Starting /dee2/code/volunteer_pipeline.sh SRR7692642 current disk space = 1523409264640 free memory = 1605386884 SRR7692642 SRAfilesize 6c515610032679aa5d84a91303d403a5 SRR7692642.sra SRR7692642.sra file validated SRR7692642 is paired end SRR7692642 is conventional basespace SRR7692642 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692642_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.155 32.0 25.0 33.0 18.0 33.0 2 26.94625 29.0 25.0 31.0 18.0 33.0 3 29.596 31.0 29.0 33.0 25.0 33.0 4 31.15325 33.0 31.0 33.0 29.0 33.0 5 32.113 33.0 32.0 33.0 31.0 33.0 6 35.6225 38.0 35.0 38.0 31.0 38.0 7 36.58275 38.0 37.0 38.0 34.0 38.0 8 37.09275 38.0 38.0 38.0 36.0 38.0 9 37.31775 38.0 38.0 38.0 36.0 38.0 10-11 37.389125 38.0 38.0 38.0 36.5 38.0 12-13 37.447874999999996 38.0 38.0 38.0 37.0 38.0 14-15 37.462625 38.0 38.0 38.0 37.0 38.0 16-17 37.462625 38.0 38.0 38.0 37.0 38.0 18-19 37.4585 38.0 38.0 38.0 37.0 38.0 20-21 37.443124999999995 38.0 38.0 38.0 37.0 38.0 22-23 37.45875 38.0 38.0 38.0 37.0 38.0 24-25 37.506125 38.0 38.0 38.0 37.5 38.0 26-27 37.471125 38.0 38.0 38.0 37.0 38.0 28-29 37.417375 38.0 38.0 38.0 37.0 38.0 30-31 37.482375000000005 38.0 38.0 38.0 37.5 38.0 32-33 37.475125 38.0 38.0 38.0 37.0 38.0 34-35 37.299125000000004 38.0 38.0 38.0 37.0 38.0 36-37 37.469625 38.0 38.0 38.0 37.0 38.0 38-39 37.413 38.0 38.0 38.0 37.0 38.0 40-41 37.418000000000006 38.0 38.0 38.0 37.0 38.0 42-43 37.3125 38.0 38.0 38.0 37.0 38.0 44-45 37.417375 38.0 38.0 38.0 37.0 38.0 46-47 37.401250000000005 38.0 38.0 38.0 37.0 38.0 48-49 37.378375 38.0 38.0 38.0 37.0 38.0 50-51 37.370125 38.0 38.0 38.0 37.0 38.0 52-53 37.40175 38.0 38.0 38.0 37.0 38.0 54-55 37.437125 38.0 38.0 38.0 37.0 38.0 56-57 37.375625 38.0 38.0 38.0 37.0 38.0 58-59 37.369125 38.0 38.0 38.0 37.0 38.0 60-61 37.289249999999996 38.0 38.0 38.0 36.5 38.0 62-63 37.418 38.0 38.0 38.0 37.0 38.0 64-65 37.28425 38.0 38.0 38.0 36.5 38.0 66-67 37.293375 38.0 38.0 38.0 36.5 38.0 68-69 37.275625 38.0 38.0 38.0 36.0 38.0 70-71 37.287125 38.0 38.0 38.0 37.0 38.0 72-73 37.27725 38.0 38.0 38.0 36.0 38.0 74-75 37.222624999999994 38.0 38.0 38.0 36.0 38.0 76-77 37.171375 38.0 38.0 38.0 36.0 38.0 78-79 37.199625 38.0 38.0 38.0 36.0 38.0 80-81 37.206999999999994 38.0 38.0 38.0 36.0 38.0 82-83 37.186625 38.0 38.0 38.0 36.0 38.0 84-85 37.1845 38.0 38.0 38.0 36.0 38.0 86-87 37.14375 38.0 38.0 38.0 36.0 38.0 88-89 37.123875 38.0 38.0 38.0 36.0 38.0 90-91 37.15175 38.0 38.0 38.0 36.0 38.0 92-93 37.103125000000006 38.0 38.0 38.0 35.5 38.0 94-95 36.969125 38.0 38.0 38.0 35.5 38.0 96-97 37.0245 38.0 38.0 38.0 35.0 38.0 98-99 36.849000000000004 38.0 38.0 38.0 35.0 38.0 100-101 36.878625 38.0 38.0 38.0 35.0 38.0 102-103 36.718 38.0 38.0 38.0 34.0 38.0 104-105 36.69425 38.0 38.0 38.0 34.0 38.0 106-107 36.609625 38.0 38.0 38.0 34.0 38.0 108-109 36.533 38.0 38.0 38.0 34.0 38.0 110-111 36.531375 38.0 38.0 38.0 34.0 38.0 112-113 36.623374999999996 38.0 38.0 38.0 34.0 38.0 114-115 36.486875 38.0 38.0 38.0 34.0 38.0 116-117 36.558875 38.0 38.0 38.0 34.0 38.0 118-119 36.354124999999996 38.0 37.0 38.0 34.0 38.0 120-121 36.35225 38.0 38.0 38.0 34.0 38.0 122-123 36.21275 38.0 37.0 38.0 33.5 38.0 124-125 36.316875 38.0 37.0 38.0 34.0 38.0 126 32.04975 35.