 58-59 24.149574787393696 25.18759379689845 24.16208104052026 26.500750375187593 60-61 24.725 24.2625 24.762500000000003 26.25 62-63 23.65 24.4 24.825 27.125 64-65 24.756189047261813 24.293573393348336 25.03125781445361 25.918979744936234 66-67 24.2375 23.775 25.2625 26.724999999999998 68-69 24.212500000000002 24.525 25.05 26.2125 70-71 24.2 24.6625 25.0125 26.125 72-73 24.925 23.8625 24.462500000000002 26.75 74-75 24.337500000000002 24.775 24.5375 26.35 76-77 24.099999999999998 25.074999999999996 24.725 26.1 78-79 23.4375 24.6 25.1 26.8625 80-81 24.0125 25.162499999999998 25.25 25.575 82-83 24.962500000000002 25.5 23.9 25.637500000000003 84-85 24.325 25.1875 23.962500000000002 26.525 86-87 24.125 25.5 24.875 25.5 88-89 25.0625 24.7375 24.2375 25.9625 90-91 24.212500000000002 24.875 24.762500000000003 26.150000000000002 92-93 24.05 24.4125 24.625 26.9125 94-95 25.5375 24.025 25.05 25.387500000000003 96-97 24.7375 23.9 24.0625 27.3 98-99 25.05 24.474999999999998 24.3625 26.1125 100-101 24.9375 24.075 24.637500000000003 26.35 102-103 24.3625 24.212500000000002 24.425 27.0 104-105 24.837500000000002 24.6875 24.2625 26.2125 106-107 24.8 24.712500000000002 23.974999999999998 26.5125 108-109 24.45 24.575 24.45 26.525 110-111 24.65 24.3875 24.75 26.2125 112-113 24.75 25.2125 24.1625 25.874999999999996 114-115 26.0 24.474999999999998 23.150000000000002 26.375 116-117 24.2875 25.525 24.775 25.412499999999998 118-119 25.650000000000002 24.4375 23.2875 26.625 120-121 25.2875 24.6875 24.5125 25.5125 122-123 25.0125 24.3 24.5625 26.125 124-125 25.637500000000003 25.5375 23.1875 25.637500000000003 126 24.525 24.8 24.375 26.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 2.0 28 5.0 29 3.5 30 4.5 31 10.5 32 13.5 33 14.0 34 24.0 35 34.0 36 42.0 37 57.5 38 74.5 39 106.0 40 125.5 41 135.0 42 159.0 43 177.0 44 185.5 45 179.5 46 166.0 47 181.5 48 181.5 49 158.5 50 164.5 51 154.0 52 132.5 53 121.0 54 109.0 55 99.5 56 90.5 57 80.5 58 73.0 59 69.5 60 72.0 61 77.5 62 77.0 63 69.5 64 63.5 65 70.5 66 70.0 67 59.5 68 52.0 69 45.0 70 41.0 71 34.5 72 24.0 73 22.5 74 22.0 75 21.5 76 18.0 77 10.5 78 6.0 79 2.5 80 2.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.2625 36-37 0.0 38-39 0.13749999999999998 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0375 48-49 0.22499999999999998 50-51 0.125 52-53 0.125 54-55 0.0 56-57 0.0 58-59 0.05 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra Read 812623 spots for SRR7692626.sra Written 812623 spots for SRR7692626.sra Read 812622 spots for SRR7692626.sra Written 812622 spots for SRR7692626.sra SRR ids: ['SRR7692626.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6hnoc148 SRR7692626.sra spots: 16252441 blocks: [[1, 812622], [812623, 1625244], [1625245, 2437866], [2437867, 3250488], [3250489, 4063110], [4063111, 4875732], [4875733, 5688354], [5688355, 6500976], [6500977, 7313598], [7313599, 8126220], [8126221, 8938842], [8938843, 9751464], [9751465, 10564086], [10564087, 11376708], [11376709, 12189330], [12189331, 13001952], [13001953, 13814574], [13814575, 14627196], [14627197, 15439818], [15439819, 16252441]] SRR7692626 file size 5186873 SRR7692626 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692626 SRR7692626_1.fastq SRR7692626_2.fastq Input file: SRR7692626_1.fastq Paired file: SRR7692626_2.fastq trimmed: SRR7692626-trimmed-pair1.fastq, SRR7692626-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:45:03 2024 >> started Mon Dec 9 15:46:27 2024 >> done (83.758s) 16252441 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 16252441 (100.00%) read pairs available; of these: 556509 ( 3.42%) trimmed read pairs available after processing 15695932 (96.