Starting /dee2/code/volunteer_pipeline.sh SRR7692627 current disk space = 1523376078848 free memory = 1580398152 SRR7692627 SRAfilesize efc041c9aef74c1d1a811bc6bf3539b8 SRR7692627.sra SRR7692627.sra file validated SRR7692627 is paired end SRR7692627 is conventional basespace SRR7692627 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692627_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0325 28.0 18.0 32.0 18.0 33.0 2 29.07325 31.0 27.0 33.0 18.0 33.0 3 30.9925 33.0 30.0 33.0 28.0 33.0 4 32.28975 33.0 33.0 33.0 31.0 33.0 5 32.821 33.0 33.0 33.0 32.0 34.0 6 36.55775 38.0 37.0 38.0 34.0 38.0 7 36.88825 38.0 37.0 38.0 35.0 38.0 8 37.167 38.0 38.0 38.0 36.0 38.0 9 37.38475 38.0 38.0 38.0 37.0 38.0 10-11 37.448 38.0 38.0 38.0 37.0 38.0 12-13 37.48925 38.0 38.0 38.0 37.0 38.0 14-15 37.439875 38.0 38.0 38.0 37.0 38.0 16-17 37.435500000000005 38.0 38.0 38.0 37.0 38.0 18-19 37.48075 38.0 38.0 38.0 37.0 38.0 20-21 37.426500000000004 38.0 38.0 38.0 37.0 38.0 22-23 37.435874999999996 38.0 38.0 38.0 37.0 38.0 24-25 37.499875 38.0 38.0 38.0 37.5 38.0 26-27 37.435375 38.0 38.0 38.0 37.0 38.0 28-29 37.48675 38.0 38.0 38.0 37.0 38.0 30-31 37.513374999999996 38.0 38.0 38.0 37.0 38.0 32-33 37.4895 38.0 38.0 38.0 37.0 38.0 34-35 37.365624999999994 38.0 38.0 38.0 37.0 38.0 36-37 37.47125 38.0 38.0 38.0 37.0 38.0 38-39 37.40537500000001 38.0 38.0 38.0 37.0 38.0 40-41 37.406875 38.0 38.0 38.0 37.0 38.0 42-43 37.353625 38.0 38.0 38.0 37.0 38.0 44-45 37.383624999999995 38.0 38.0 38.0 37.0 38.0 46-47 37.409625 38.0 38.0 38.0 37.0 38.0 48-49 37.3215 38.0 38.0 38.0 37.0 38.0 50-51 37.416624999999996 38.0 38.0 38.0 37.0 38.0 52-53 37.383250000000004 38.0 38.0 38.0 37.0 38.0 54-55 37.439750000000004 38.0 38.0 38.0 37.0 38.0 56-57 37.373875 38.0 38.0 38.0 37.0 38.0 58-59 37.379875 38.0 38.0 38.0 37.0 38.0 60-61 37.393249999999995 38.0 38.0 38.0 37.0 38.0 62-63 37.3865 38.0 38.0 38.0 37.0 38.0 64-65 37.368125 38.0 38.0 38.0 37.0 38.0 66-67 37.312250000000006 38.0 38.0 38.0 37.0 38.0 68-69 37.360749999999996 38.0 38.0 38.0 37.0 38.0 70-71 37.258 38.0 38.0 38.0 37.0 38.0 72-73 37.295500000000004 38.0 38.0 38.0 37.0 38.0 74-75 37.241875 38.0 38.0 38.0 36.0 38.0 76-77 37.255875 38.0 38.0 38.0 36.0 38.0 78-79 37.2855 38.0 38.0 38.0 36.5 38.0 80-81 37.25 38.0 38.0 38.0 36.0 38.0 82-83 37.244749999999996 38.0 38.0 38.0 36.0 38.0 84-85 37.244749999999996 38.0 38.0 38.0 36.0 38.0 86-87 37.240125 38.0 38.0 38.0 36.0 38.0 88-89 37.14375 38.0 38.0 38.0 36.0 38.0 90-91 37.173 38.0 38.0 38.0 36.0 38.0 92-93 37.0985 38.0 38.0 38.0 36.0 38.0 94-95 37.026125 38.0 38.0 38.0 35.5 38.0 96-97 37.083375000000004 38.0 38.0 38.0 36.0 38.0 98-99 36.926500000000004 38.0 38.0 38.0 35.0 38.0 100-101 36.97725 38.0 38.0 38.0 35.0 38.0 102-103 36.876999999999995 38.0 38.0 38.0 35.0 38.0 104-105 36.8165 38.0 38.0 38.0 35.0 38.0 106-107 36.6395 38.0 38.0 38.0 34.0 38.0 108-109 36.581500000000005 38.0 38.0 38.0 34.0 38.0 110-111 36.557625 38.0 38.0 38.0 34.0 38.0 112-113 36.609750000000005 38.0 38.0 38.0 34.0 38.0 114-115 36.423500000000004 38.0 38.0 38.0 34.0 38.0 116-117 36.60425 38.0 38.0 38.0 34.0 38.0 118-119 36.3735 38.0 38.0 38.0 34.0 38.0 120-121 36.520250000000004 38.0 38.0 38.0 34.0 38.0 122-123 36.34 38.0 37.5 38.0 33.5 38.0 124-125 36.36725 38.0 38.0 38.0 34.0 38.0 126 32.26825 36.