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 2.0 26 11.0 27 6.0 28 11.0 29 11.0 30 26.0 31 30.0 32 46.0 33 72.0 34 116.0 35 214.0 36 668.0 37 2782.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.37185929648241 10.703517587939698 8.115577889447236 41.80904522613066 2 25.0 13.0 35.975 26.025 3 22.400000000000002 16.725 23.549999999999997 37.325 4 27.200000000000003 24.525 21.4 26.875 5 25.775 29.349999999999998 23.425 21.45 6 20.7 32.425 24.6 22.275 7 20.150000000000002 22.975 36.3 20.575 8 21.325 22.400000000000002 29.525000000000002 26.75 9 21.224999999999998 20.65 32.975 25.15 10-11 24.5625 28.449999999999996 22.55 24.4375 12-13 24.275 22.037499999999998 26.25 27.437499999999996 14-15 23.2625 24.5 26.1 26.137500000000003 16-17 24.325 25.0625 25.3 25.3125 18-19 25.0125 24.2375 25.137500000000003 25.6125 20-21 24.4375 25.5375 25.637500000000003 24.3875 22-23 24.4875 24.65 25.25 25.6125 24-25 24.15 24.4375 24.2375 27.175 26-27 24.9 24.6625 24.962500000000002 25.474999999999998 28-29 24.6125 25.074999999999996 25.6125 24.7 30-31 23.549999999999997 24.925 24.625 26.900000000000002 32-33 23.5875 25.2875 25.8 25.324999999999996 34-35 25.084575867685754 24.771331913294073 24.6084450570104 25.535647162009774 36-37 23.962500000000002 25.112499999999997 24.2375 26.687499999999996 38-39 24.223835753630446 24.586880320480724 25.826239359038556 25.363044566850274 40-41 24.425 25.0 24.15 26.424999999999997 42-43 24.887500000000003 24.2625 24.925 25.924999999999997 44-45 24.4375 24.962500000000002 25.087500000000002 25.5125 46-47 24.70308788598575 25.103137892236532 24.86560820102513 25.328166020752597 48-49 24.127143035915406 24.677762482793142 25.003128519584532 26.19196596170692 50-51 23.71778834125594 24.54340755566675 25.006254691018263 26.732549412059043 52-53 25.428392745465917 24.47779862414009 24.027517198248905 26.06629143214509 54-55 24.66558319789974 24.765595699462434 24.37804725590699 26.190773846730842 56-57 24.6125 24.8125 24.712500000000002 25.8625 58-59 24.574787393696848 24.84992496248124 25.0 25.57528764382191 60-61 24.5125 24.099999999999998 24.725 26.6625 62-63 25.203150393799223 24.715589448681087 23.902987873484186 26.178272284035504 64-65 24.518629657414355 24.543635908977244 24.281070267566893 26.65666416604151 66-67 24.637318659329665 24.074537268634316 25.350175087543768 25.937968984492244 68-69 24.2625 24.675 24.474999999999998 26.5875 70-71 24.3875 25.8 24.1375 25.674999999999997 72-73 25.025 24.0625 24.5 26.4125 74-75 24.275 24.4875 24.7375 26.5 76-77 24.7375 24.2 24.762500000000003 26.3 78-79 24.4125 24.637500000000003 24.95 26.0 80-81 24.6125 24.0625 24.8125 26.5125 82-83 24.4375 24.9875 24.5125 26.0625 84-85 25.337500000000002 24.325 24.7 25.637500000000003 86-87 24.65 24.85 25.15 25.35 88-89 24.7375 25.412499999999998 24.212500000000002 25.637500000000003 90-91 