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 75 6 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 0 0.00% 82 0 0.00% 83 0 0.00% 84 0 0.00% 85 0 0.00% 86 0 0.00% 87 0 0.00% 88 0 0.00% 89 0 0.00% 90 0 0.00% 91 0 0.00% 92 0 0.00% 93 0 0.00% 94 0 0.00% 95 0 0.00% 96 0 0.00% 97 0 0.00% 98 0 0.00% 99 0 0.00% 100 0 0.00% 101 0 0.00% 102 0 0.00% 103 0 0.00% 104 0 0.00% 105 0 0.00% 106 0 0.00% 107 0 0.00% 108 0 0.00% 109 0 0.00% 110 8 0.00% 111 334 0.00% 112 6386 0.04% 113 26258 0.16% 114 28861 0.18% 115 31571 0.19% 116 33914 0.21% 117 36584 0.23% 118 38957 0.24% 119 41030 0.25% 120 43554 0.27% 121 47038 0.29% 122 49740 0.31% 123 52771 0.32% 124 57013 0.35% 125 62484 0.38% 126 15695932 96.58% 16252441 reads passed initial QC criterion=sequence-density sequence-density=1.34 sequence-density-rank=1 fanout-score=33.54 fanout-score-rank=2 prefix-density=1.39 prefix-fanout=32.4 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCC criterion=fanout-score sequence-density=0.18 sequence-density-rank=20 fanout-score=49.44 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=13.6 sequence=CAAGAAGAAGGT criterion=sequence-density sequence-density=1.36 sequence-density-rank=1 fanout-score=46.22 fanout-score-rank=2 prefix-density=1.37 prefix-fanout=46.1 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=106.38 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=11.2 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACCGGAACC SRR7692626 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:50:02 Started mapping on | Dec 09 15:50:03 Finished on | Dec 09 15:54:21 Mapping speed, Million of reads per hour | 226.78 Number of input reads | 16252441 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 15613528 Uniquely mapped reads % | 96.07% Average mapped length | 250.69 Number of splices: Total | 13686475 Number of splices: Annotated (sjdb) | 12972014 Number of splices: GT/AG | 13501569 Number of splices: GC/AG | 162799 Number of splices: AT/AC | 5182 Number of splices: Non-canonical | 16925 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230993 % of reads mapped to multiple loci | 1.42% Number of reads mapped to too many loci | 16133 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 407920 407920 407920 N_multimapping 230993 230993 230993 N_noFeature 555682 649224 15226103 N_ambiguous 342403 49504 1472 UnstrandedReadsAssigned:14715443 PositiveStrandReadsAssigned:14914800 NegativeStrandReadsAssigned:385953 Dataset is classified positive stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692626 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692626-trimmed-pair1.fastq SRR7692626-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,252,441 reads, 15,170,988 reads pseudoaligned [quant] estimated average fragment length: 170.692 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR7692626.ke.tsv 35125 SRR7692626.se.tsv 88098 total ==> SRR7692626.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 766.441 18.0011 2.24421 PNS24247 1044 874.308 41.4186 4.52664 PNS24249 1928 1758.31 93.0562 5.05702 PNS24246 1044 874.308 41.4186 4.52664 PNS24248 1044 874.308 41.4186 4.52664 PNS24244 1471 1301.31 63.6868 4.67643 PNS24243 293 125.456 0 0 KQK14069 1603 1433.31 7169.64 477.972 KQK14071 474 305.896 246.882 77.1187 ==> SRR7692626.se.tsv <== BRADI_1g14170v3 7804 BRADI_1g53295v3 136 BRADI_1g59795v3 452 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 231 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 342 BRADI_1g48960v3 0 SRR7692626 completed mapping pipeline successfully