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 2.0 25 3.0 26 5.0 27 13.0 28 12.0 29 15.0 30 18.0 31 39.0 32 43.0 33 63.0 34 90.0 35 202.0 36 589.0 37 2901.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.44410723318159 10.343955488113304 8.750632271117857 44.46130500758726 2 22.7 14.299999999999999 36.875 26.125 3 22.45 17.125 23.575 36.85 4 27.025 25.35 20.825 26.8 5 27.500000000000004 28.975 22.575 20.95 6 22.400000000000002 33.125 22.525000000000002 21.95 7 18.85 23.474999999999998 38.35 19.325 8 21.15 23.3 28.825 26.724999999999998 9 20.974999999999998 20.724999999999998 32.425 25.874999999999996 10-11 23.6125 29.225 24.0 23.1625 12-13 24.1875 23.7125 25.575 26.525 14-15 22.975 25.95 26.187500000000004 24.887500000000003 16-17 23.962500000000002 25.162499999999998 24.7375 26.137500000000003 18-19 24.1125 25.3125 25.087500000000002 25.4875 20-21 23.474999999999998 24.5 25.9875 26.0375 22-23 24.712500000000002 25.15 24.9125 25.224999999999998 24-25 23.125 26.237500000000004 24.3625 26.275 26-27 23.940492561570196 24.803100387548444 25.465683210401302 25.790723840480062 28-29 23.849999999999998 25.137500000000003 25.35 25.662499999999998 30-31 23.8625 25.15 25.275 25.7125 32-33 22.8625 25.7 25.624999999999996 25.8125 34-35 23.727113117632307 25.395033860045146 25.13167795334838 25.746175068974164 36-37 23.7875 25.112499999999997 25.05 26.05 38-39 23.99198597545705 24.868519909842224 25.59479088404708 25.544703230653642 40-41 25.0375 24.25 25.525 25.1875 42-43 23.6625 24.875 24.65 26.8125 44-45 23.7125 25.7 25.337500000000002 25.25 46-47 24.043510877719427 24.48112028007002 25.381345336334082 26.094023505876468 48-49 22.998872604284102 25.353876988600778 24.927971940373293 26.719278466741827 50-51 23.366708385481854 24.993742177722154 26.33291614518148 25.306633291614517 52-53 23.554443053817273 25.556946182728414 24.63078848560701 26.25782227784731 54-55 23.533825184444165 25.30949105914718 24.92184569213455 26.2348380642741 56-57 24.04050506313289 24.965620702587824 24.778097262157768 26.215776972121514 58-59 23.799399699849925 25.287643821910955 25.062531265632813 25.850425212606304 60-61 24.2375 25.087500000000002 24.7875 25.887500000000003 62-63 23.790473809226153 24.6530816352044 25.753219152394045 25.803225403175396 64-65 24.484181568088033 24.721770663999 25.196948855820935 25.597098912092036 66-67 23.499249624812407 25.45022511255628 24.69984992496248 26.350675337668832 68-69 24.090511313914238 25.128141017627204 24.70308788598575 26.078259782472806 70-71 24.131032758189548 25.70642660665166 25.381345336334082 24.781195298824706 72-73 