24.349999999999998 24.587500000000002 24.675 26.387500000000003 92-93 24.6875 24.3625 24.55 26.400000000000002 94-95 25.8625 23.8375 24.975 25.324999999999996 96-97 24.7875 23.45 24.925 26.8375 98-99 24.1875 24.5125 25.587500000000002 25.7125 100-101 25.4875 24.962500000000002 24.4875 25.0625 102-103 25.6 24.224999999999998 24.55 25.624999999999996 104-105 25.7 24.0375 24.4875 25.775 106-107 25.224999999999998 24.7375 23.25 26.787499999999998 108-109 26.224999999999998 24.4125 23.6875 25.674999999999997 110-111 24.65 24.587500000000002 25.2125 25.55 112-113 24.6125 24.975 24.7875 25.624999999999996 114-115 25.387500000000003 24.099999999999998 24.1875 26.325 116-117 25.2125 24.0625 23.95 26.775 118-119 25.8625 25.2125 23.2375 25.687500000000004 120-121 24.474999999999998 25.174999999999997 24.6125 25.7375 122-123 25.05 25.387500000000003 23.8375 25.724999999999998 124-125 25.825 24.7 23.724999999999998 25.75 126 24.775 25.900000000000002 24.125 25.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.0 28 3.0 29 4.5 30 5.5 31 10.0 32 16.5 33 21.5 34 27.5 35 33.5 36 48.5 37 64.0 38 83.0 39 105.0 40 116.0 41 137.0 42 159.0 43 168.5 44 178.0 45 181.5 46 190.5 47 190.0 48 172.0 49 156.5 50 131.5 51 125.0 52 116.5 53 99.0 54 100.5 55 99.0 56 90.5 57 91.0 58 86.5 59 74.5 60 78.0 61 88.0 62 80.5 63 63.5 64 66.5 65 70.0 66 55.0 67 50.0 68 57.5 69 47.5 70 42.0 71 47.5 72 34.0 73 24.5 74 26.0 75 19.5 76 16.0 77 14.5 78 10.5 79 6.0 80 3.0 81 2.5 82 2.0 83 1.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.2375 36-37 0.0 38-39 0.15 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.11249999999999999 50-51 0.075 52-53 0.0625 54-55 0.0125 56-57 0.0 58-59 0.05 60-61 0.0 62-63 0.0125 64-65 0.025 66-67 0.05 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9750000000000001 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCTT 15 0.0039514517 60.000004 28-29 >>END_MODULE SRR7692642 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7692642_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75425 33.0 33.0 34.0 32.0 34.0 2 32.81275 33.0 33.0 34.0 32.0 34.0 3 32.7815 33.0 33.0 34.0 32.0 34.0 4 32.70225 33.0 33.0 34.0 32.0 34.0 5 32.773 33.0 33.0 34.0 32.0 34.0 6 36.97875 38.0 38.0 38.0 36.0 38.0 7 36.947 38.0 38.0 38.0 36.0 38.0 8 36.90725 38.0 38.0 38.0 36.0 38.0 9 36.7965 38.0 38.0 38.0 35.0 38.0 10-11 36.9355 38.0 38.0 38.0 36.0 38.0 12-13 36.933375 38.0 38.0 38.0 36.0 38.0 14-15 36.775875 38.0 38.0 38.0 35.0 38.0 16-17 36.88375 38.0 38.0 38.0 36.0 38.0 18-19 36.867374999999996 38.0 38.0 38.0 36.0 38.0 20-21 36.924875 38.0 38.0 38.0 36.0 38.0 22-23 36.841625 38.0 38.0 38.0 35.5 38.0 24-25 36.923125 38.0 38.0 38.0 36.0 38.0 26-27 36.92475 38.0 38.0 38.0 36.0 38.0 28-29 37.02725 38.0 38.0 38.0 36.0 38.0 30-31 37.087125 38.0 38.0 38.0 36.0 38.0 32-33 37.008624999999995 38.0 38.0 38.0 36.0 38.0 34-35 37.04675 38.0 38.0 38.0 36.0 38.0 36-37 37.087 38.0 38.0 38.0 36.5 38.0 38-39 37.061125000000004 38.0 38.0 38.0 36.0 38.0 40-41 37.069500000000005 38.0 38.0 38.0 36.5 38.0 42-43 37.1195 38.0 