24.50306288286036 24.590573821727716 23.80297537192149 27.103387923490434 74-75 24.5125 25.162499999999998 23.849999999999998 26.474999999999998 76-77 24.425 25.3125 25.4 24.8625 78-79 23.775 24.875 25.124999999999996 26.224999999999998 80-81 24.975 24.6875 25.4875 24.85 82-83 25.5125 24.075 24.625 25.7875 84-85 24.85 24.2 24.2875 26.6625 86-87 24.75 24.349999999999998 24.4875 26.4125 88-89 24.3875 24.712500000000002 24.9375 25.9625 90-91 24.953119139892486 24.440555069383674 24.715589448681087 25.890736342042754 92-93 24.603075384423054 24.803100387548444 24.965620702587824 25.62820352544068 94-95 25.593898474618655 24.356089022255563 24.681170292573142 25.36884221055264 96-97 24.153019127390923 24.840605075634453 24.94061757719715 26.065758219777475 98-99 24.69058632329041 24.79059882485311 24.32804100512564 26.190773846730842 100-101 25.428178522315285 25.403175396924617 24.915614451806476 24.253031628953618 102-103 24.4125 24.55 24.962500000000002 26.075 104-105 24.05 24.675 25.825 25.45 106-107 24.725 25.4625 24.55 25.2625 108-109 24.775 24.887500000000003 23.9 26.437500000000004 110-111 24.6 25.650000000000002 24.3875 25.362499999999997 112-113 25.4 24.9875 24.337500000000002 25.275 114-115 25.324999999999996 23.9375 25.0375 25.7 116-117 25.624999999999996 23.9 24.4875 25.9875 118-119 26.150000000000002 24.675 23.7625 25.412499999999998 120-121 26.0125 26.4125 23.075000000000003 24.5 122-123 24.8625 25.2125 24.2625 25.662499999999998 124-125 25.55 24.6125 24.575 25.2625 126 24.474999999999998 26.0 23.549999999999997 25.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 4.0 29 7.0 30 8.5 31 12.5 32 16.0 33 21.5 34 28.5 35 36.5 36 52.0 37 66.5 38 75.0 39 100.5 40 125.5 41 143.5 42 169.0 43 187.5 44 202.5 45 206.0 46 189.5 47 179.5 48 168.5 49 151.0 50 155.5 51 148.5 52 117.5 53 107.0 54 95.5 55 76.0 56 76.5 57 77.5 58 77.0 59 74.0 60 68.5 61 69.0 62 67.5 63 65.0 64 65.0 65 69.0 66 67.0 67 52.5 68 52.5 69 51.5 70 42.0 71 35.0 72 33.5 73 32.0 74 21.5 75 14.5 76 11.5 77 9.5 78 5.5 79 3.0 80 2.0 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.325 36-37 0.0 38-39 0.17500000000000002 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.025 48-49 0.21250000000000002 50-51 0.125 52-53 0.125 54-55 0.0375 56-57 0.0125 58-59 0.05 60-61 0.0 62-63 0.0125 64-65 0.0375 66-67 0.05 68-69 0.0125 70-71 0.025 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0125 94-95 0.025 96-97 0.0125 98-99 0.0125 100-101 0.0125 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114 2.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7692627 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692627_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76225 33.0 33.0 34.0 32.0 34.0 2 32.82525 33.0 33.0 34.0 32.0 34.0 3 32.8235 33.0 33.0 34.0 32.0 34.0 4 32.816 33.0 33.0 34.0 32.0 34.0 5 32.794 33.0 33.0 34.0 32.0 34.0 6 36.938 38.0 38.0 38.0 36.0 38.0 7 36.911 38.0 38.0 38.0 35.0 38.0 8 36.8915 38.0 38.0 38.0 36.0 38.0 9 36.76625 38.0 38.0 38.0 35.0 38.0 10-11 36.94375 38.0 38.0 38.0 36.0 38.0 12-13 36.97125 38.0 38.0 38.0 36.0 38.0 14-15 36.737625 38.0 38.0 38.0 35.0 38.0 16-17 36.916 38.0 38.0 38.0 36.0 38.0 18-19 36.815125 38.0 38.0 38.0 35.5 38.0 20-21 37.02775 38.0 38.0 38.0 36.0 38.0 22-23 36.905125 38.0 38.0 38.0 36.0 38.0 24-25 36.920500000000004 38.0 38.0 38.0 36.0 38.0 26-27 36.993875 38.0 38.0 38.0 36.0 38.0 28-29 37.104375000000005 38.0 38.0 38.0 36.5 38.0 30-31 37.1435 38.0 38.0 38.0 36.0 38.0 32-33 37.0705 38.0 38.0 38.0 36.0 38.0 34-35 37.162625 38.0 38.0 38.0 36.5 38.0 36-37 37.148250000000004 38.0 38.0 38.0 37.0 38.0 38-39 37.171875 38.0 38.0 38.0 37.0 38.0 40-41 37.161 38.0 38.0 38.0 36.5 38.0 42-43 37.133375 38.0 38.0 38.0 36.0 38.0 44-45 37.107375 38.0 38.0 38.0 36.0 38.0 46-47 37.131875 38.0 38.0 38.0 36.0 38.0 48-49 36.994875 38.0 38.0 38.0 36.0 38.0 50-51 37.105625 38.0 38.0 38.0 36.0 38.0 52-53 37.14925 38.0 38.0 38.0 36.5 38.0 54-55 37.110375000000005 38.0 38.0 38.0 36.0 38.0 56-57 37.085499999999996 38.0 38.0 38.0 36.0 38.0 58-59 37.162 38.0 38.0 38.0 36.5 38.0 60-61 37.08775 38.0 38.0 38.0 36.0 38.0 62-63 37.024 38.0 38.0 38.0 36.0 38.0 64-65 37.08325 38.0 38.0 38.0 36.0 38.0 66-67 36.991375 38.0 38.0 38.0 36.0 38.0 68-69 36.9765 38.0 38.0 38.0 36.0 38.0 70-71 36.951375 38.0 38.0 38.0 36.0 38.0 72-73 36.997749999999996 38.0 38.0 38.0 36.0 38.0 74-75 37.001375 38.0 38.0 38.0 36.0 38.0 76-77 36.9295 38.0 38.0 38.0 35.5 38.0 78-79 36.8405 38.0 38.0 38.0 35.0 38.0 80-81 36.782375 38.0 38.0 38.0 35.0 38.0 82-83 36.832750000000004 38.0 38.0 38.0 35.0 38.0 84-85 36.751125 38.0 38.0 38.0 35.0 38.0 86-87 36.806125 38.0 38.0 38.0 35.0 38.0 88-89 36.82325 38.0 38.0 38.0 35.0 38.0 90-91 36.74125 38.0 38.0 38.0 35.0 38.0 92-93 36.61825 38.0 38.0 38.0 34.5 38.0 94-95 36.736 38.0 38.0 38.0 35.0 38.0 96-97 36.674375 38.0 38.0 38.0 35.0 38.0 98-99 36.571125 38.0 38.0 38.0 34.5 38.0 100-101 36.508 38.0 38.0 38.0 34.0 38.0 102-103 36.491625 38.0 38.0 38.0 34.0 38.0 104-105 36.4745 38.0 38.0 38.0 34.0 38.0 106-107 36.413 38.0 38.0 38.0 34.0 38.0 108-109 36.237624999999994 38.0 38.0 38.0 34.0 38.0 110-111 36.316874999999996 38.0 38.0 38.0 34.0 38.0 112-113 36.242625000000004 38.0 38.0 38.0 33.0 38.0 114-115 36.15175 38.0 38.0 38.0 33.5 38.0 116-117 35.9495 38.0 37.0 38.0 32.5 38.0 118-119 36.1225 38.0 37.5 38.0 32.5 38.0 120-121 36.007125 38.0 37.5 38.0 31.5 38.0 122-123 35.656375 38.0 36.0 38.0 31.0 38.0 124-125 35.37125 38.0 35.5 38.0 29.5 38.0 126 30.384 33.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 3.0 18 8.0 19 7.0 20 3.0 21 3.0 22 6.0 23 5.0 24 10.0 25 17.0 26 16.0 27 15.0 28 16.0 29 28.0 30 36.0 31 46.0 32 49.0 33 77.0 34 121.0 35 183.0 36 452.0 37 2897.