38.0 38.0 37.0 38.0 44-45 37.054874999999996 38.0 38.0 38.0 36.5 38.0 46-47 37.063500000000005 38.0 38.0 38.0 36.0 38.0 48-49 37.07775 38.0 38.0 38.0 36.5 38.0 50-51 37.08225 38.0 38.0 38.0 36.5 38.0 52-53 37.104625 38.0 38.0 38.0 36.5 38.0 54-55 37.069874999999996 38.0 38.0 38.0 36.0 38.0 56-57 37.037625000000006 38.0 38.0 38.0 36.0 38.0 58-59 37.06775 38.0 38.0 38.0 36.0 38.0 60-61 37.101625 38.0 38.0 38.0 36.0 38.0 62-63 37.09425 38.0 38.0 38.0 36.0 38.0 64-65 37.037875 38.0 38.0 38.0 36.0 38.0 66-67 36.962 38.0 38.0 38.0 36.0 38.0 68-69 36.98225 38.0 38.0 38.0 36.0 38.0 70-71 36.931 38.0 38.0 38.0 36.0 38.0 72-73 36.9185 38.0 38.0 38.0 36.0 38.0 74-75 36.919375 38.0 38.0 38.0 36.0 38.0 76-77 36.917 38.0 38.0 38.0 36.0 38.0 78-79 36.843374999999995 38.0 38.0 38.0 35.5 38.0 80-81 36.902375 38.0 38.0 38.0 36.0 38.0 82-83 36.876999999999995 38.0 38.0 38.0 35.5 38.0 84-85 36.744375000000005 38.0 38.0 38.0 35.0 38.0 86-87 36.789249999999996 38.0 38.0 38.0 35.0 38.0 88-89 36.81975 38.0 38.0 38.0 35.5 38.0 90-91 36.758250000000004 38.0 38.0 38.0 35.0 38.0 92-93 36.619625 38.0 38.0 38.0 34.5 38.0 94-95 36.668499999999995 38.0 38.0 38.0 35.0 38.0 96-97 36.60175 38.0 38.0 38.0 35.0 38.0 98-99 36.56 38.0 38.0 38.0 34.0 38.0 100-101 36.484125 38.0 38.0 38.0 34.0 38.0 102-103 36.58375 38.0 38.0 38.0 34.0 38.0 104-105 36.47475 38.0 38.0 38.0 34.0 38.0 106-107 36.429125 38.0 38.0 38.0 34.0 38.0 108-109 36.306 38.0 38.0 38.0 34.0 38.0 110-111 36.285 38.0 38.0 38.0 33.5 38.0 112-113 36.324250000000006 38.0 38.0 38.0 33.5 38.0 114-115 36.109875 38.0 37.5 38.0 33.0 38.0 116-117 35.93125 38.0 36.5 38.0 33.0 38.0 118-119 36.072 38.0 37.0 38.0 32.5 38.0 120-121 35.97625 38.0 37.5 38.0 32.0 38.0 122-123 35.522 38.0 36.0 38.0 30.0 38.0 124-125 35.330125 38.0 35.5 38.0 30.0 38.0 126 30.62625 34.0 25.0 38.0 13.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10-11 0.0 2203 12-13 0.0 2203 14-15 0.0 2203 16-17 0.0 2203 18-19 0.0 2203 20-21 0.0 2203 22-23 0.0 2203 24-25 0.0 2203 26-27 0.0 2203 28-29 0.0 2203 30-31 0.0 2203 32-33 0.0 2203 34-35 0.0 2203 36-37 0.0 2203 38-39 0.0 2203 40-41 0.0 2203 42-43 0.0 2203 44-45 0.0 2203 46-47 0.0 2203 48-49 0.0 2203 50-51 0.0 2203 52-53 0.0 2203 54-55 0.0 2203 56-57 0.0 2203 58-59 0.0 2203 60-61 0.0 2203 62-63 0.0 2203 64-65 0.0 2203 66-67 0.0 2203 68-69 0.0 2203 70-71 0.0 2203 72-73 0.0 2203 74-75 0.0 2203 76-77 0.0 2203 78-79 0.0 2203 80-81 0.0 2203 82-83 0.0 2203 84-85 0.0 2203 86-87 0.0 2203 88-89 0.0 2203 90-91 0.0 2203 92-93 0.0 2203 94-95 0.0 2203 96-97 0.0 2203 98-99 0.0 2203 100-101 0.0 2203 102-103 0.0 2203 104-105 0.0 2203 106-107 0.0 2203 108-109 0.0 2203 110-111 0.0 2203 112-113 0.0 2203 114-115 0.0 2203 116-117 0.0 2203 118-119 0.0 2203 120-121 0.0 2203 122-123 0.0 2203 124-125 0.0 2203 126 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 6.0 17 3.0 18 8.0 19 8.0 20 8.0 21 3.0 22 11.0 23 12.0 24 9.0 25 9.0 26 10.0 27 18.0 28 15.0 29 19.0 30 26.0 31 35.0 32 54.0 33 74.0 34 108.0 35 200.0 36 486.0 37 2876.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.375 17.299999999999997 11.525 38.800000000000004 2 29.725 24.25 26.8 19.225 3 22.650000000000002 26.25 25.85 25.25 4 27.200000000000003 28.425 20.349999999999998 24.025 5 28.199999999999996 30.425 20.525 20.849999999999998 6 22.925 34.150000000000006 20.525 22.400000000000002 7 23.724999999999998 17.9 33.650000000000006 24.725 8 25.624999999999996 21.55 24.975 27.85 9 24.75 22.0 26.85 26.400000000000002 10-11 26.737499999999997 27.237499999999997 20.9875 25.0375 12-13 26.700000000000003 21.837500000000002 24.337500000000002 27.125 14-15 26.875 24.05 24.762500000000003 24.3125 16-17 27.5125 23.8875 23.6625 24.9375 18-19 26.25 25.137500000000003 23.2625 25.35 20-21 25.7 25.7125 23.6625 24.925 22-23 26.25 24.025 23.9125 25.8125 24-25 25.7875 24.6875 24.025 25.5 26-27 26.0375 25.3125 23.65 25.0 28-29 26.375 23.8375 24.5125 25.275 30-31 25.887500000000003 25.025 23.875 25.2125 32-33 25.937500000000004 25.025 24.325 24.712500000000002 34-35 26.187500000000004 23.7125 23.7125 26.387500000000003 36-37 25.224999999999998 25.112499999999997 24.462500000000002 25.2 38-39 25.887500000000003 25.05 24.1875 24.875 40-41 26.2125 25.0 23.25 25.5375 42-43 25.6125 24.637500000000003 24.4 25.35 44-45 26.5125 25.9625 23.3375 24.1875 46-47 26.0125 24.4375 23.9375 25.6125 48-49 25.687500000000004 25.2625 23.7625 25.2875 50-51 26.5375 25.087500000000002 23.8125 24.5625 52-53 26.187500000000004 24.125 23.674999999999997 26.0125 54-55 25.575 24.4875 24.762500000000003 25.174999999999997 56-57 25.7625 24.3875 24.587500000000002 25.2625 58-59 26.437500000000004 24.625 23.75 25.1875 60-61 25.7625 23.9125 25.087500000000002 25.2375 62-63 27.2625 24.4875 24.5125 23.7375 64-65 26.337500000000002 24.525 23.65 25.4875 66-67 26.137500000000003 24.212500000000002 24.425 25.224999999999998 68-69 26.087500000000002 24.712500000000002 23.95 25.25 70-71 25.4375 23.8375 24.962500000000002 25.7625 72-73 26.5875 24.462500000000002 23.5 25.45 74-75 26.25 23.65 25.087500000000002 25.0125 76-77 26.1125 24.375 23.849999999999998 25.662499999999998 78-79 25.937500000000004 24.5 25.0125 24.55 80-81 25.75 24.6125 24.875 24.762500000000003 82-83 26.5625 24.0625 24.425 24.95 84-85 25.5625 24.962500000000002 24.05 25.424999999999997 86-87 25.974999999999998 24.712500000000002 24.95 24.3625 88-89 26.437500000000004 24.3 23.8625 25.4 90-91 25.525 24.1375 25.575 24.762500000000003 92-93 25.75 24.825 24.3625 25.0625 94-95 27.1375 24.9125 23.8625 24.087500000000002 96-97 25.912499999999998 25.25 24.3 24.5375 98-99 26.625 24.875 24.15 24.349999999999998 100-101 26.437500000000004 24.975 23.875 24.712500000000002 102-103 25.8 24.625 25.1 24.474999999999998 104-105 25.900000000000002 23.849999999999998 25.5625 24.6875 106-107 26.8125 23.962500000000002 24.224999999999998 25.0 108-109 25.9875 25.424999999999997 23.7625 24.825 110-111 26.650000000000002 25.2875 24.2 23.8625 112-113 26.2875 24.349999999999998 24.3625 25.0 114-115 25.900000000000002 25.75 24.3875 23.962500000000002 116-117 25.7875 25.825 23.925 24.462500000000002 118-119 25.6 25.6125 23.974999999999998 24.8125 120-121 25.387500000000003 24.875 24.7875 24.95 122-123 25.95324415551944 24.953119139892486 24.765595699462434 24.32804100512564 124-125 27.675 24.474999999999998 24.587500000000002 23.2625 126 25.724999999999998 25.074999999999996 24.474999999999998 24.