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.175 16.45 12.775 37.6 2 27.525 23.799999999999997 28.575 20.1 3 22.95 25.35 25.825 25.874999999999996 4 27.075 29.099999999999998 20.0 23.825 5 28.275 32.225 19.825 19.675 6 22.975 35.0 20.424999999999997 21.6 7 22.1 18.099999999999998 35.725 24.075 8 24.75 21.525 24.875 28.849999999999998 9 24.099999999999998 22.625 26.75 26.525 10-11 26.5 27.400000000000002 21.1375 24.962500000000002 12-13 26.8 22.275 24.825 26.1 14-15 25.45 24.975 24.3 25.275 16-17 25.525 24.224999999999998 24.762500000000003 25.4875 18-19 25.362499999999997 24.85 23.225 26.5625 20-21 26.0125 24.3625 24.4875 25.137500000000003 22-23 26.337500000000002 24.45 23.974999999999998 25.2375 24-25 24.575 24.675 24.9375 25.8125 26-27 25.025 24.887500000000003 24.9 25.1875 28-29 26.25 24.2375 24.325 25.1875 30-31 25.025 25.087500000000002 25.162499999999998 24.725 32-33 25.7875 25.275 24.5375 24.4 34-35 25.6125 24.5375 24.1625 25.687500000000004 36-37 26.0375 24.825 23.3625 25.775 38-39 25.4375 25.162499999999998 24.8 24.6 40-41 25.124999999999996 24.5625 25.1875 25.124999999999996 42-43 25.9625 24.474999999999998 24.2 25.362499999999997 44-45 25.324999999999996 25.0125 24.762500000000003 24.9 46-47 25.8125 24.9875 24.4125 24.7875 48-49 25.324999999999996 24.9875 24.2375 25.45 50-51 24.7375 25.575 24.462500000000002 25.224999999999998 52-53 26.5375 24.95 24.0 24.5125 54-55 25.587500000000002 24.9375 25.025 24.45 56-57 25.9875 26.3125 24.425 23.275000000000002 58-59 26.575 23.8375 24.275 25.3125 60-61 25.3125 24.1875 25.837500000000002 24.6625 62-63 25.724999999999998 24.5625 25.45 24.2625 64-65 25.474999999999998 24.9875 24.375 25.162499999999998 66-67 25.0375 25.412499999999998 24.4125 25.137500000000003 68-69 26.3 25.2375 24.8625 23.599999999999998 70-71 25.362499999999997 24.4875 25.575 24.575 72-73 26.2125 24.175 25.374999999999996 24.2375 74-75 26.0375 24.275 25.55 24.1375 76-77 26.150000000000002 25.2 24.1125 24.5375 78-79 24.975 24.474999999999998 25.837500000000002 24.712500000000002 80-81 26.0625 24.462500000000002 25.4625 24.0125 82-83 26.5375 24.325 24.6625 24.474999999999998 84-85 25.912499999999998 24.525 25.4875 24.075 86-87 25.4875 25.624999999999996 25.374999999999996 23.5125 88-89 26.0 24.8 24.325 24.875 90-91 26.075 24.6 24.9 24.425 92-93 26.2625 24.887500000000003 24.8 24.05 94-95 26.3125 25.275 24.85 23.5625 96-97 25.7875 25.5125 24.9125 23.7875 98-99 26.2125 25.45 24.125 24.212500000000002 100-101 26.174999999999997 25.4875 24.675 23.6625 102-103 26.200000000000003 24.762500000000003 25.112499999999997 23.925 104-105 26.2625 24.7875 25.6 23.35 106-107 26.55 24.85 25.112499999999997 23.4875 108-109 25.912499999999998 25.7375 24.7 23.65 110-111 25.424999999999997 25.35 24.975 24.25 112-113 25.9875 26.087500000000002 24.1375 23.7875 114-115 26.325 25.112499999999997 24.925 23.6375 116-117 26.525 25.387500000000003 25.05 23.0375 118-119 27.6375 25.1 23.9875 23.275000000000002 120-121 26.0625 26.325 24.3125 23.3 122-123 27.79792422158309 25.372014505439537 24.484181568088033 22.345879704889335 124-125 26.8375 26.0375 24.15 22.975 126 26.25 25.6 24.099999999999998 24.