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 1.0 25 2.5 26 4.0 27 3.5 28 3.5 29 3.5 30 5.5 31 6.5 32 13.0 33 18.0 34 20.5 35 31.0 36 40.0 37 58.0 38 78.5 39 93.0 40 107.0 41 127.0 42 142.5 43 161.5 44 177.0 45 177.5 46 185.0 47 168.5 48 170.5 49 169.0 50 150.0 51 146.0 52 117.5 53 90.5 54 97.0 55 91.0 56 68.5 57 75.5 58 84.5 59 87.5 60 91.0 61 86.5 62 86.0 63 79.0 64 65.0 65 63.0 66 68.0 67 75.5 68 64.5 69 55.0 70 52.5 71 49.0 72 47.0 73 36.0 74 23.0 75 18.5 76 17.0 77 10.0 78 9.5 79 9.5 80 6.0 81 3.5 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0125 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6045340050377833 1.2 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra Read 385384 spots for SRR7692642.sra Written 385384 spots for SRR7692642.sra SRR ids: ['SRR7692642.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4v37qhuu SRR7692642.sra spots: 7707680 blocks: [[1, 385384], [385385, 770768], [770769, 1156152], [1156153, 1541536], [1541537, 1926920], [1926921, 2312304], [2312305, 2697688], [2697689, 3083072], [3083073, 3468456], [3468457, 3853840], [3853841, 4239224], [4239225, 4624608], [4624609, 5009992], [5009993, 5395376], [5395377, 5780760], [5780761, 6166144], [6166145, 6551528], [6551529, 6936912], [6936913, 7322296], [7322297, 7707680]] SRR7692642 file size 2456396 SRR7692642 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7692642 SRR7692642_1.fastq SRR7692642_2.fastq Input file: SRR7692642_1.fastq Paired file: SRR7692642_2.fastq trimmed: SRR7692642-trimmed-pair1.fastq, SRR7692642-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 15:54:49 2024 >> started Mon Dec 9 15:54:58 2024 >> done (8.665s) 7707680 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 34 ( 0.00%) empty read pairs filtered out after trimming by size control 7707643 (100.00%) read pairs available; of these: 390920 ( 5.07%) trimmed read pairs available after processing 7316723 (94.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 0 0.00% 32 2 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 2 0.00% 38 0 0.00% 39 1 0.00% 40 4 0.00% 41 4 0.00% 42 3 0.00% 43 1 0.00% 44 7 0.00% 45 3 0.00% 46 4 0.00% 47 6 0.00% 48 8 0.00% 49 7 0.00% 50 6 0.00% 51 15 0.00% 52 7 0.00% 53 13 0.00% 54 14 0.00% 55 9 0.00% 56 15 0.00% 57 16 0.00% 58 14 0.00% 59 19 0.00% 60 39 0.00% 61 22 0.00% 62 27 0.00% 63 40 0.00% 64 69 0.00% 65 60 0.00% 66 79 0.00% 67 73 0.00% 68 80 0.00% 69 100 0.00% 70 117 0.00% 71 110 0.00% 72 139 0.00% 73 165 0.00% 74 167 0.00% 75 188 0.00% 76 227 0.00% 77 249 0.00% 78 252 0.00% 79 316 0.00% 80 376 0.00% 81 416 0.01% 82 502 0.01% 83 543 0.01% 84 618 0.01% 85 749 0.01% 86 815 0.01% 87 912 0.01% 88 1027 0.01% 89 1145 0.01% 90 1321 0.02% 91 1423 0.02% 92 1652 0.02% 93 1926 0.02% 94 2142 0.03% 95 2339 0.03% 96 2574 0.03% 97 2917 0.04% 98 3190 0.04% 99 3398 0.04% 100 3753 0.05% 101 4199 0.05% 102 4551 0.06% 103 5174 0.07% 104 5548 0.07% 105 5952 0.08% 106 6793 0.09% 107 7186 0.09% 108 7912 0.10% 109 8626 0.11% 110 9517 0.12% 111 10394 0.13% 112 11524 0.15% 113 12639 0.16% 114 13541 0.18% 115 15288 0.20% 116 16507 0.21% 117 17829 0.23% 118 19194 0.25% 119 20164 0.26% 120 21638 0.28% 121 22940 0.30% 122 24172 0.31% 123 25872 0.34% 124 27619 0.36% 125 29700 0.39% 126 7316723 94.93% 7707643 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.58 fanout-score-rank=16 prefix-density=0.50 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=56.65 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.7 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=29 prefix-density=0.38 prefix-fanout=2.6 sequence=CCCTCGAGAACCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=76.55 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.8 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR7692642 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 15:59:46 Started mapping on | Dec 09 15:59:46 Finished on | Dec 09 16:00:27 Mapping speed, Million of reads per hour | 676.77 Number of input reads | 7707643 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 7496985 Uniquely mapped reads % | 97.27% Average mapped length | 250.30 Number of splices: Total | 6556016 Number of splices: Annotated (sjdb) | 6236169 Number of splices: GT/AG | 6468384 Number of splices: GC/AG | 77996 Number of splices: AT/AC | 2307 Number of splices: Non-canonical | 7329 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 85781 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 5672 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 124877 124877 124877 N_multimapping 85781 85781 85781 N_noFeature 245831 7320916 288570 N_ambiguous 157803 704 24726 UnstrandedReadsAssigned:7093351 PositiveStrandReadsAssigned:175365 NegativeStrandReadsAssigned:7183689 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR7692642 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7692642-trimmed-pair1.fastq SRR7692642-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,707,643 reads, 7,233,412 reads pseudoaligned [quant] estimated average fragment length: 173.417 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52973 SRR7692642.ke.tsv 35125 SRR7692642.se.tsv 88098 total ==> SRR7692642.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 763.702 0 0 PNS24247 1044 871.583 19.0729 4.4232 PNS24249 1928 1755.58 56.5664 6.51279 PNS24246 1044 871.583 19.0729 4.4232 PNS24248 1044 871.583 19.0729 4.4232 PNS24244 1471 1298.58 25.2151 3.92483 PNS24243 293 122.482 0 0 KQK14069 1603 1430.58 1180.26 166.762 KQK14071 474 302.835 70.2533 46.8911 ==> SRR7692642.se.tsv <== BRADI_1g14170v3 1342 BRADI_1g53295v3 42 BRADI_1g59795v3 187 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 43 BRADI_1g74790v3 79 BRADI_1g09890v3 0 BRADI_1g77505v3 124 BRADI_1g48960v3 0 SRR7692642 completed mapping pipeline successfully