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 2.5 26 4.0 27 2.0 28 3.5 29 3.0 30 3.5 31 9.0 32 14.5 33 25.5 34 33.5 35 34.0 36 46.0 37 67.5 38 79.5 39 94.0 40 115.0 41 125.5 42 139.5 43 162.5 44 178.0 45 184.0 46 191.0 47 190.5 48 175.0 49 162.0 50 147.5 51 130.0 52 113.0 53 111.0 54 105.0 55 98.0 56 94.5 57 85.0 58 80.5 59 83.0 60 83.0 61 71.5 62 75.0 63 74.0 64 70.5 65 79.5 66 71.0 67 58.5 68 59.0 69 50.0 70 41.0 71 38.0 72 34.0 73 30.0 74 21.5 75 13.5 76 11.0 77 8.5 78 5.0 79 2.5 80 2.0 81 2.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0375 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8500000000000001 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650603 spots for SRR7692627.sra Written 650603 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra Read 650602 spots for SRR7692627.sra Written 650602 spots for SRR7692627.sra SRR ids: ['SRR7692627.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__2_j43xj SRR7692627.sra spots: 13012041 blocks: [[1, 650602], [650603, 1301204], [1301205, 1951806], [1951807, 2602408], [2602409, 3253010], [3253011, 3903612], [3903613, 4554214], [4554215, 5204816], [5204817, 5855418], [5855419, 6506020], [6506021, 7156622], [7156623, 7807224], [7807225, 8457826], [8457827, 9108428], [9108429, 9759030], [9759031, 10409632], [10409633, 11060234], [11060235, 11710836], [11710837, 12361438], [12361439, 13012041]] SRR7692627 file size 4150545 SRR7692627 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692627 SRR7692627_1.fastq SRR7692627_2.fastq Input file: SRR7692627_1.fastq Paired file: SRR7692627_2.fastq trimmed: SRR7692627-trimmed-pair1.fastq, SRR7692627-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:50:13 2024 >> started Mon Dec 9 15:50:26 2024 >> done (12.670s) 13012041 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 83 ( 0.00%) empty read pairs filtered out after trimming by size control 13011955 (100.00%) read pairs available; of these: 1218172 ( 9.36%) trimmed read pairs available after processing 11793783 (90.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 2 0.00% 36 3 0.00% 37 5 0.00% 38 4 0.00% 39 10 0.00% 40 6 0.00% 41 9 0.00% 42 6 0.00% 43 4 0.00% 44 6 0.00% 45 5 0.00% 46 6 0.00% 47 8 0.00% 48 8 0.00% 49 11 0.00% 50 14 0.00% 51 14 0.00% 52 17 0.00% 53 17 0.00% 54 27 0.00% 55 22 0.00% 56 29 0.00% 57 26 0.00% 58 32 0.00% 59 34 0.00% 60 37 0.00% 61 57 0.00% 62 77 0.00% 63 74 0.00% 64 84 0.00% 65 110 0.00% 66 111 0.00% 67 129 0.00% 68 133 0.00% 69 159 0.00% 70 166 0.00% 71 170 0.00% 72 159 0.00% 73 186 0.00% 74 231 0.00% 75 225 0.00% 76 307 0.00% 77 330 0.00% 78 372 0.00% 79 450 0.00% 80 450 0.00% 81 567 0.00% 82 662 0.01% 83 756 0.01% 84 922 0.01% 85 1025 0.01% 86 1192 0.01% 87 1366 0.01% 88 1524 0.01% 89 1769 0.01% 90 2040 0.02% 91 2433 0.02% 92 2929 0.02% 93 3317 0.03% 94 4006 0.03% 95 4797 0.04% 96 5593 0.04% 97 6525 0.05% 98 7323 0.06% 99 8577 0.07% 100 9868 0.08% 101 11240 0.09% 102 13293 0.10% 103 15162 0.12% 104 17016 0.13% 105 19175 0.15% 106 21879 0.17% 107 24730 0.19% 108 26981 0.21% 109 30360 0.23% 110 33176 0.25% 111 35680 0.27% 112 39220 0.30% 113 42906 0.33% 114 47127 0.36% 115 51232 0.39% 116 54463 0.42% 117 57972 0.45% 118 62593 0.48% 119 65441 0.50% 120 68526 0.53% 121 73530 0.57% 122 76519 0.59% 123 80768 0.62% 124 85818 0.66% 125 91829 0.71% 126 11793783 90.64% 13011955 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=3.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=106.19 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=12.3 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACCGGAACC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=7.09 fanout-score-rank=9 prefix-density=0.47 prefix-fanout=4.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=59.03 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=12.1 sequence=CCGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGTTCCGTTCGCTATCCCTATGAATGAATGAAAAA SRR7692627 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:51:11 Started mapping on | Dec 09 15:51:12 Finished on | Dec 09 15:52:25 Mapping speed, Million of reads per hour | 641.69 Number of input reads | 13011955 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 12572997 Uniquely mapped reads % | 96.63% Average mapped length | 249.50 Number of splices: Total | 10841321 Number of splices: Annotated (sjdb) | 10259755 Number of splices: GT/AG | 10692756 Number of splices: GC/AG | 130092 Number of splices: AT/AC | 4611 Number of splices: Non-canonical | 13862 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 184056 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 14249 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 254903 254903 254903 N_multimapping 184056 184056 184056 N_noFeature 519425 12260577 600713 N_ambiguous 269204 1282 38488 UnstrandedReadsAssigned:11784368 PositiveStrandReadsAssigned:311138 NegativeStrandReadsAssigned:11933796 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692627 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692627-trimmed-pair1.fastq SRR7692627-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,011,955 reads, 12,055,033 reads pseudoaligned [quant] estimated average fragment length: 159.055 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR7692627.ke.tsv 35125 SRR7692627.se.tsv 88098 total ==> SRR7692627.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 778.187 0 0 PNS24247 1044 885.945 31.8765 4.48748 PNS24249 1928 1769.94 103.019 7.25936 PNS24246 1044 885.945 31.8765 4.48748 PNS24248 1044 885.945 31.8765 4.48748 PNS24244 1471 1312.94 26.3511 2.50318 PNS24243 293 136.715 0 0 KQK14069 1603 1444.94 7126.64 615.138 KQK14071 474 317.242 402.14 158.098 ==> SRR7692627.se.tsv <== BRADI_1g14170v3 8102 BRADI_1g53295v3 96 BRADI_1g59795v3 326 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 82 BRADI_1g74790v3 106 BRADI_1g09890v3 0 BRADI_1g77505v3 301 BRADI_1g48960v3 0 SRR7692627 completed mapping pipeline successfully